Construction method and application of C5AR1 gene humanized animal model

Abstract

The invention belongs to the technical field of biology, and relates to a construction method and application of a humanized gene modified animal model, in particular to a construction method and application of a C5AR1 gene humanized animal model. A humanized mouse model with a humanized C5AR1 target spot is constructed, an animal endogenous C5ar1 sequence is replaced with a human C5AR1 related sequence in a homologous recombination mode, and human C5AR1 protein can be normally expressed in the model body, so that the model is applied to research on a C5AR1 signal mechanism.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to a method for constructing and applying a humanized gene-modified animal model, and specifically relates to a method for constructing and applying a C5AR1 gene humanized animal model. Background Art

[0002] The complement system is a major component of innate immunity. It plays a key role in host defense by working with phagocytes and liquid antibodies to identify and eliminate invading pathogens or damaged tissues, thereby restoring the body's homeostasis. In addition to the innate response of vertebrates, the complement system is also involved in conditioning and the enhancement of adaptive immunity. Studies have found that complement plays a variety of functions through its various enzymatic products and can also appear as a key regulator of cancer immunity, and therefore participates in the initiation and development of tumors to varying degrees.

[0003] C5AR1, also known as CD88, is a seven-transmembrane G protein-coupled receptor (GPCR) expressed on the surface of immune cells. The main function of C5AR1 is to serve as a receptor for C5a produced by the complement system. Multiple lines of evidence from mouse models indicate that C5a and C5AR1 play a key role in the initiation of tissue inflammation, especially in autoantibody-induced, neutrophil-driven diseases. As a potent inflammatory mediator, the anaphylatoxin C5a promotes squamous cell carcinogenesis by fostering an immunosuppressive microenvironment through the abnormal expression of C5AR1 on these tumor cells. In addition, C5a stimulates the M2 polarization of tumor-associated macrophages (TAMs) by interacting with C5AR1, thereby promoting tumor metastasis in colon cancer. As one of the receptors for C5a, C5AR1 also plays an important role in the pathogenesis of autoimmune diseases. Studies have shown that the C5a / C5AR1 signaling pathway is involved in the occurrence and development of a variety of diseases, such as rheumatoid arthritis and systemic lupus erythematosus. Therefore, in-depth research on the mechanism of action of the C5a / C5AR1 signaling pathway is of great significance for the treatment of autoimmune diseases and infectious diseases. As an important part of the pathway, C5AR1 has also become one of the hot targets for immunotherapy. At present, several inhibitor drugs targeting the C5 target have been approved for marketing, such as the monoclonal antibody named Ravulizumab-CWVZ for neuromyelitis optica, Cavalizumab for paroxysmal nocturnal hemoglobinuria, and Zilucoplan for myasthenia gravis. Globally, only a small molecule drug named Avacopan for anti-neutrophil cytoplasmic antibody-associated vasculitis is currently on the market for the C5AR1 target. Others, such as INF-904 for chronic urticaria, are in the clinical phase 2 stage, Lzastobart for autoimmune diseases, VIS-954 for hereditary complement deficiency, and ALS-205 for Huntington's disease are in the clinical phase 1 stage, and the research on related drugs for solid tumors and inflammation is in the preclinical stage.

[0004] In preclinical drug research, mice are widely used in drug efficacy evaluation, pharmacology and toxicology analysis, etc. The premise for these studies is that drugs acting on human targets can bind to or activate the corresponding targets of mice. If the test drug cannot bind to the mouse target or activate the downstream signaling pathway, mice cannot be used for drug efficacy, pharmacology and toxicology evaluation. By comparing the C5AR1 protein of humans and mice, it was found that the amino acid identity of the C5AR1 protein of humans and mice was only 65%. This difference in the amino acid sequence of human and mouse proteins is likely to cause drugs targeting human C5AR1 targets to be unable to recognize mouse C5AR1 targets, especially antibody drugs. A difference in the recognition site of one amino acid may cause the antibody to be unable to recognize the target site. Therefore, it is likely that wild-type mice cannot be used to simulate signal transduction, disease model establishment, drug evaluation and screening studies targeting human C5AR1. Animal model experiments are an essential part of preclinical drug research, and the lack of models may become a bottleneck for drug development. The current lack of small animal models of human C5AR1 limits research on human C5AR1 signal transduction, disease research, drug screening and evaluation.

[0005] With the continuous development and maturity of genetic engineering technology, the use of human cells or genes to replace or displace endogenous similar cells or genes of animals to establish a biological system or disease model closer to humans and establish a humanized experimental animal model (humanized animal model), which has provided an important tool for new clinical treatment methods or means. Among them, the genetic humanized animal model, that is, using gene modification operation technology to replace animal homologous genes with normal or mutant human genes, can establish a genetic humanized animal model of normal or mutant genes that are closer to human disease characteristics in animals. Genetically humanized animals not only have important application value in themselves, such as gene humanization can improve the recognition of drugs to drug targets in the body, but more importantly, due to the presence of human gene fragments, proteins with human functions can be expressed or partially expressed in animals, thereby greatly reducing the difference between preclinical animal experiments and clinical experimental results, and providing the possibility of drug screening and verification at the level of preclinical animals. Summary of the invention

[0006] The purpose of the present invention is to construct a C5AR1 gene humanized animal model, using homologous recombination to replace the animal's endogenous C5ar1 sequence with the relevant sequence of human C5AR1, so that the model can normally express human C5AR1 protein in vivo, thereby being applied to the study of C5AR1 signaling mechanism.

[0007] In order to achieve the above-mentioned purpose, the first aspect of the present invention discloses a method for constructing a C5AR1 gene humanized animal model. A targeting vector is used to replace the DNA sequence of amino acids shown in SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, and SEQ ID NO: 18 in the C5ar1 gene of a non-human animal with the DNA sequence of amino acids shown in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, and SEQ ID NO: 10 in the C5AR1 gene of a human.

[0008] Among them, the DNA sequences encoding the amino acids shown in SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO:10 are shown in SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:9.

[0009] The DNA sequences encoding the amino acids shown in SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, and SEQ ID NO: 18 are shown in SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, and SEQ ID NO: 17.

[0010] The genome of the non-human animal after replacement contains a humanized C5AR1 gene, and the sequence of mRNA transcribed from the humanized C5AR1 gene is shown in SEQ ID NO: 23.

[0011] The above-mentioned targeting vector includes: 5' homology arm, resistance screening expression frame, gene fragment of human-mouse chimeric C5AR1, and 3' homology arm; The DNA fragment sequence of the 5' homology arm is shown in SEQ ID NO: 19, the DNA fragment sequence of the 3' homology arm is shown in SEQ ID NO: 20, the DNA fragment sequence of the resistance screening expression frame is shown in SEQ ID NO: 21, and the DNA fragment sequence of the human-mouse chimeric C5AR1 genome is shown in SEQ ID NO: 22.

[0012] After the gene fragment of C5AR1 in a non-human animal is replaced with the gene fragment of human C5AR1 using a targeting vector, the genome of the non-human animal contains a humanized C5AR1 gene, the sequence of the mRNA transcribed from the humanized C5AR1 gene is shown in SEQ ID NO: 23, and the expression of endogenous C5AR1 protein in the non-human animal is reduced or absent.

[0013] Wherein, the DNA sequence encoding the amino acids shown in SEQ ID NO: 35 of the non-human animal is regulated by an endogenous regulatory element.

[0014] The present invention also discloses a C5AR1 gene humanized animal cell, and the C5AR1 gene humanized animal cell is obtained by the above construction method.

[0015] Furthermore, the targeting vector is introduced into a fertilized egg cell of a non-human animal, and the resulting embryo is transplanted into a surrogate mother for development to obtain an F0 generation animal; Select animals with positive genotype identification as F0 positive animals; then hybridize and self-pollinate the F0 positive animals, and self-pollinate the heterozygous animals to obtain homozygous animals, so as to establish stable humanized C5AR1 gene-modified animals; Among them, the C5AR1 gene humanized animal model is a genetically modified animal that can stably express human C5AR1 protein.

[0016] In addition, the present invention also discloses a tissue or organ, which is derived from a C5AR1 gene humanized animal model or its offspring, and the C5AR1 gene humanized animal model is obtained by the above-mentioned method for constructing a C5AR1 gene humanized animal model.

[0017] The second aspect of the present invention discloses the application of the above C5AR1 gene humanized animal model in the field of studying human C5AR1 gene or protein, wherein the C5AR1 gene humanized animal model also includes cells, cell lines or cell cultures, tissues, organs, etc. derived from the C5AR1 gene humanized animal model.

[0018] The applications described include: a) Development of products involving immunological processes in human cells, and use in the manufacture or screening of human antibodies; b) Application as a model system in pharmacology, immunology, microbiology and medical research; c) Production and use of animal experimental disease models involving human cells for use in etiological research; d) In vivo screening, efficacy testing, efficacy assessment, validation or evaluation of human C5AR1 signaling pathway modulators; or e) Study the function of C5AR1 gene, study human C5AR1 antibodies, study drugs targeting human C5AR1 target site and their efficacy, and study the use of drugs for immune-related diseases as well as anti-tumor or inflammatory drugs.

[0019] Compared with the prior art, the present invention has the following advantages: The present invention provides a method for constructing a C5AR1 gene humanized animal cell and an animal model and applications. The C5AR1 gene humanized animal model constructed by the present invention can accelerate research progress in fields related to the human C5AR1 gene or protein, for example, can be used to evaluate the efficacy of human C5AR1 target drugs, has important guiding significance for the clinical effects of drug development, and is also an ideal model for drug safety evaluation, and performs preclinical in vivo evaluation of the toxicology of human C5AR1 target drugs.

[0020] The present invention utilizes ES cell targeting technology to replace part of the mouse C5ar1 gene with the human C5AR1 gene in mice with a sound immune system, thereby constructing a mouse model that can interact with anti-human C5AR1 antibodies. Compared with ordinary mice, this model achieves the humanization of key target molecules and retains a complete immune system. It can be used to screen and evaluate drugs targeting the human C5AR1 gene, and is an ideal preclinical drug testing model.

[0021] The C5AR1 humanized mouse constructed by the present invention replaces the extracellular region of the mouse C5ar1 gene with a human sequence, while the intracellular region retains the complete mouse sequence. The successfully produced humanized mouse has a human extracellular region, which can be used to screen human C5AR1 target drugs, while the mouse intracellular region ensures that its intracellular signal transduction is not affected, and faithfully converts external stimuli into intracellular behavior.

[0022] The present invention provides a method for constructing a humanized C5AR1 genetically modified animal model and its application, and relates to the field of biotechnology. The humanized C5AR1 genetically modified animal model constructed by the present invention can accelerate the research progress in the field related to the human C5AR1 gene or protein, for example, using the humanized C5AR1 genetically modified animal model to replace human drug testing, and providing an effective model and powerful tool for preclinical experiments of C5AR1 target drugs. The present invention uses ES cell targeting technology to replace a partial sequence of the mouse C5AR1 gene with a partial sequence of the human C5AR1 gene, and constructs a mouse model that can interact with anti-human C5AR1 antibodies. Compared with ordinary mice, the model realizes the humanization of key target molecules, can be used to screen and evaluate drugs targeting the human C5AR1 gene, and is a very ideal preclinical drug testing model. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the existing methods and experiments, the following is a brief introduction to the drawings required for use in the embodiments. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 Schematic diagram of the structure of mouse C5AR1 gene and human C5AR1 gene.

[0025] Figure 2 Schematic diagram of the gene structure of the modified humanized mouse C5AR1.

[0026] Figure 3 Schematic diagram of the targeting scheme for humanizing the mouse C5AR1 gene.

[0027] Figure 4 This is the electrophoresis diagram of PCR identification of homologous recombination-positive ES cells. Figure A and Figure B are the electrophoresis diagrams of homologous recombination identification of 5' homology arm and 3' homology arm, respectively. The numbers above are the ES clone numbers; WT is the wild-type control; M is the 1kb DNA marker.

[0028] Figure 5 This is the electrophoresis of homologous recombination PCR identification results of F1 generation mice. Figure A and Figure B are the electrophoresis of homologous recombination identification of 5' homologous arm and 3' homologous arm of F1 generation mice, respectively. The numbers above are the mouse numbers; WT is the wild-type control; M is the 1kb DNA marker.

[0029] Figure 6 Schematic diagram for qPCR primer position design.

[0030] Figure 7 The qPCR results of wild-type mice and homozygous mice. HO is hC5AR1 homozygous mouse; WT is wild-type mouse; M is electrophoresis DNA marker.

[0031] Fig. 8A The results of C5AR1 expression in bone marrow cells in wild-type mouse blood samples are shown in Figure 2. Figure 8B The results show the expression of C5AR1 in bone marrow cells in blood samples of C5AR1 humanized homozygous mice.

[0032] Fig. 9A The results of C5AR1 expression in bone marrow cells of wild-type mice bone marrow samples are shown in Figure 2. Fig. 9B The results show the expression of C5AR1 in bone marrow cells of bone marrow samples from C5AR1 humanized homozygous mice.

[0033] Fig.10 Strategies for sequence design of DNA fragments containing human-mouse chimeric C5AR1 genome. DETAILED DESCRIPTION

[0034] The present invention is further described below in conjunction with specific examples. The experimental methods and techniques in the following examples without specifying specific conditions are usually carried out according to conventional conditions in the relevant field or according to conditions recommended by the manufacturer.

[0035] The mouse strains, biochemical reagents, and experimental instruments used in the examples of the present invention are: The primer synthesis and sequencing services were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0036] C57BL / 6 and ICR mice were purchased from Shanghai Lingchang Biotechnology Co., Ltd.

[0037] EcoRI restriction endonuclease was purchased from NEB with the catalog number R3101M.

[0038] The PCR product gel recovery kit was QIAquick Gel Extraction Kit, purchased from QIAGEN, catalog number 28706.

[0039] Human Anti-C5a-R antibody was purchased from Abcam with the catalog number ab252435.

[0040] Mouse Anti-C5a-R was purchased from Abcam with the catalog number ab54378.

[0041] The manufacturer of the flow cytometer is BECKMAN COULTER, and the model is CytoFLEX Flow Cytometer.

[0042] Example 1 Construction of C5AR1 humanized mouse model The human C5AR1 gene contains multiple transcripts, and the sequence design of this embodiment is mainly described by taking one of the transcripts as an example. The overall strategy of humanization is: from the DNA level, part of the intron1 (SEQ ID NO: 1) and the extracellular coding region of the human C5AR1 gene (ENSEMBL Gene ID: ENSG00000197405) transcript (ENSEMBL ID: ENST00000355085.4) are replaced with part of the intron1 (SEQ ID NO: 2) and the extracellular coding region of the corresponding mouse C5ar1 gene (ENSEMBL Gene ID: ENSMUSG00000049130) transcript (ENSMUST00000168818.2). The first extracellular region DNA sequence of the human C5AR1 gene (ENSEMBL Gene ID: ENSG00000197405) transcript (ENSEMBL ID: ENST00000355085.4) is shown in SEQ ID NO: 3, and the corresponding protein amino acid sequence is shown in SEQ ID NO: 4. The second extracellular region DNA sequence of the human C5AR1 gene (ENSEMBL Gene ID: ENSG00000197405) transcript (ENSEMBL ID: ENST00000355085.4) is shown in SEQ ID NO: 5, and the corresponding protein amino acid sequence is shown in SEQ ID NO: 6. The third extracellular region DNA sequence of the human C5AR1 gene (ENSEMBL Gene ID: ENSG00000197405) transcript (ENSEMBL ID: ENST00000355085.4) is shown in SEQ ID NO: 7, and the corresponding protein amino acid sequence is shown in SEQ ID NO: 8, the DNA sequence of the fourth extracellular region of the transcript of human C5AR1 gene (ENSEMBL Gene ID: ENSG00000197405) (ENSEMBL ID: ENST00000355085.4) is shown in SEQ ID NO: 9, and the corresponding protein amino acid sequence is shown in SEQ ID NO: 10. The DNA sequences of the extracellular region of the replaced region of the transcript of mouse C5AR1 gene (ENSEMBL Gene ID: ENSMUSG00000018920) (ENSMUST00000019064.9) are shown in SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, and SEQ ID NO: 17, respectively, and the corresponding protein amino acid sequences are shown in SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, and SEQ ID NO: 18, respectively.

[0043] Schematic diagram of the comparison between mouse C5AR1 gene and human C5AR1 gene is shown in Figure 1 The schematic diagram of the final modified humanized mouse C5AR1 gene is shown in Figure 2 .

[0044] According to the sequence design, the present invention further designs the following Figure 3 The homologous recombination scheme shown in the figure and the vector containing the 5' homology arm, the resistance screening expression cassette, the DNA fragment of the human-mouse chimeric C5AR1 genome, and the 3' homology arm. The 5' homology arm (SEQ ID NO: 19) is the nucleotides 15983316-15984315 of the NCBI accession number NC_000073.7; the 3' homology arm (SEQ ID NO: 20) is the nucleotides 15980933-15982169 of the NCBI accession number NC_000073.7; the resistance screening expression cassette (SEQ ID NO: 21) contains the resistance gene neomycin phosphotransferase (Neo) expression cassette for positive clone screening, the FRT sites specifically recognized by the Flp recombinase arranged in the same direction on both sides of the expression cassette for subsequent removal of the expression cassette, and the identification primers and other sequences; the DNA fragment sequence containing the human-mouse chimeric C5AR1 genome is as shown in SEQ ID NO: 22. The sequence design of the specific construction strategy is as follows Fig.10 The blue background represents the human partial intron1 sequence, i.e., the sequence shown in SEQ ID NO: 1, the yellow background represents the human extracellular region coding sequence, and the green background represents the mouse intracellular region sequence.

[0045] According to the design plan, the mRNA sequence of humanized C5AR1 expressed by the transformed humanized mouse is shown in SEQ ID NO: 23, and the protein sequence is shown in SEQ ID NO: 24. According to the strategic design plan, ES targeting was used to construct a C5AR1 humanized mouse model.

[0046] Using C57BL / 6 mouse genomic DNA or BAC library as a template, PCR amplification was performed to obtain the 5' homology arm and 3' homology arm. Using the synthetic human-mouse chimeric C5AR1 gene fragment and the resistance gene expression frame as a template, PCR amplification was performed to obtain the resistance screening expression frame and the gene fragment of human-mouse chimeric C5AR1. The fragment was connected to the PBR322-MCS plasmid using the Infusion kit to obtain the homologous recombination vector PBR322-C5AR1. After the vector was verified to be correct by restriction digestion and sequencing, it was electroporated into mouse embryonic stem cells (ES cells) and transferred into ES cells. After clonal screening of ES cells, a total of 96 resistant ES cell clones were finally obtained. After the genomic DNA of the resistant ES cell clones was extracted, the 5' homology arm and 3' homology arm homologous recombination positive clones were PCR identified by long-fragment PCR. The positions of the primers for PCR identification are shown in the figure below. Figure 3 The specific identification information is as follows: The conditions for identifying 5' arm homologous recombination are as follows: The primer sequence information is as follows: Primer name Sequence information (5'→3') P1 TCCCCACCCTGCCTCCTGTTACTG (SEQ ID NO: 25) P2 AGGCCTACCCGCTTCCATTGCTCA (SEQ ID NO: 26) The PCR reaction system is as follows: PCR reaction composition Volume(µL) <![CDATA[ddH2O]]> 13.2 GXL PCR Buffer 2 2.5 mM dNTP 2 Primer P1 (10pmol / µL) 0.5 Primer P2 (10pmol / µL) 0.5 GXL DNA Polymerase* 0.8 Genomic DNA 1 total 20 * PrimeStar GXL (TaKaRa, Code No: R050A) The PCR reaction procedure is as follows: step Temperature (℃) time Remark 1 94 3 min 2 98 15 sec 3 61 15 sec 4 68 2 min Repeat steps 2-4 for a total of 35 cycles 5 68 5 min 6 12 10 min The conditions for identifying 3' arm homologous recombination are as follows: The primer sequence information is as follows: Primer name Sequence information (5'→3') P3 CTGGCGGCGAATGGGCTGAC (SEQ ID NO: 27) P4 GCTGGGGCTGGGGGAGGAGAAA (SEQ ID NO: 28) The PCR reaction system is as follows: PCR reaction composition Volume(µL) <![CDATA[ddH2O]]> 13.2 GXL PCR Buffer 2 2.5 mM dNTP 2 Primer P3 (10pmol / µL) 0.5 Primer P4 (10pmol / µL) 0.5 GXL DNA Polymerase* 0.8 Genomic DNA 1 total 20 * PrimeStar GXL (TaKaRa, Code No: R050A) The PCR reaction procedure is as follows: step Temperature (℃) time Remark 1 94 3 min 2 98 15 sec 3 61 15 sec 4 68 4 min Repeat steps 2-4 for a total of 35 cycles 5 68 5 min 6 12 10 min According to the design strategy and identification scheme, the 5' arm homologous recombination positive clone should amplify a 2.2 kb fragment, and the negative clone should have no product; the 3' arm homologous recombination positive clone should amplify a 5.7 kb fragment, and the negative clone should have no product. After identification, a total of 1 ES cell clone (A3) with positive homologous recombination in both 5' and 3' arms was obtained from 96 resistant clones. The electrophoresis results are as follows: Figure 4 shown.

[0047] A3 positive ES cell clones were expanded and injected into C57BL / 6 mouse blastocysts to obtain highly chimeric male mice. Chimeric male mice were mated with mice expressing Flp recombinase in the early stages of oocyte / embryo development to obtain C5AR1 humanized F1 generation mice with resistance gene removed. The PCR identification method for F1 generation mice is as follows: The conditions for identifying 5' arm homologous recombination are as follows: The primer sequence information is as follows: Primer name Sequence information (5'→3') P1 TCCCCACCCTGCCTCCTGTTACTG (SEQ ID NO: 25) P5 CCCGTCTCTACTGAAAATACAGCATCCCT (SEQ ID NO: 29) The PCR reaction system is as follows: PCR reaction composition Volume(µL) <![CDATA[ddH2O]]> 13.2 GXL PCR Buffer 2 2.5 mM dNTP 2 Primer P1 (10pmol / µL) 0.5 Primer P5 (10pmol / µL) 0.5 GXL DNA Polymerase* 0.8 Genomic DNA 1 total 20 * PrimeStar GXL (TaKaRa, Code No: R050A) The PCR reaction procedure is as follows: step Temperature (℃) time Remark 1 94 3 min 2 98 15 sec 3 60 15 sec 4 68 2 min Repeat steps 2-4 for a total of 35 cycles 5 68 5 min 6 12 10 min The conditions for identifying 3' arm homologous recombination are as follows: The primer sequence information is as follows: Primer name Sequence information (5'→3') P6 GGCGTGGACTACAGCCACGACAAAC (SEQ ID NO: 30) P4 GCTGGGGCTGGGGGAGGAGAAA (SEQ ID NO: 28) The PCR reaction system is as follows: PCR reaction composition Volume(µL) <![CDATA[ddH2O]]> 13.2 GXL PCR Buffer 2 2.5 mM dNTP 2 Primer P6 (10pmol / µL) 0.5 Primer P4 (10pmol / µL) 0.5 GXL DNA Polymerase* 0.8 Genomic DNA 1 total 20 * PrimeStar GXL (TaKaRa, Code No: R050A) The PCR reaction procedure is as follows: step Temperature (℃) time Remark 1 94 3 min 2 98 15 sec 3 61 15 sec 4 68 3 min Repeat steps 2-4 for a total of 35 cycles 5 68 5 min 6 12 10 min After PCR identification and sequencing confirmation, a total of 5 positive mice were obtained, numbered: 16, 31, 32, 33, and 37. The results of PCR identification and electrophoresis are as follows Figure 5 Middle A and Figure 5 As shown in B. Mice with positive 5' arm homologous recombination and resistance gene removal can amplify a 1.9kb PCR product, mice with resistance gene removal can amplify a 3.7kb PCR product, and wild-type mice can amplify no PCR product; F1 generation mice with positive 3' arm homologous recombination can amplify a 4.3 kb target PCR product band, and wild-type should have no band. The F1 generation mice obtained by breeding are used to expand the population by breeding with wild-type C57BL / 6 mice, and homozygous mice are obtained by self-crossing for subsequent experimental verification.

[0048] The above results indicate that this method can be used to efficiently construct a C5AR1 gene humanized mouse model that can be stably propagated.

[0049] Example 2 Verification of expression of human C5AR1 in a humanized mouse model Verification of mRNA expression of human C5AR1 in humanized mouse models C5AR1 humanized homozygous mice and a wild-type mouse of the same litter (6 weeks old) were selected to extract total spleen RNA, which was reverse transcribed into cDNA using a reverse transcription kit. PCR was performed using cDNA as a template to verify the expression level of human C5AR1 mRNA in humanized mice.

[0050] In this experiment, primers were designed for detecting mouse C5AR1 and human C5AR1 RNA, respectively. Figure 6 The positions of P7 / P8 and P9 / P10 primers are shown in Figure 1. The RNA detection results are shown in Figure 2. Figure 7 As shown. The primer sequences for detecting the expression of mouse C5AR1 RNA are: P7: 5'-CTGGTACTTTGATGCCACCG-3' (SEQ ID NO: 31), and P8: 5'-CAGTGTGCTCTGAGTAGAAGTC-3' (SEQ ID NO: 32), PCR product is 257 bp; The primer sequences for human C5AR1 RNA expression detection are: P9: 5'-GTCCGGGAGGAGTACTTTC-3' (SEQ ID NO: 33), and P10: 5'-GCTTCTTCAGCAGCAGGAA-3' (SEQ ID NO: 34), the PCR product size is 313 bp.

[0051] The PCR reaction system and reaction conditions of the two primer pairs P7 / P8 and P9 / P10 were the same, 20μL PCR system, reaction conditions: 94℃, 4min; (94℃, 15sec; 58℃, 15sec; 72℃, 45sec, 32 cycles); 72℃, 5min; 12℃ insulation.

[0052] The above results indicate that active human C5AR1 expression can be detected at the RNA level in C5AR1 humanized mice.

[0053] Verification of protein expression of human C5AR1 in humanized mouse models In order to verify whether human C5AR1 protein is expressed after humanization, the applicant detected the expression of C5AR1 protein in bone marrow cells including dendritic cells, neutrophils, macrophages and monocytes in the blood (Figure 8A-Figure 8B) and bone marrow (Figure 9A-Figure 9B) of wild-type mice and C5AR1 humanized homozygous mice by ELISA. The results were consistent with expectations: human C5AR1 protein was not expressed in dendritic cells, neutrophils, macrophages and monocytes in the blood and bone marrow of wild-type mice, and human C5AR1 protein was expressed in dendritic cells, neutrophils, macrophages and monocytes in the blood and bone marrow of C5AR1 humanized homozygous mice.

[0054] The results indicate that human C5AR1 protein can be expressed in C5AR1 humanized mice, and this mouse model can be used to conduct related studies such as drug screening and verification at the preclinical animal level.

Claims

1. A method for constructing a C5AR1 gene humanized animal model, characterized in that: Using ES cell targeting technology, a targeting vector is used to replace the DNA sequence of amino acids such as SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, and SEQ ID NO: 18 in the C5ar1 gene of a non-human animal with the DNA sequence of amino acids such as SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, and SEQ ID NO: 10 in the C5AR1 gene of a human; The targeting vector comprises: a 5' homology arm, a resistance screening expression frame, a gene fragment of human-mouse chimeric C5AR1, and a 3' homology arm; The DNA fragment sequence of the 5' homology arm is shown in SEQ ID NO: 19, the DNA fragment sequence of the 3' homology arm is shown in SEQ ID NO: 20, the DNA fragment sequence of the resistance screening expression frame is shown in SEQ ID NO: 21, and the DNA fragment sequence of the human-mouse chimeric C5AR1 genome is shown in SEQ ID NO:

22.

2. The method for constructing a C5AR1 gene humanized animal model according to claim 1, characterized in that: The DNA sequences encoding the amino acids shown in SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO:10 are shown in SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:

9.

3. The method for constructing a C5AR1 gene humanized animal model according to claim 1, characterized in that: The DNA sequences encoding the amino acids shown in SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, and SEQ ID NO: 18 are shown in SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, and SEQ ID NO:

17.

4. The method for constructing a C5AR1 gene humanized animal model according to claim 1, characterized in that: After the replacement is completed, the genome of the non-human animal contains a humanized C5AR1 gene, the sequence of the mRNA transcribed from the humanized C5AR1 gene is as shown in SEQ ID NO: 23, and the expression of endogenous C5AR1 protein in the non-human animal is reduced or absent.

5. The method for constructing a C5AR1 gene humanized animal model according to claim 1, characterized in that: The targeting vector is introduced into the fertilized egg cell of the non-human animal, and the developed embryo is transplanted into a surrogate mother for development to obtain an F0 generation animal; Select animals with positive genotype identification as F0 positive animals; then hybridize and self-pollinate the F0 positive animals, and self-pollinate the heterozygous animals to obtain homozygous animals, so as to establish stable humanized C5AR1 gene-modified animals; Among them, the C5AR1 gene humanized animal model is a genetically modified animal that can stably express human C5AR1 protein.

6. Application of the C5AR1 gene humanized animal model obtained by the construction method according to any one of claims 1 to 5 in the field of studying human C5AR1 gene or protein.

7. The use according to claim 6, characterized in that The applications described include: a) Development of products involving immunological processes in human cells, and use in the manufacture or screening of human antibodies; b) Application as a model system in pharmacology, immunology, microbiology and medical research; c) Production and use of animal experimental disease models involving human cells for use in etiological research; d) In vivo screening, efficacy testing, efficacy assessment, validation or evaluation of human C5AR1 signaling pathway modulators; or e) Study the function of C5AR1 gene, study human C5AR1 antibodies, study drugs targeting human C5AR1 target site and their efficacy, and study the use of drugs for immune-related diseases as well as anti-tumor or inflammatory drugs.

Images