Spherical nucleic acid and application thereof in preparation of hepatic fibrosis drugs

Abstract

The invention belongs to the technical field of biological medicines, and discloses spherical nucleic acid and application thereof in preparation of hepatic fibrosis medicines. The miR-325-3p nucleic acid is obtained through screening, it is verified that the nucleic acid has an important influence effect in the stage that liver blood sinus endothelial cells are subjected to endothelial-to-mesenchymal conversion, capillary vascularization of the liver blood sinus endothelial cells can be effectively reversed by applying the miR-325-3p simulant, and the miR-325-3p mimulant has the application prospect of preparing the liver fibrosis medicine.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine and discloses a spherical nucleic acid and application thereof in preparing a liver fibrosis drug. Background Art

[0002] Liver fibrosis, as the advanced stage of chronic liver disease, can develop into cirrhosis and may eventually lead to hepatocellular carcinoma (HCC). Viral infection, obesity-related nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH), chronic alcohol abuse, autoimmune diseases, and cholestatic diseases are all causes of liver fibrosis, which is characterized by excessive deposition of extracellular matrix (ECM) such as fibrillogenic collagen, elastin, and fibronectin. Capillarization of liver sinusoidal endothelial cells (LSECs) and activation of hepatic stellate cells (HSCs) are the necessary pathways for liver fibrosis. Under the autocrine and paracrine stimulation of neighboring cells, quiescent hepatic stellate cells (qHSCs) undergo a myofibroblast (MFB)-like phenotype transformation and become activated hepatic stellate cells (aHSCs), leading to cell proliferation and increased ECM synthesis. Transforming growth factor-β1 (TGF-β1) is both a key regulator of ECM protein expression and secretion by HSCs and can also inhibit ECM degradation by increasing the production of tissue inhibitor of metalloproteinase-1 (TIMP-1). Although multiple hepatocytes have been shown to regulate the local microenvironment that leads to liver fibrosis, the interactions between them remain unclear. LSECs are essential for maintaining the unique structure and function of the hepatic sinusoids and promoting efficient blood circulation and metabolic exchange. In addition, these specialized endothelial cells play an integral role in driving the progression of liver fibrosis. LSECs undergo a transformation process known as capillarization—abandoning the fenestrae and cribriform plate structures while adopting a more dedifferentiated and profibrotic phenotype. This phenomenon, known as endothelial-to-mesenchymal transition (EMT), exacerbates the fibrotic mechanism by promoting the deposition of extracellular matrix components and increasing the recruitment of inflammatory cells. Therefore, restoring the capillarization of LSECs has become a favorable therapeutic approach to alleviate liver fibrosis and restore optimal liver function. Summary of the invention

[0003] In order to overcome the above-mentioned problems in the prior art, the present invention provides a spherical nucleic acid and its application in the preparation of a liver fibrosis drug.

[0004] On the one hand, the present invention relates to the use of miR-325-3p mimetic compounds in the preparation of drugs, which are used to treat at least one of liver fibrosis, reduce the area of ​​liver fibrosis, inhibit hepatic stellate cell activation, reduce Col I levels, inhibit Kupffer cell activity, improve hepatic sinusoidal endothelial cell differentiation, and reverse hepatic sinusoidal endothelial cell capillarization.

[0005] MicroRNAs (referred to as miRNA) are a series of non-coding RNAs with a length of 21-23 nt, which regulate gene expression by silencing or degrading mRNA molecules. MiRNA mimic compounds (or miRNA mimics) refer to compounds that directly simulate mature miRNAs. They are double-stranded RNA molecules that simulate the miRNA form in vivo and achieve the purpose of upregulating mature miRNAs by transfecting cells.

[0006] Furthermore, in the application provided by the present invention, the drug targets Ptprm to regulate the cytoskeleton of hepatic sinusoidal endothelial cells, reverse the capillarization of hepatic sinusoidal endothelial cells, and treat liver fibrosis.

[0007] On the other hand, the present invention relates to a spherical nucleic acid, wherein the spherical nucleic acid is a miRNA mimic compound through sulfhydryl and Au + After modification, self-assembly occurs, and the spherical nucleic acid has characteristic peaks in Au-4f orbital and S-2p orbital.

[0008] Specifically, the present invention is for thiol and Au + The number of modifications is not particularly limited, and those skilled in the art can easily adjust the amount of thiol and Au. + The number of modifications can be used to change the particle size of the spherical nucleic acid and thus target different cells.

[0009] Specifically, the present invention does not particularly limit the preparation method of the spherical nucleic acid, and those skilled in the art can easily prepare it using different methods according to different preparation conditions.

[0010] Illustratively, the present invention provides a method for preparing the spherical nucleic acid, which comprises: modifying the miRNA mimic compound with a thiol group, mixing it with a solution containing gold ions with a valence greater than +1, and adding a reducing agent to obtain the spherical nucleic acid.

[0011] Illustratively, in the method for preparing the spherical nucleic acid provided by the present invention, the gold ion solution is a HAuCl4 solution, and the reducing agent is sodium citrate.

[0012] Furthermore, in the spherical nucleic acid provided by the present invention, the particle size of the spherical nucleic acid is 13nm~102nm.

[0013] Furthermore, in the spherical nucleic acid provided by the present invention, the particle size of the spherical nucleic acid is 38 nm.

[0014] Furthermore, in the spherical nucleic acid provided by the present invention, the particle size of the spherical nucleic acid is 39 nm.

[0015] Furthermore, in the spherical nucleic acid provided by the present invention, the spherical nucleic acid targets the Scara outer membrane protein on the surface of the hepatic sinusoidal endothelial cells and releases the miR-325-3p mimic compound in the hepatic sinusoidal endothelial cells.

[0016] Furthermore, in the spherical nucleic acid provided by the present invention, the miRNA mimic compound is a miR-325-3p mimic compound.

[0017] On the other hand, the present invention relates to the use of the spherical nucleic acid in the preparation of a drug, wherein the drug selectively internalizes the miRNA mimic compound into hepatic sinusoidal endothelial cells through clathrin-dependent endocytosis mediated by Scara outer membrane protein.

[0018] On the other hand, the present invention relates to the use of the spherical nucleic acid in the preparation of a liver fibrosis drug, wherein the liver fibrosis drug is used for treating at least one of liver fibrosis, reducing the area of ​​liver fibrosis, inhibiting the activation of hepatic stellate cells, reducing the level of Col I, inhibiting the activity of Kupffer cells, improving the differentiation of hepatic sinusoidal endothelial cells, and reversing the capillarization of hepatic sinusoidal endothelial cells.

[0019] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages.

[0020] (1) The present invention verifies that during the treatment of liver fibrosis, multiple miRNAs are upregulated and / or their target genes are enriched. Among them, the target genes corresponding to miR-325-3p in LSEC are significantly different between healthy individuals and individuals with liver fibrosis.

[0021] (2) Transplantation of mesenchymal stem cells (MSCs) is a method for treating liver fibrosis. The present invention verifies that MSC reverses the capillarization of LSEC in a miR-325-3p-dependent manner, which is specifically manifested in at least one of reducing the area of ​​liver fibrosis, inhibiting the activation of hepatic stellate cells, reducing the level of Col I, inhibiting the activity of Kupffer cells, improving the differentiation of hepatic sinusoidal endothelial cells, and reversing the capillarization of hepatic sinusoidal endothelial cells. The present invention treats LSEC with miR-325-3p mimic compounds and verifies that miR-325-3p regulates the cytoskeleton of LSECs by targeting Ptprm and reverses its capillarization; specifically, Ptprm is a direct target gene of miR-325-3p and can effectively reverse the capillarization of LSEC. Ptprm can regulate the cytoskeleton through p120-catenin, thereby controlling the fenestration and sieve plate structure of LSEC.

[0022] (3) The present invention constructs a spherical nucleic acid, which is a miRNA mimic compound through sulfhydryl and Au + After modification, self-assembly occurs, and by adjusting the thiol and Au + The number of modifications can change the particle size accordingly. The present invention verifies that the spherical nucleic acid is selectively internalized into LSEC through Scara-mediated clathrin-dependent endocytosis, and can selectively internalize into LSEC and protect the miRNA mimic compound from being degraded.

[0023] (4) The present invention prepares the miR-325-3p mimic compound into a spherical nucleic acid, which can target LSEC, enrich miR-325-3p in LSEC, and has the ability to reverse LSEC capillarization and effectively treat liver fibrosis, while maintaining good biosafety. The present invention also verifies that the spherical nucleic acid prepared from the miR-325-3p mimic compound can cooperate with mesenchymal stem cells to treat liver fibrosis and achieve better therapeutic effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1To explore the reversal of LSEC capillarization by MSCs with the assistance of artificial intelligence. (A) LESC cell lines were divided into 5 groups, namely, untreated LSEC group, co-cultured with MSCs group, and treated with MSCs culture medium (CM) containing / without extracellular vesicles (EVs) and RNase, and then observed by scanning electron microscopy after 48 h of culture. Scale bars 10µm and 2µm. The upper left corner is a schematic diagram of cell treatment. Red arrows indicate fenestrations and lamina cribrosa. (B) Quantification of the percentage of lamina cribrosa in total surface area and fenestration diameter. P values ​​were calculated using one-way analysis of variance (ANOVA). N = 20 / group. (C) Potential miRNAs for MSCs to reverse LSEC capillarization were identified through the development of ChatGPT 4.0 oT artificial intelligence (AI) model, which was trained using human and mouse miRNAs and their corresponding target genes from GSEA and TargetScan databases. (D&E) Gene set enrichment analysis (GSEA) of hsa / mmu miR-325-3p target genes using proteomics data (D) and RNA-seq data (E).

[0026] Figure 2 MSCs reverse capillarization of LSECs in a miR-325-3p-dependent manner. (A) AST analysis of three healthy volunteers and three volunteers with cirrhosis. (B&C) Sirius red staining and quantification of mature collagen in liver sections from three patients (C). Scale bar 500µm. (D) Confocal laser scanning microscopy (CLSM) analysis of immunofluorescence staining for stablin 2. Scale bar 20µm. (E) Scanning electron microscopy (SEM) of LESCs from three patients transfected with miR-325-3p and miR-NC, respectively, was performed 48 hours after transfection. Scale bars 10µm and 2µm. (F) Quantification of the percentage of total surface area and fenestrae diameter of lamina cribrosa. (G&H) Sirius red staining and quantification of mature collagen in liver sections from mice treated with different conditions (H). (IP) Immunofluorescence staining and quantification of α-SMA, Col I, F4 / 80, and stabilin 2 (I). (Q) Phenotypic changes of primary LSECs in three groups were detected by scanning electron microscopy (SEM). Scale bars 10 µm and 2 µm. Red arrows indicate fenestrae and sieve plates. (R) Quantification of the percentage of sieve plates in total surface area and fenestrae diameter. In A, C, F, H, J, L, N, P, and R, data are presented as mean ± SD. P values ​​in A and F were calculated by unpaired two-tailed Student's t test; in H, J, L, N, P, and R, one-way analysis of variance (ANOVA) was used.

[0027] Figure 3miR-325-3p targets Ptprm to regulate the cytoskeleton of LSECs and reverse their capillarization. (A) Volcano plot of differentially expressed proteins in LSECs before and after transfection with miR-325. (B) Venn diagram of miR-325-3p target genes and proteins downregulated in response to miR-325-3p in (A). (C) Expression of the four genes found in B in CCl4-induced liver fibrosis LSECs before and after MSC treatment. (D) The predicted binding sequence between Ptprm mRNA 3'UTR and miR-325-3p is shown. (E) To verify the binding relationship between Ptprm mRNA 3'UTR and miR-325-3p, a dual luciferase reporter gene assay was used. (F) Western blot was used to detect the expression of Ptprm in LSECs transfected with miR-325-3p mimics or inhibitors. (G) SEM observation of phenotypic changes in LSECs under three different treatments. Scale bars 10 µm and 2 µm. Red arrows indicate fenestrations and sieve plates. (H) Quantification of the percentage of sieve plates in total surface area and fenestration diameter. (I&J) Gene set enrichment analysis of cell adhesion and microtubule pathways using proteomic data obtained from primary LSECs by LC-MS and 4D label-free methods, comparing miR-325-3p and miR-NC. (KM) CLSM analysis of immunofluorescence staining of β-tubulin and β-actin in LSECs incubated with miR-NC and miR325-3p for 48 h. Positive signals were quantified by Image J (K). (N&O) Single sample gene set enrichment analysis (ss-GSEA) of LSEC capillarization (N), microtubule binding pathway, and filamentous actin pathway (O) was performed on LSECs transfected with Si-Ptprm and Si-NC. The data of E (n=3), H (n=6), and K (n=20) are expressed as mean ± SD. The P values ​​of E, H, and K were calculated by one-way analysis of variance (ANOVA).

[0028] Figure 4Construction of spherical nucleic acids (SNAs) for targeted internalization of miR-325-3p into LSECs. (A) t-distributed stochastic neighbor embedding (t-SNE) plots of a wide range of cell types in liver tissues of CCl4-induced liver fibrosis mice (n = 3). (B) Heatmap showing the top 5 genes uniquely expressed in each liver cell type. (C) Expression levels of Scara in various types of liver cells. (D) Schematic diagram of the synthesis process of spherical nucleic acids (SNAs). (E) TEM images of SNAs with hydrodynamic diameters of 13-102 nm. (F&G) Laser scanning confocal microscopy (LSCM) images depicting the cellular uptake of different SNAs by LSECs (F) and macrophages (G). (H&I) Fluorescence intensity analysis of SNAs internalized by LSECs (H) and macrophages (I). N = 3 biological replicates per group. Data are presented as mean ± SD. (J) X-ray photoelectron spectroscopy reveals the electron spectrum of SNAs with a size of 39 nm, especially in the Au-4f and S-2p orbitals.

[0029] Figure 5 Cellular internalization pathways and in vivo biodistribution of SNAs. (A) Schematic diagram of LSEC endocytosis and liver homeostasis. (B) LSCM images showing cellular uptake of SNAs into LSECs after incubation with ATP for 1 h at 4 °C, 37 °C, and 37 °C. (C) Proteomics results of LSECs treated with SNAs and mock-treated controls were used to investigate the effects of SNAs treatment on cellular endocytic pathways using GSEA analysis. (D) GSEA analysis and protein level changes related to clathrin-dependent endocytosis in LSECs treated with SNAs and mock-treated groups. (E) LSCM images and fluorescence intensity analysis showed that SNAs were taken up into LSECs by cells after 12 h of culture with si-Scara, Anti-Scare, or Dynasore. N = 3 biological replicates per group. Data are presented as mean ± SD. (F) Au concentrations detected by ICP-MS reflected the accumulation of SNAs in organs and tissues in CCl4-induced fibrotic mice. Euthanasia was performed at different time points (2 h and 48 h) after systemic injection. (G) Immunofluorescence analysis of F4 / 80 (left) and Stabilin 2 (right) co-localized with Cy3-SNAs was performed on liver tissues of fibrotic mice 2 and 48 hours after tail vein injection of Cy3-SNAs. Quantification of double-positive signals is shown below. Data are presented as mean ± SD (n = 3).

[0030] Figure 6SNAs effectively reversed the capillarization of LSECs and showed significant therapeutic effects in the CCl4-induced liver fibrosis model. (A) Schematic diagram of CCl4-induced liver fibrosis in mice and the corresponding clinical cirrhosis types. (B) AST analysis of five different serum samples, including serum samples from healthy mice and fibrotic mice treated with saline (Ctrl), SNASC, SNAS, and MSC. (C&D) Single sample gene set enrichment analysis (ss-GSEA) of LSECs isolated from healthy mice and fibrotic mice treated with saline, SNASC, and SNAS. (E&F) Sirius red, masson staining, and Sirius red-stained mature collagen quantification of liver sections of mice under different treatment conditions. (G&H) Immunofluorescence staining and quantification of α-SMA, ColI, and stabilin2 (H). (I) Scanning electron microscopy of primary LSECs isolated from 4 different groups to observe phenotypic changes. Scale bars 10µm and 2µm. Red arrows indicate fenestrae and cribriform plates. (J) Quantification of the percentage of the total surface area and fenestrae diameter of the lamina cribrosa. Data are presented as mean ± SD (4D label-free n = 3, CCl4-induced mouse model and treatment n = 6). P values ​​in B, E, G, and I were calculated using one-way analysis of variance (ANOVA).

[0031] Figure 7SNAS effectively reversed the capillarization of LSECs and showed significant therapeutic effects in TAA-induced liver fibrosis and BDL models. (A) Schematic diagram of TAA-induced liver fibrosis in mice and the corresponding clinical cirrhosis types. (B) AST levels in four different serum samples, including serum samples from healthy mice and fibrotic mice treated with saline (Ctrl), SNASC, and SNAS. (C&D) Sirius red staining and quantification of mature collagen in four liver sections (D). (E&F) Immunofluorescence staining and quantification of α-SMA and stablin2 (F). (G) Scanning electron microscopy observation of phenotypic changes in primary LSECs in the three groups. Scale bars 10µm and 2µm. Red arrows indicate fenestrae and cribriform plates. (H) Quantification of the percentage of cribriform plates in the total surface area and fenestrae diameter. (I) Schematic diagram of the bile duct ligation model and the corresponding clinical biliary cirrhosis. (J) AST levels in four different serum samples, including serum samples from healthy mice and fibrotic mice treated with saline, SNASC, and SNAS. (K&L) Sirius red staining and quantification of mature collagen in four liver sections (D). (M&N) Immunofluorescence staining and quantification of α-SMA and stablin2 (F). (O) SEM observation of phenotypic changes in LSECs in the three groups. Scale bars 10 µm and 2 µm. Red arrows indicate fenestrae and cribriform plates. (P) Quantification of the percentage of cribriform plates in the total surface area of ​​the cribriform plates and fenestrae diameter. Data are expressed as mean ± SD (TAA-induced mouse model and treatment n = 6, BDL model and treatment n = 4). P values ​​in B, D, F, H, J, L, N, and P were calculated using one-way analysis of variance (ANOVA).

[0032] Figure 8 Figure 2 shows the changes in miR-325-3p levels under different treatments. (A) Levels of miR-325-3p in LSECs after transfection with miR-325-3p. (B) Levels of miR-325-3p in MSCs, LSECs, and LSECs isolated from mice treated with MSCs.

[0033] Fig. 9 Figure 2. Changes in each preparation in cirrhotic patients under different treatments. (A) Ptprm protein levels in LSECs isolated from healthy donors or cirrhotic patients. (B) Ptprm mRNA levels in LSECs after transfection with Si-NC or Si-Ptprm. (C) Expression levels of miR-325-3p in LSECs after transfection. (D) GSEA results of microtubule binding and filamentous actin binding in iTRAQ proteomic analysis, comparing miR-325-3p transfected LSECs with mock-treated control samples.

[0034] Fig.10Physical properties of SNAs. (A) The hydrodynamic diameters of SNAs were measured using dynamic light scattering (DLS) in PBS buffer at pH 7.4. (B) Laser scanning confocal microscopy (LSCM) images show the uptake of different SNAs by Kupffer cells.

[0035] Fig.11 Physiological properties of SNAs. (A) Fluorescence intensity analysis of internalized SNAs in LSECs after incubation with ATP for 1 h at 4, 37, and 37 °C. N = 3 biological replicates per group. Data are presented as mean ± SD. (B) LSCM images showing the uptake of SNAs by LSEC cells after incubation with ATP for 6 h at 4, 37, and 37 °C. (C) Fluorescence intensity analysis of internalized SNAs in LSECs after incubation with ATP for 6 h at 4, 37, and 37 °C. N = 3 biological replicates per group. Data are presented as mean ± SD. (D) Au concentrations detected by ICP-MS in CCl4-induced fibrotic mice treated with scavenger receptor A subtype reflect the accumulation of SNAs in organs and tissues. Serial euthanasia was performed at different time points (2 and 48 h) after systemic injection. (E&F) Analysis of nude mouse miRNA and residual miRNA after incubation of SNAs with 20% FBS at 37°C by gel electrophoresis (E) and quantitative fitting analysis (F). (G) Au concentration detected by ICP-MS reflects the accumulation of SNAs-R in organs and tissues in CCl4-induced fibrotic mice. Serial euthanasia was performed at different time points (2 hours and 48 hours) after systemic injection. (H&I) Analysis of nude mouse miRNA and residual miRNA after incubation of SNAs-R with 20% FBS at 37°C by gel electrophoresis (H) and quantitative fitting analysis (I).

[0036] Fig.12 For proteomic analysis, GSEA results for microtubule- and filamentous actin-binding in LSECs isolated from mice treated with SNAs or mock-treated were compared.

[0037] Fig.13 Results of mouse tissue staining. (A) Blood routine test of mice with CCl4-induced liver fibrosis treated with SNAs or SNAs-C. (B) Renal function analysis of mice with CCl4-induced liver fibrosis treated with SNAs or SNAs-C. (C) HE tissue staining of the heart, spleen, lung and kidney of mice with CCl4-induced liver fibrosis treated with SNAs or SNAs-C.

[0038] Fig.14Results of tissue staining of TAA model mice. (A&B) Immunofluorescence staining (A) and quantification (B) of F4 / 80 in TAA model. (C&D) Immunofluorescence staining (C) and quantification (D) of ColI in BDL model. (n=6 for each mouse model and treatment). P values ​​in B and D were calculated by one-way analysis of variance (ANOVA).

[0039] Among them, SNAs are spherical nucleic acids with a particle size of 38 nm prepared from miR-325-3p mimic compounds; SNAs-R are spherical nucleic acids prepared from random misRNA sequence mimic compounds. DETAILED DESCRIPTION

[0040] The technical scheme of the present invention is described below in conjunction with the examples, but the present invention is not limited to the following examples. The experimental methods and detection methods described in each example are conventional methods unless otherwise specified; the reagents and materials are available on the market unless otherwise specified, and the % in the following examples are all mass percentages unless otherwise specified.

[0041] All synthetic miRNAs (miRNA mimic compounds) were from Genetron Health Ltd. (Shanghai, China), including mmu-miR-325-3p: sense, 5'-UUUAUUGAGCACCUCCUAUCAA-3'; antisense, 5'-UUGAUAGGAGGUGCUCAAUAUU-3'; hsa-miR-325-3p: sense, 5'-UUUAUUGAGGACCUCCUAUCAA-3'; antisense, UUGAUAGGAGGUCCUCAAUAUU, and their negative controls. Phosphate buffered saline (PBS), Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), dimethyl sulfoxide (DMSO), and water (HPLC grade) were purchased from Fisher Scientific Inc. HAuCl4-H2O and Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) were purchased from Aladdin Reagent Co., Ltd. Unless otherwise stated, other chemicals used in the following examples were purchased from Sigma-Aldrich Trading Co., Ltd. All products were used as received without further purification.

[0042] Example 1 This example provides the acquisition and functional identification of miR-325-3p.

[0043] To investigate the potential mechanism of MSCs reversing LSEC capillarization, the present invention employed a complex nested compartmentalized cell co-culture chamber to isolate the physical contact between cells while maintaining a connected culture environment. Figure 1 As shown in A, LSEC cell lines were seeded in the lower chamber, while MSCs or their culture medium were added to the upper chamber. Scanning cryo-electron microscopy ( Figure 1 A) and the corresponding analysis ( Figure 1 B) The present invention found that after 72 hours of incubation of isolated MSCs and their culture medium (MSC-cm), LSECs showed the ability to restore the structure of fenestrations and sieve plates. Interestingly, this redifferentiation process was not observed after centrifugation to remove extracellular vesicles (MSC-CM ΔEV ), strongly suggesting their key role as active substances leading to LSEC redifferentiation. In addition, the addition of RNase to MSC-CM effectively blocked the recovery of LSEC function, providing strong evidence that nucleic acids may be key components of these active substances.

[0044] Since miRNAs are mainly present in extracellular vesicles, this paper developed an artificial intelligence (AI) model to identify active miRNAs by collaboratively analyzing multiple omics data. The AI ​​model was trained using ChatGPT 4.0 through machine learning using human and mouse miRNAs and their corresponding target genes in the GSEA and TargetScan databases ( Figure 1 C). Subsequently, RNA-seq results obtained from LSECs isolated from mice with CCl4-induced liver fibrosis (treated with mesenchymal stem cells or mock treatment) were input into the AI ​​model to identify the active miRNAs responsible for these differentially expressed genes. Similarly, proteomic results from LSECs isolated from 3 healthy donors and 12 patients with cirrhosis were also incorporated into this AI model. Through these two independent operations, the AI ​​model identified the top 10 miRNAs most likely to cause these differences ( Figure 1 C), of which only miR-325-3p appeared in both sets of results. To further clarify the characteristics of these four miRNAs, the present invention used proteomics data and RNA-seq data to perform gene set enrichment analysis (GSEA) on their target genes. The results showed that only the target genes of miR-325-3p showed statistically significant upregulation in LSECs of patients with cirrhosis ( Figure 1 D). In mice, miR-325-3p also showed statistically significant changes between healthy LSECs and fibrotic LSECs, and between MSC-treated fibrotic LSECs and untreated fibrotic LSECs ( Figure 1 E). In summary, miR-325-3p is a key factor in MSCs reversing LSEC capillarization.

[0045] To verify the key role of miR-325-3p, we isolated LSECs from three patients with severe liver fibrosis. Notably, these patients showed extensive fibrosis ( Figure 2 BD) and AST levels were significantly elevated, ten times higher than those of healthy people ( Figure 2 A). In addition, the LSECs they isolated clearly lacked fenestrations and sieve plate structures ( Figure 2 E). Notably, after transfection of miR-325-3p mimics using Lipo 3000 and subsequent confirmation of successful transfection by RT-PCR ( Figure 8 A) LSECs of three patients developed numerous fenestrae and lamina cribrosa within only 48 hours ( Figure 2 E). This activation was accompanied by a significant increase in the diameter and total number of sieve plates compared to before transfection. Figure 2 F. The results of this study clearly demonstrated the profound effect of miR-325-3p in reversing LSEC capillarization.

[0046] Next, to investigate the role of miR-325-3p in MSC therapy, the present invention transfected the inhibitor of miR-325-3p (miR-325i) into MSCs, and then transplanted MSCs and miR-325i-treated MSCs into CCl4-induced liver fibrosis mice. It is noteworthy that the present invention's research results showed that compared with NaCl simulation treatment, MSC treatment significantly reduced the fibrosis area characterized by picrosirius red staining ( Figure 2 G&H). However, when miR-325i was introduced, the efficacy was greatly weakened ( Figure 2 G&H). Consistent with these observations, MSC transplantation also resulted in an increase in α-SMA levels, a marker for active hepatic stellate cells ( Figure 2 I and J) and Col I levels ( Figure 2 K&L) were significantly decreased, and F4 / 80 levels (a marker of active Kupffer cells) were also decreased ( Figure 2 M&N) and Stabilin 2 levels (a marker of differentiated LSECs) were elevated ( Figure 2 O and P). In contrast, miR-325i-treated MSCs showed no effect on these markers ( Figure 2 IP). In addition, SEM images of LSECs isolated after MSC transplantation showed that miR-325i blocked the biological function of MSCs in reversing LSEC capillarization ( Figure 2Q&R). Subsequently, the present invention analyzed the miR-325-3p levels in MSC and LSEC of liver fibrosis mice treated with NaCl, MSC or miR-325i. Interestingly, the present invention observed that the miRNA in liver fibrosis LSEC was almost negligible, while the miRNA abundance in MSC was very high ( Fig. 9 B). However, after MSC transplantation, miR-325-3p was also detected in LSECs, suggesting that these cells acquired miRNA from the transplanted MSCs ( Figure 8 B). Together, these findings demonstrate a critical role for MSC-derived miR-325-3p in reversing LSEC capillarization.

[0047] In order to study the mechanism of miR-325-3p reversing LSEC capillarization, the present invention transfected miR-325-3p mimics into LSEC cell lines, and iTRAQ (isotope tag relative and absolute quantification) proteomics analysis found that 448 proteins were significantly downregulated compared with the mock treatment group ( Figure 3 A). By crossing these proteins with the target genes of miR-325-3p, the present invention identified four genes: Madk, Csn2, Ptprm and Ngly1 ( Figure 3 B). Further analysis showed that in LSEC cells, only the expression of Ptprm was significantly decreased after MSC transplantation ( Figure 3 C), indicating that Ptprm is a potential target gene for miR-325-3p to reverse LSEC capillarization. In addition, the expression level of Ptprm was higher in LSEC isolated from cirrhotic patients compared with that in LSEC isolated from healthy liver ( Fig. 9 A), which further supports the hypothesis of the present invention. At the same time, the present invention determines the specific binding site between miR-325-3p and the mRNA 3'UTR of Ptprm ( Figure 3 D). Dual luciferase reporter gene assay showed that overexpression of miR-325-3p significantly attenuated the luciferase activity of cells expressing Ptprm-WT, but had no significant effect on cells expressing Ptprm-MUT ( Figure 3 E). Western blot analysis further confirmed that the abnormal expression of miR-325-3p significantly reduced the protein level of Ptprm in MSCs compared with the control group (miRNA negative control group or inhibitor negative control group), while transfection of miRNA inhibitors produced the opposite effect ( Figure 3 F). In addition, transfection of LSEC cells with small interfering RNA targeting Prprm (si-Ptprm) significantly reduced Ptprm mRNA by 71% ( Fig. 9B), which showed that its effect was comparable to that of miR-325-3p in effectively restoring the fenestrae and cribriform plate structures of differentiated LSECs ( Figure 3 G&H). Taken together, these results indicate that Ptprm is a direct target gene of miR-325-3p and can effectively reverse the capillarization of LSECs.

[0048] Comparison of transfection with miR-325-3p mimics ( Fig. 9 C) or control miRNA LSEC iTRAQ proteomic analysis showed that microtubule binding and filamentous actin binding were significantly upregulated ( Figure 3 I). Gene set enrichment analysis (GSEA) results further supported this finding ( Figure 3 J and 9D). miR-325-3p effectively reversed LSEC capillarization by regulating its cytoskeleton, as evidenced by significant improvements in tubulin and actin levels and assembly ( Figure 3 KM). In addition, as confirmed by RNA-seq data, si-Ptprm transfection also promoted the reversal of LSEC capillarization ( Figure 3 N) and increased microtubule binding and filamentous actin binding ( Figure 3 O). Collectively, these results strongly suggest that miR-325-3p can target Ptprm to regulate the cytoskeleton of LSECs, thereby reversing their capillarization.

[0049] Example 2 This example provides the construction of spherical nucleic acids (SNAs) for the targeted internalization of miR-325-3p into LSECs.

[0050] In order to specifically deliver miR-325-3p to liver LSEC during the treatment of liver fibrosis, the present invention first explored the genetic characteristics of various liver cell types by single-cell sequencing analysis in mice with liver fibrosis. Through this method, the present invention successfully identified 11 different cell types, including LSEC ( Figure 4 A). Heatmap reveals the top five genes uniquely expressed in each cell type, highlighting that Cldn7, Onecut2, Sorbs2, Scara, and Prox1 are highly specific to LSECs ( Figure 4 B). Of note, among these genes, Scara stood out as an outer membrane protein that could serve as a potential target for delivery. In addition, Scara was expressed at a significantly higher level in LSECs compared with other cells within fibrotic liver tissue ( Figure 4C), indicating its feasibility as a highly efficient LSEC-specific delivery target. Scara is believed to have a significant affinity for spherical nucleic acids, and the present invention assembles miR-325-3p into spherical polymeric nucleic acid particles to precisely target Scara in LSECs. In addition, this approach may help overcome another drug barrier for miRNAs - cellular internalization. The hydrophilic spherical structure, as well as the electronegativity of nucleic acids and Scara affinity, can promote the internalization of these spherical polymeric nucleic acids into LSEC cells. This study adopted a mild and biocompatible self-assembly method to cleverly assemble the thiol- and Au(I)-modified miR-325-3p into a spherical polyhedron through affinity complexation, so this assembled miR-325-3p is called spherical nucleic acids (SNAs) ( Figure 4 D). The next step is to select the most appropriate size of SNAs to trigger endocytosis.

[0051] Specifically, 2OD of thiol-modified miR-325-3p (hereinafter referred to as miR-325) was completely dissolved in 5mL HEPES buffer (50nM, pH 7.0) and stirred at 50°C and 550rpm for 10 minutes. 500μL 10 mM HAuCl4 (Aladdin Chemical Company) was added and stirred for about 10 minutes until the solution turned purple-red, and SNAs (39nm) were successfully synthesized. Control particles, named SNAs-C, were synthesized in the same way, but without miR-325. In the process of synthesizing SNA particles, the ratio of sodium citrate and chloroauric acid can be adjusted according to the ratio of 2:1, 1:1, 1:2, 1:4 and 1:8 to generate particles of different sizes, such as 13nm, 21nm, 51nm, 70nm and 102nm.

[0052] Subsequently, a series of SNAs with hydrated particle sizes ranging from 13 nm to 102 nm were synthesized by using different concentrations of miR-325-3p modified with thiol and Au(I) and changing the pH conditions ( Fig.10A and 4E). Subsequently, after 6 h of incubation of cells and SNAs, the cellular internalization of these SNAs in LSECs and the macrophage cell line Raw264.7 was assessed by laser scanning confocal microscopy (LSCM). The miR-325 synthesized with a thiol-modified 3'-end and a Cy3-modified 5'-end was called SNAs-Cy3. SNAs with a particle size distribution ranging from 13 nm to 102 nm were redispersed in complete medium at a final concentration of 2 μM (pH 7.0). LSECs, Raw264.7, and Kupffer cells were seeded in 96-well plates at a density of 5000 cells per well. After 24 h, cells were first treated with SNAs ranging from 13 nm to 102 nm. Then, cells were treated with 10% concentration of SNAs (39 nm) at 37°C or 4°C for 1 h and 6 h in the presence or absence of ATP, washed twice with cold PBS buffer, and fixed with 4% formaldehyde for 15 min. The cytoskeleton and nucleus were stained with phalloidin and DAPI, respectively, and then analyzed by fluorescence microscopy (OLYMPUS FV3000, Japan). In order to explore the uptake mechanism of SNA by LSECs, the present invention used Dynasore (200μM), si-Scara and Scara antibodies to inhibit clathrin-dependent endocytosis. After the cells were treated with clathrin-dependent endocytosis inhibitors for 30 minutes, they were incubated with SNAs-Cy3 at a concentration of 10% for 1 hour. The uptake was then determined by confocal and flow cytometric analysis. It was observed that SNAs-39nm was most highly taken up by LSECs, while the uptake by macrophages was relatively low ( Figure 4 FI). In addition, minimal uptake of SNAs-38nm was observed in Kupffer cells ( Fig.10 B). Due to their excellent efficiency and selective absorption of LSECs, SNAs-38nm are henceforth referred to as "SNAs" for further exploration purposes. In addition, X-ray photoelectron spectroscopy was used to investigate the chemical properties of these SNAs, revealing characteristic peaks of monovalent Au and divalent S ( Figure 4 J), thus supporting the expected chemical composition of the present invention design ( Figure 4 D).

[0053] Example 3 This example provides the construction of spherical nucleic acids (SNAs) for the targeted internalization of miR-325-3p into LSECs.

[0054] According to the design of the present invention, SNAs have the excellent ability to recognize Scara on the surface of LSECs and internalize them into LSEC cells through this receptor, followed by the release of miR-325-3p to reverse LSEC capillarization ( Figure 5A). Subsequently, the present inventors investigated the internalization model and observed that while lower temperatures hampered the internalization of SNAs into LSECs, ATP incubation significantly enhanced it ( Figure 5 B and Fig.11 AC), indicating an active uptake process. Next, gene set enrichment analysis (GSEA) of RNA-seq data of LSECs exposed to SNAs revealed a significantly activated clathrin-dependent endocytic pathway ( Figure 5 C&D). Furthermore, treatment with Dynasore, an inhibitor of clathrin-dependent endocytosis, resulted in a near-complete inhibition of SNAs internalization in LSECs ( Figure 5 E), providing further support for this finding. Most importantly, both siRNA-mediated downregulation of Scara expression in LSECs and surface neutralization of Scara using Anti-Scara resulted in significant inhibition of SNAs internalization (~88% and ~97%, respectively) ( Figure 5 E); thus, Scara is demonstrated to be a specific receptor mediating clathrin-dependent endocytosis of LSECs into SNAs.

[0055] In order to further verify the targeting of LSEC in vivo, the present invention used inductively coupled plasma mass spectrometry (ICP-MS) to analyze the expression of SNAs in various organs of mice with CCl4-induced liver fibrosis. 197 Au content was quantified and the biodistribution of SNAs was calculated. As expected, the liver showed the highest accumulation of SNAs among the major organs at 2 h and 2 days after injection ( Figure 5 F). More interestingly, Scara neutralizing antibodies can effectively block the targeted accumulation of SNAs in fibrotic livers. Specifically, when injected intravenously at a dose of 5 mg / kg, Anti-Scara injected 12 hours before the injection of SNAs unexpectedly caused SNAs to accumulate in the spleen rather than the liver ( Fig.11 D), which further demonstrates the Scara-dependent mechanism of SNAs’ targeted accumulation in liver fibrosis. In addition, considering that Kupffer cells may reside outside LSECs due to the hepatic sinusoidal structure, it is necessary to study their predatory uptake of BVP. Therefore, confocal analysis of SNAs fluorescence and Kupffer cell marker F4 / 80 and LSEC marker Stablin2 fluorescence signals ( Figure 5 G) shows that there is a clear colocalization between SNAs and Stablin2, but not SNAs and F4 / 80, indicating that the vast majority of internalized SNAs are localized to LSECs rather than Kupffer cells. These in vivo findings clearly demonstrate that LSECs can be targeted in mice with liver fibrosis.

[0056] In addition, the rapid degradation of miRNAs also poses a huge challenge to the clinical transformation of nucleic acid drugs. Fortunately, SNAs provide a solution to this obstacle, which can effectively extend the half-life of miR-325-3p in PBS solution containing 20% ​​serum to more than 30 hours, while the half-life of naked miR-325-3p is less than one hour ( Fig.11 H&I). In addition, to further verify the universality of SNAs, the present invention also used random sequence microRNA to produce spherical nucleic acids, which the present invention named SNAs-R. As expected, SNAs-R showed a similar tendency to liver fibrosis accumulation as SNAs ( Fig.11 G), while showing excellent resistance to degradation ( Fig.11 H&I). These findings strongly suggest that SNAs represent a comprehensive technology capable of selectively internalizing into LSECs and protecting microRNAs from degradation.

[0057] Example 3 This example provides the results of using SNAs to treat liver fibrosis in mice.

[0058] The successful targeting of SNAs in mice with liver fibrosis prompted the present inventors to investigate their efficacy in vivo. To evaluate the potential of SNAs, the mouse model initially chosen was CCl4-induced liver fibrosis, which replicates the pathogenesis caused by oxidative stress associated with unhealthy lifestyle habits, aging, or acute and chronic liver damage (Figure 6A). After successful modeling, a total of 300 μL of SNAs containing 0.3 OD miR-325-3p was injected intravenously. As a negative control, control SNAs composed of random sequences of miR-325-3p (SNAs-C) and an equal volume of saline (Ctrl) were used. In addition, to establish a positive control, 2×10 5 Mesenchymal stem cells were injected into the tail vein of the mice, and 6 healthy mice were used as blocking controls. It is worth noting that all administrations were single-dose therapies. After 10 days of administration, all mice were euthanized to evaluate liver fibrosis. The liver function index AST of the diseased mice treated with SNAs and mesenchymal stem cells returned to normal levels, similar to those of healthy mice ( Figure 6 B). In contrast, AST levels in SNAs-C and mock-treated diseased mice were significantly higher than those in the other three groups ( Figure 6 B).

[0059] The RNA-seq results of LSEC capillarization-related genes obtained from the isolated LSECs were then Figure 6 C) Simple GSEA analysis of its signal ( Figure 6ssGSEA in D) showed that, unlike SNASC, SNAs effectively reversed LSEC capillarization at the transcriptional level. In addition, GSEA analysis of ex vivo LSEC data from SNAS-treated mice also revealed upregulation of filamentous actin and microtubule binding compared to mock-treated mice, which is fully consistent with the mechanism of miR-325-3p described above ( Fig.12 Importantly, gold standard assessment of liver fibrosis using picrosirius red and Masson staining showed that SNAs significantly reduced the area of ​​liver fibrosis from approximately 7% to less than 3%, which was better than the 3.5% achieved with MSC treatment ( Figure 6 E&F). Consistent with these findings, both SNAs and MSCs reduced the upregulation of active hematopoietic stem cell markers α-SMA and Col I in fibrotic livers, while increasing the expression of the differentiated LSEC marker Stabilin 2 ( Figure 6 G&H). Furthermore, scanning electron microscopy images of LSECs isolated from these diseased mice further confirmed the above results, showing that SNAs and MSCs increased not only the diameter of the lamina cribrosa but also the number of lamina cribrosa ( Figure 6 I&J). This suggests that treatment of MSCs with SNAs can effectively restore the fenestrae and cribriform plate structures of differentiated LSECs.

[0060] In addition, hematopoietic toxicity and organ toxicity were investigated after administration. Fig.13 A) Renal function assessment ( Fig.13 B) and histopathological examination of sections of heart, spleen, lung, and kidney ( Fig.13 C) Results showed no signs of hematopoietic or organ toxicity in mice treated with SNAs and SNAs-C. Taken together, these findings clearly demonstrate the ability of SNAs to reverse LSEC capillarization and effectively treat liver fibrosis while maintaining good biosafety.

[0061] The next step was to challenge the efficacy of SNAs in a TAA-induced mouse liver fibrosis model, a typical model of drug-induced hepatocyte death ( Figure 7 A). SNAs effectively ameliorated the elevated AST levels in TAA-induced liver fibrosis mice compared with the same treatment regimen observed in CCl4-induced liver fibrosis and significantly reduced the extent of fibrosis area compared with mock- and SNAs-C-treated livers ( Figure 7 BD). Consistent with these findings, SNAs significantly reduced α-SMA, a marker of activated hepatic stellate cells, in fibrotic livers ( Figure 7 E&F), and F4 / 80, a marker of active Kupffer cells ( Fig.14 In addition, it also corrected the down-regulated expression level of Stablin-2, a marker of differentiated cells LSEC ( Figure 7 In addition, SEM images of isolated LSECs further confirmed these results, indicating that SNAS increased not only the diameter of the sieve plates but also the number of sieve plates ( Figure 7 G and H). These results clearly demonstrate the ability of SNAs to reverse LSEA capillarization, thereby effectively treating TAA-induced liver fibrosis.

[0062] The next challenge was to use SNAs in a mouse model of cholestasis-induced liver fibrosis, which was established by bile duct ligation (BDL). Figure 7 I). As expected, SNAs effectively ameliorated BDL-induced AST upregulation ( Figure 7 J), while significantly reducing the fibrosis area to that of healthy mice ( Figure 7 K and L). In addition, SNAs significantly reduced the expression of α-SMA, a marker of active hepatic stellate cells, in fibrotic livers ( Figure 7 M and N) and Col I ( Fig.14 C and D), accompanied by increased expression of Stabilin 2, a marker of differentiated LSEC cells ( Figure 7 M and N). In addition, SEM images of isolated LSECs showed that SNAs restored the diameter and number of lamina cribrosa to levels comparable to those of healthy individuals ( Figure 6 O and P). Collectively, these findings suggest that SNAs have the ability to reverse LSEA capillarization and effectively treat BDL-induced liver fibrosis. Of note, it is worth mentioning that the efficacy of SNASCs was almost negligible in all three liver fibrosis models, highlighting the unique role of miR-325-3p in the efficacy of SNAs.

[0063] Liver fibrosis is characterized by excessive accumulation of extracellular matrix, and the clinical challenges it poses remain severe. The therapeutic potential of LSECs in reversing fibrosis has attracted widespread attention and interest. Traditional methods, such as MSC transplantation, have been shown to be effective in reversing LSEC capillarization and alleviating fibrosis. However, mesenchymal stem cell therapy faces limitations such as safety issues (such as tumorigenicity, immune rejection, ethical issues, and high costs). This study not only revealed the intrinsic mechanism of mesenchymal stem cell-induced reversal of LSEC capillarization, namely, regulating the cytoskeleton of LSECs through complex secretion of miR-325-3p, thereby restoring its fenestration and cribriform plate structure to a differentiated state, but also introduced a biomimetic spherical nucleic acid (SNAs) that was specifically designed to selectively target LSECs, while utilizing miR-325-3p to regulate the cytoskeleton and restore the function of LSECs. Therefore, this approach addresses the limitations of mesenchymal stem cell therapy and provides a safer and more effective alternative.

[0064] There are several advantages to using SNAs instead of mesenchymal stem cells for the treatment of liver fibrosis. First, SNAs can specifically target LSECs, ensuring the precise delivery of therapeutic drugs, minimizing off-target effects while improving efficacy. The targeted delivery mechanism of SNAs relies on the overexpression of Scara in liver fibrotic LSECs, thereby achieving selective infiltration and therapeutic effects. This targeting mechanism highlights the superiority of SNAs over MSCs and provides a more controllable, efficient and safe treatment option for liver fibrosis. Second, unlike MSCs, SNAs avoid potential issues related to cell sources and ethical dilemmas because it does not involve the transplantation of living cells. Moreover, and most importantly, preclinical models have shown that SNAs have excellent properties and can effectively reverse LSEC capillarization and reduce fibrosis markers, with effects comparable to or even more significant than those of mesenchymal stem cells.

[0065] In summary, this application highlights the great potential of SNAs in the treatment of liver fibrosis by specifically targeting LSECs and reversing their capillarization. Through innovative design and precise delivery mechanisms, SNAs effectively restored the structure and function of LSECs, reduced fibrosis and improved liver function in multiple preclinical models. The discovery of the role of miR-325-3p in reversing LSEC capillarization through Ptprm targeting further deepens the understanding of the relevant molecular level therapeutic mechanisms by those skilled in the art, thereby advancing the understanding of fibrosis treatment. These findings make SNAs a promising alternative to MSC therapy, bringing hope to patients with chronic liver disease. In addition, the remarkable progress of SNAs strongly suggests that they represent a universal technology that can selectively internalize into LSECs and protect micro-RNAs from degradation, paving the way for targeted and efficient nucleic acid drug therapy specific to LSECs.

[0066] As described above, the basic principle, main features and advantages of the present invention are well described. The above embodiments and descriptions are only descriptions of the preferred implementation modes of the present invention, and the present invention is not limited by the above embodiments. Without departing from the spirit and scope of the present invention, various changes and improvements made by ordinary technicians in this field to the technical solution of the present invention should fall within the protection scope determined by the present invention.

Claims

1. Use of miR-325-3p mimetic compounds in the preparation of drugs, characterized in that: The drug is used for treating at least one of liver fibrosis, reducing the area of ​​liver fibrosis, inhibiting the activation of hepatic stellate cells, reducing the level of Col I, inhibiting the activity of Kupffer cells, improving the differentiation of hepatic sinusoidal endothelial cells, and reversing the capillarization of hepatic sinusoidal endothelial cells.

2. The use according to claim 1, characterized in that: The drug targets Ptprm to regulate the cytoskeleton of hepatic sinusoidal endothelial cells, reverses the capillarization of hepatic sinusoidal endothelial cells, and treats liver fibrosis.

3. A spherical nucleic acid, characterized in that: The spherical nucleic acid is a miRNA mimic compound through thiol and Au + After modification, self-assembly occurs, and the spherical nucleic acid has characteristic peaks in Au-4f orbital and S-2p orbital.

4. The spherical nucleic acid according to claim 3, characterized in that The particle size of the spherical nucleic acid is 13nm~102nm.

5. The spherical nucleic acid according to claim 4, characterized in that The particle size of the spherical nucleic acid is 38 nm.

6. The spherical nucleic acid according to claim 4, characterized in that The particle size of the spherical nucleic acid is 39 nm.

7. The spherical nucleic acid according to claim 3, characterized in that The spherical nucleic acid targets the Scara outer membrane protein on the surface of the hepatic sinusoidal endothelial cells and releases miR-325-3p mimic compounds in the hepatic sinusoidal endothelial cells.

8. The spherical nucleic acid according to any one of claims 3 to 7, characterized in that The miRNA mimic compound is a miR-325-3p mimic compound.

9. Use of the spherical nucleic acid according to any one of claims 3 to 8 in the preparation of a drug, characterized in that: The drug selectively internalizes the miRNA mimic compound into liver sinusoidal endothelial cells through clathrin-dependent endocytosis mediated by Scara outer membrane protein.

10. The use of the spherical nucleic acid according to claim 8 in the preparation of a liver fibrosis drug, characterized in that: The liver fibrosis drug is used for at least one of treating liver fibrosis, reducing the area of ​​liver fibrosis, inhibiting the activation of hepatic stellate cells, reducing the level of Col I, inhibiting the activity of Kupffer cells, improving the differentiation of hepatic sinusoidal endothelial cells, and reversing the capillarization of hepatic sinusoidal endothelial cells.

Images