SSR primer and method for identifying purity of pw1801 spinach hybrid

Abstract

According to the SSR primer and the method for identifying the purity of the pw1801 spinach hybrid, provided by the invention, the primer which can simultaneously show specific bands of a male parent and a female parent in the pw1801 spinach hybrid and has relatively strong specificity is screened and used; therefore, the problems of great influence of factors such as external environment, planting season, planting technology and experience, large workload, long period and the like caused by morphological identification of the seed purity are solved, so that the seed purity of the pw1801 spinach hybrid can be rapidly and accurately identified within one or two hours; the method has the advantages of rapidness, stability, simplicity in operation, low cost, no environmental influence and the like, can be used for efficiently detecting the seed purity of the pw1801 spinach hybrid, and has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an SSR primer and a method for identifying the purity of a pw1801 spinach hybrid. Background Art

[0002] Spinach belongs to the genus Spinach of the subfamily Chenopodoideae of the Amaranthaceae family. It is an annual or biennial herb whose main edible parts are green leaves and tender stems.

[0003] Spinach is divided into the following types according to sex: all-female plants, all-male plants, hermaphroditic plants, and vegetative male plants. Therefore, it is very important to remove impurities during field production. In the process of hybrid production, all-male plants should be removed in time, and vegetative male plants should be removed in time after pollination. However, since spinach sex differentiation is easily affected by external environmental factors, there is a situation where impurities are not removed thoroughly, and there is also a situation where vegetative male plants are not completely removed after pollination, which will have a certain degree of influence on the purity of the hybrid produced. Traditional seed purity identification is generally carried out in the field based on phenotype, and it is necessary to observe one or more of its traits when the crop grows to a certain stage to judge the seed purity. This method has the defects of long cycle, large workload, large influence of environmental factors, and large influence of experience factors.

[0004] Pw1801 spinach is a new variety independently cultivated by Wuxi Puwei Agricultural Technology Co., Ltd. It belongs to the bundled spinach variety, with long round leaves, bright green color, good commercial quality, fast growth rate, and can be harvested about 45 days after germination. It has strong disease resistance and is suitable for open-field cultivation in September in Henan, Shandong, Hebei, Hubei, Sichuan and other places. The seed purity of this variety has always been identified by morphology. With the increase in sowing area and seed demand, it is urgent to explore a purity identification method that is fast, accurate and not easily affected by external factors. Summary of the invention

[0005] In response to the above technical problems, the present invention provides SSR primers and methods for identifying the purity of pw1801 spinach hybrids, so as to overcome the problems that the morphological identification of seed purity in the prior art is greatly affected by factors such as the external environment, planting season, planting technology and experience, and has a large workload and a long cycle. Therefore, the seed purity of pw1801 spinach hybrids can be quickly and accurately identified within one or two hours, and has broad application prospects.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] The SSR primers for identifying the purity of pw1801 spinach hybrid provided by the present invention include an upstream primer SP029-F and a downstream primer SP029-R, wherein:

[0008] The upstream primer SSR-F is: CGGAGGGGAGAAGGTTTGAG;

[0009] The downstream primer SSR-R is: ACCAACAATGCTGATTCCCA.

[0010] A method for identifying the purity of PW1801 spinach hybrids, comprising:

[0011] (1) Extracting genomic DNA of the test sample pw1801 spinach hybrid;

[0012] (2) using the primers described in claim 1 to perform PCR amplification on the genomic DNA of the pw1801 spinach hybrid obtained in step (1);

[0013] (3) using 8% polyacrylamide gel to separate the PCR amplification products of step (2) by electrophoresis and silver staining;

[0014] (4) Statistical results, calculate the purity of pw1801 spinach hybrids, seed purity (%) = (total number of tested seeds - number of non-hybrids - number of foreign hybrids) / total number of tested seeds × 100%;

[0015] The step (2) uses a 10 μl reaction system: 5 μl of 2×Taq Master Mix, 0.5 μl of each of the 10 μM upstream primer and the downstream primer, 1.5 μl of genomic DNA, and 2.5 μl of 0.1 μM Tris-HCl (pH=8.0);

[0016] The PCR reaction program is:

[0017] Stage 1: pre-denaturation at 95°C for 5 min;

[0018] The second stage: denaturation at 94°C for 30 seconds; annealing at 60°C for 30 seconds; extension at 72°C for 1 minute; this stage was repeated for 33 cycles;

[0019] Stage 3: extension at 72°C for 7 min;

[0020] Stage 4: Keep warm at 4°C.

[0021] In the above method for identifying the purity of pw1801 spinach hybrid, the step (1) is specifically as follows: take half a cotyledon and place it in a 2 ml centrifuge tube; add a steel ball with a diameter of 3 mm and 300 μl of DNA extraction solution; place it on a grinder at a frequency of 50 Hz and grind for 15 seconds; centrifuge at 10,000 rpm for 1 minute and take it out for use.

[0022] In the above method for identifying the purity of pw1801 spinach hybrid, in step (3), 8% polyacrylamide gel electrophoresis is used to detect the amplified product; 1.5 μl of the amplified product is added to each spot well, and electrophoresis is stopped when the electrophoresis indicator is 2 cm away from the bottom of the gel; the gel is carefully removed, poured into 1000 ml of staining solution containing 1.2 g AgNO3 and shaken for 3 minutes; the staining solution is poured out, a small amount of distilled water is added for rapid rinsing, and then a color developing solution is poured in, shaken until a band appears, and rinsed with distilled water; the color developing solution is a mixture of 15 g NaOH and 15 ml formaldehyde diluted to 1000 ml of distilled water.

[0023] In the above-mentioned method for identifying the purity of the PW1801 spinach hybrid, the purity of the PW1801 spinach hybrid is calculated in step (4), the gel obtained in step (3) is placed on a white light box, and the statistical results are photographed. The banding characteristics of the PW1801 spinach hybrid and the parents are compared. The PW1801 hybrid that exhibits co-dominant complementary double bands and the same banding pattern as the parents is a non-hybrid, and the one that exhibits other banding patterns is an alien hybrid.

[0024] The above technical solution has the following advantages or beneficial effects:

[0025] The present invention provides an SSR primer and method for identifying the purity of a PW1801 spinach hybrid. The present invention screens and uses primers with strong specificity that can simultaneously show the specific bands of the male and female parents in the PW1801 spinach hybrid, thereby overcoming the problems of being greatly affected by factors such as the external environment, planting season, planting technology and experience, and having a large workload and a long cycle caused by using morphological identification of seed purity. Therefore, the seed purity of the PW1801 spinach hybrid can be quickly and accurately identified within one or two hours. The method has the advantages of being fast, stable, simple to operate, low cost, not affected by the environment, etc., can efficiently detect the seed purity of the PW1801 spinach hybrid, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the electrophoresis diagram of the amplified products of SP029 in pw1801 spinach hybrid and parents provided in Example 1 of the present invention. DETAILED DESCRIPTION

[0027] The present invention is further described below in conjunction with specific embodiments, but is not intended to be a limitation of the present invention. The male and female parents of the PW1801 spinach hybrid used can be obtained from the spinach research group of Wuxi Puwei Agricultural Technology Co., Ltd., and the PW1801 spinach hybrid is commercially available.

[0028] Embodiment 1:

[0029] 1. Materials

[0030] Take 10 seeds of each of the parent plants of PW1801 spinach and 100 seeds of PW1801 spinach hybrids randomly selected from the seed production base, sow them in 72-hole plug trays, and sample them after the cotyledons are fully grown.

[0031] 2. Primer Screening

[0032] Firstly, one single plant of the male and female parent was selected to extract their DNA, and 192 pairs of SSR primers were screened to select differential markers. Then, 48 hybrid plants were used to verify the differential markers, and SP029 was selected as having obvious differences and easy to interpret, which can be used for hybrid purity identification.

[0033] SP029 includes an upstream primer SP029-F and a downstream primer SP029-R, wherein:

[0034] The upstream primer SSR-F was: CGGAGGGGAGAAGGTTTGAG;

[0035] The downstream primer SSR-R is: ACCAACAATGCTGATTCCCA.

[0036] 3. Extraction of genomic DNA

[0037] Take half a cotyledon and place it in a 2 ml centrifuge tube; add a steel ball with a diameter of 3 mm and 300 μl of DNA extraction solution; place it on a grinder at a frequency of 50 Hz and grind for 15 seconds; centrifuge at 10,000 rpm for 1 minute and take it out for use.

[0038] IV. PCR Amplification and Detection

[0039] Reaction system: 2×Taq Master Mix 5 μl, 10 μM / 5 μl upstream and downstream primers 0.5 μl each, genomic DNA 1.5 μl, 0.1 μM / 5 μl Tris-HCl 2.5 μl, pH=8.0.

[0040] The PCR reaction program is as follows: the first stage: pre-denaturation at 95°C for 5 min; the second stage: denaturation at 94°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 1 min; this stage is repeated for 33 cycles; the third stage: extension at 72°C for 7 min; the fourth stage: insulation at 4°C.

[0041] Detection of amplification products: add 1.5μl amplification product to each spot well and perform electrophoresis. Stop electrophoresis when the electrophoresis indicator is 2cm away from the bottom of the gel. Carefully remove the gel, pour in 1000ml of staining solution containing 1.2g AgNO3, and stain on a shaker for 3min. Pour out the staining solution, add a small amount of distilled water for rapid rinse, and then pour in the color developing solution for color development. The color developing solution consists of 15g NaOH and 15ml formaldehyde and is fixed to 1000ml. Stain until bands appear; rinse with distilled water.

[0042] 5. Seed purity identification

[0043] SP029 was used to perform PCR testing on hybrids harvested from the seed production base. The results are shown in Figure 1 It can be clearly seen from the figure that SP029 can clearly expand the male-specific band and the female-specific band, and the hybrid has both parental band types. According to the results, the purity of this batch of seeds is 96%.

[0044] Those skilled in the art should understand that those skilled in the art can implement the above-mentioned variations by combining the prior art and the above-mentioned embodiments, which will not be described in detail here. Such variations do not affect the essential content of the present invention, and will not be described in detail here.

[0045] The preferred embodiments of the present invention are described above. It should be understood that the present invention is not limited to the above-mentioned specific embodiments, and any details not described therein should be understood as being implemented in a common manner in the art; any technician familiar with the art can make many possible changes and modifications without departing from the technical solution of the present invention, or modify them into equivalent embodiments with equivalent changes, which does not affect the essential content of the present invention. Therefore, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of protection of the technical solution of the present invention.

Claims

1. An SSR primer for identifying the purity of pw1801 spinach hybrid, characterized in that: It includes an upstream primer SP029-F and a downstream primer SP029-R, wherein: The upstream primer SSR-F is: CGGAGGGGAGAAGGTTTGAG; The downstream primer SSR-R is: ACCAACAATGCTGATTCCCA.

2. A method for identifying the purity of pw1801 spinach hybrid, characterized in that: include: (1) Extracting genomic DNA of the test sample pw1801 spinach hybrid; (2) using the primers described in claim 1 to perform PCR amplification on the genomic DNA of the pw1801 spinach hybrid obtained in step (1); (3) using 8% polyacrylamide gel to separate the PCR amplification products of step (2) by electrophoresis and silver staining; (4) Statistical results, calculate the purity of pw1801 spinach hybrids, seed purity (%) = (total number of tested seeds - number of non-hybrids - number of foreign hybrids) / total number of tested seeds × 100%; The step (2) uses a 10 μl reaction system: 5 μl of 2×Taq Master Mix, 0.5 μl of each of the 10 μM upstream primer and the downstream primer, 1.5 μl of genomic DNA, and 2.5 μl of 0.1 μM Tris-HCl (pH=8.0); The PCR reaction program is: Stage 1: pre-denaturation at 95°C for 5 min; The second stage: denaturation at 94°C for 30 seconds; annealing at 60°C for 30 seconds; extension at 72°C for 1 minute; this stage was repeated for 33 cycles; Stage 3: extension at 72°C for 7 min; Stage 4: Keep warm at 4°C.

3. The method for identifying the purity of pw1801 spinach hybrid as claimed in claim 2, characterized in that: The step (1) is specifically as follows: Take half a cotyledon and place it in a 2 ml centrifuge tube; add a steel ball with a diameter of 3 mm and 300 μl of DNA extraction solution; place it on a grinder at a frequency of 50 Hz and grind for 15 seconds; centrifuge at 10,000 rpm for 1 minute and take it out for use.

4. The method for identifying the purity of pw1801 spinach hybrid as claimed in claim 2, characterized in that: In the step (3), 8% polyacrylamide gel is used for electrophoresis detection of the amplified product; 1.5 μl of the amplified product is added to each spot well, and electrophoresis is performed, and the electrophoresis is stopped when the electrophoresis indicator is 2 cm away from the bottom of the gel; Carefully remove the gel, pour it into 1000 ml of staining solution containing 1.2 g AgNO3 and shake for 3 min; Pour out the staining solution, add a small amount of distilled water to rinse quickly, then pour in the color developing solution, shake until the bands appear, and rinse with distilled water; The color developing solution is a mixture of 15g NaOH, 15ml formaldehyde and 1000ml distilled water.

5. The method for identifying the purity of pw1801 spinach hybrid as claimed in claim 2, characterized in that: In the step (4), the purity of the PW1801 spinach hybrid is calculated, the gel obtained in the step (3) is placed on a white light box, photographed and statistically analyzed, and the banding characteristics of the PW1801 spinach hybrid and the parents are compared. The PW1801 hybrid that exhibits co-dominant complementary double bands and the same banding pattern as the parents is a non-hybrid, and the hybrid that exhibits other banding patterns is an alien hybrid.

Images