Andactylogyrus eel and Andactylogyrus brachycarpus genetic typing nucleic acid molecule and kit

Abstract

The invention provides anguilla anguilla and anguilla brachycarpus genotyping nucleic acid molecules and a kit, the anguilla anguilla and anguilla brachycarpus genotyping nucleic acid molecules comprise a primer group, the primer group comprises a first primer and a second primer, the first primer has a sequence as shown in SEQ ID NO.1, and the second primer has a sequence as shown in SEQ ID NO.2; the second primer has a sequence as shown in SEQ ID NO. 2. According to the invention, the anguilla anguilla and the anguilla brachycarpus can be successfully and rapidly identified by an SNP-Taqman fluorescent quantitative PCR (Polymerase Chain Reaction) method; the operation is simple and convenient, and the detection time is short.

Description

Technical Field

[0001] The invention relates to the field of biological detection, and in particular to a nucleic acid molecule and a kit for genotyping of Pseudomonas anguillarum and Pseudomonas brevis. Background Art

[0002] Dactylariasis is one of the main parasitic diseases in eel farming. In severe cases, it causes necrosis and disintegration of the gills of diseased eels, loss of respiratory function, and mass death of eels. In addition, large-scale parasitism and excessive use of anthelmintics can also cause stress in fish, leading to other diseases and huge economic losses. According to literature reports, there are currently two species of Dactylariasis parasitizing farmed eels in China, namely Dactylariasis anguillaris and Dactylariasis short hook.

[0003] The commonly used methods for identifying Pseudomonas anguillaris and Pseudomonas short-hook are mainly morphological identification under a microscope or differential base identification through sequencing, but both methods have major problems in use. The first is morphological identification under a microscope. Pseudomonas anguillaris and Pseudomonas short-hook can be identified by the full length of the central hook when the inner bend is extended. Pseudomonas anguillaris is more than 94μm, and Pseudomonas short-hook is less than 81μm. However, this identification method is affected by many restrictive factors, such as the extension state of the central hook of the worm body, the morphological direction of the worm body under a microscope, and the preservation state of the worm body. In addition, this method requires a high level of technical skills and concentration of the identification operator, making it difficult to achieve long-term and large-scale identification of Pseudomonas species. The other method is to identify differential bases through sequencing. This method first requires extracting the nucleic acid DNA of Dactylorhiza anguillarum and Dactylorhiza short hook, then performing PCR nucleic acid amplification on the specific sequence, and then sending the amplified product to a sequencing company for sequence determination, and comparing the differential bases of Dactylorhiza anguillarum and Dactylorhiza short hook. The operation of this method is relatively cumbersome and time-consuming, and it can only identify a single worm, and the detection throughput is extremely low. In summary, the existing methods for identifying Dactylorhiza anguillarum and Dactylorhiza short hook cannot meet the practical application needs such as epidemiological surveys of Dactylorhiza anguillarum.

[0004] The difference between SNP-Taqman fluorescence quantitative PCR and ordinary fluorescence quantitative PCR is that the reaction system of fluorescence quantitative PCR contains two primers and a probe for the target fragment, and the goal is to detect the presence or absence of the target fragment; while the reaction system of the SNP-Taqman method contains two primers and two probes, and the two probes are respectively labeled with different fluorescent signals (such as FAM, VIC, etc.), respectively targeting two detection target fragments. When detecting unknown samples, it is only necessary to identify the two detection target fragments based on the fluorescent signal emitted after the unknown sample is amplified. Therefore, SNP-Taqman fluorescence quantitative PCR has higher requirements for the specificity of primers and probes, and is difficult to design. There is no record of the successful design of related primers and probes in the existing literature, and it is impossible to identify Dactylopsis anguillarum and Dactylopsis short hook by the SNP-Taqman fluorescence quantitative PCR method. Summary of the invention

[0005] 1. Technical issues to be resolved

[0006] In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides a nucleic acid molecule and a kit for genotyping Dactylum anguillarum and Dactylum short-hook, which can successfully identify Dactylum anguillarum and Dactylum short-hook quickly through the SNP-Taqman fluorescent quantitative PCR method;

[0007] Correspondingly, the present invention also provides a method for genotyping of Pseudomonas anguillarum and Pseudomonas short-hookii, which can be quickly detected with high accuracy.

[0008] (II) Technical solution

[0009] In order to achieve the above object, the main technical solutions adopted by the present invention include:

[0010] In the first aspect, the present invention provides a nucleic acid molecule for genetic typing of Dactylum anguillarum and Dactylum short-hook, which includes a primer set, the primer set including a first primer and a second primer, the first primer having a sequence as shown in SEQ ID NO.1; the second primer having a sequence as shown in SEQ ID NO.2.

[0011] Optionally, it comprises a probe set, the probe set comprising a first probe and a second probe, the first probe having a sequence as shown in SEQ ID NO.3; the second probe having a sequence as shown in SEQ ID NO.4. Sequence shown in SEQ ID NO.1 (5'-3'): CTTCAGTGACCAAATCTATATGCAAATT;

[0012] Sequence shown in SEQ ID NO.2 (5'-3'): CACAAGAAGACAGCAAACCATCA;

[0013] Sequence shown in SEQ ID NO.3 (5'-3'): CATTCGTGTCGTTGTT;

[0014] The sequence shown in SEQ ID NO.4 (5'—3'): CATTCGTGTCATTGTT.

[0015] The first probe is labeled with a FAM fluorescent group at the 5' end and an MGB quencher at the 3' end, which is used to detect Dactylophora anguillarum; the second probe 2A / G Probe2 is labeled with a VIC fluorescent group at the 5' end and an MGB quencher at the 3' end, which is used to detect Dactylophora anguillarum. When detecting Dactylophora anguillarum DNA, the FAM fluorescent signal is enhanced; when detecting Dactylophora anguillarum, the VIC fluorescent signal is enhanced.

[0016] The present invention screens and verifies the conservatively different base sites between Pseudomonas anguillae and Pseudomonas short-hook, finds SNP sites with stable differences and satisfying the primer and probe design requirements of SNP-Taqman fluorescent quantitative PCR, which can be used for the identification of Pseudomonas anguillae and Pseudomonas short-hook, and verifies and optimizes them, so that the Pseudomonas anguillae can be quickly, efficiently and conveniently identified as Pseudomonas anguillae or Pseudomonas short-hook.

[0017] Among them, the primers and probes provided by the present invention have strong specificity for the target sequence, and two sets of reaction systems will be formed between the two primers and the two probes, and no interference should be generated between the reaction systems. The SNP site used for identification and screening should be located in the middle of the designed probe to avoid non-specific amplification. The primers and probes provided by the present invention can avoid the formation of more than three continuous pairings between the primers themselves, the primers and the probes, and the primers themselves, and avoid the primers themselves from forming a circular hairpin structure, etc.

[0018] In a second aspect, the present invention also provides a kit for genotyping of Dactylum anguillarum and Dactylum short-hook, which includes a TaqMan fluorescent quantitative PCR reaction solution, and the PCR reaction solution includes a first primer, a second primer, a first probe and a second probe.

[0019] Optionally, the PCR reaction solution includes DNA template 50×ROX Reference Dye.

[0020] Optionally, the reaction conditions of fluorescent quantitative PCR are: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing and extension at 62°C for 1 min, and the heating and cooling rate of each step is set higher than 3.5°C / sec.

[0021] Optionally, the fluorescence quantitative PCR is performed on a real-time fluorescence quantitative PCR instrument, and the fluorescence signal changes of the two dyes FAM and VIC of each sample are monitored in real time. A fluorescence signal intensity scatter plot is constructed with the fluorescence signal intensity of the two dyes FAM and VIC as the horizontal and vertical coordinates to identify whether the sample is Dactylopius anguillaris or Dactylopius shorthookii.

[0022] (III) Beneficial effects

[0023] The beneficial effects of the present invention are:

[0024] The present invention provides a nucleic acid molecule for genotyping of Pseudomonas anguillaris and Pseudomonas short-hook, which can successfully identify Pseudomonas anguillaris and Pseudomonas short-hook through a SNP-Taqman fluorescence quantitative PCR method;

[0025] The operation is simple and the detection time is short. The detection operation process can form a simple and easy-to-understand operating procedure. The entire detection process only takes 1.5 to 2 hours, which can save a lot of time for related scientific research and detection work;

[0026] The present invention can achieve quantitative detection by calculating the relationship between the number of insect bodies or the number of nucleic acid copies and the Ct value of the amplification curve. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a schematic diagram of the SNP-Taqman fluorescent quantitative PCR reaction process in Example 3 of the present invention;

[0028] Figure 2 This is a graph showing the relationship between the number of insect bodies or the number of nucleic acid copies calculated and the Ct value of the amplification curve in Example 3 of the present invention;

[0029] Figure 3 A scatter plot of fluorescence signal intensity is constructed in Example 3 of the present invention. DETAILED DESCRIPTION

[0030] In order to better explain the present invention and facilitate understanding, the present invention is described in detail below through specific implementation methods.

[0031] The DNA sequence of Dactylopidae in the present invention is shown as SEQ ID NO.5; the DNA sequence of Dactylopidae is shown as SEQ ID NO.6.

[0032] Example 1

[0033] This embodiment provides a nucleic acid molecule for genetic typing of Dactylopius anguillarum and Dactylopius short-hook, which includes a primer set, the primer set includes a first primer and a second primer, the first primer has a sequence as shown in SEQ ID NO.1; the second primer has a sequence as shown in SEQ ID NO.2.

[0034] In some other specific embodiments, it includes a probe set, the probe set includes a first probe and a second probe, the first probe has a sequence as shown in SEQ ID NO.3; the second probe has a sequence as shown in SEQ ID NO.4;

[0035] In some other specific embodiments, the first probe is labeled with a FAM fluorescent group at the 5' end and a MGB quencher at the 3' end for detecting Dactylopidae; the second probe is labeled with a VIC fluorescent group at the 5' end and a MGB quencher at the 3' end for detecting Dactylopidae.

[0036] The primer set and probe set provided in this embodiment can enable the genotyping of Dactylaria anguillarum and Dactylaria short hook, and are successfully applied to SNP-Taqman fluorescent quantitative PCR. It has strong specificity for the target sequence (Dactylaria anguillarum and Dactylaria short hook), and 2 sets of reaction systems will be formed between the 2 primers (the first primer and the second primer) and the 2 probes (the first probe and the second probe), and no interference shall be generated between the reaction systems. The SNP site used for identification and screening should be located in the middle of the designed probe to avoid nonspecific amplification. The primers (the first primer and the second primer) and probes provided by the present invention can avoid the formation of more than 3 continuous pairings between the primer set itself, the primer set and the probe set, and the primer set, and avoid the primer set itself from forming a circular hairpin structure, etc.

[0037] Example 2

[0038] This embodiment provides a verification method for the nucleic acid molecules used for genotyping of Pseudomonas anguillarum and Pseudomonas shorthookii in Example 1, the steps of which are as follows:

[0039] S1 Preliminary identification of Dactylopidae anguillarum and Dactylopidae short hook:

[0040] Observe under a microscope and make preliminary identification of the morphological characteristics of Pseudomonas anguillaris based on the total length of the central hook when the inner bend is extended; absorb the free single Pseudomonas anguillaris (Pseudomonas anguillaris and Pseudomonas short-hook) and fix them with 90% ethanol and store them separately for molecular identification;

[0041] S2 Nucleic acid extraction of Dactylopidae anguillarum and Dactylopidae shorthook

[0042] The Viral RNA / DNA Extraction Kit was used to extract DNA from Dactylum anguillarum and Dactylum brevis according to the instructions, and the concentration and purity of the DNA were determined by an ultra-micro spectrophotometer.

[0043] S3 Pseudoglossina 18S rDNA-ITS1-5.8S rDNA-ITS2-28S rDNA sequence amplification

[0044] Primers were synthesized according to Table 1, and ITS, 18s rDNA, 28s rDNA, and 18+28s rDNA sequences were amplified for Pseudo-Dactylus anguillatus and Pseudo-Dactylus short-hook separated and identified by microscopic morphology, and the target fragment sizes were 1100bp, 1846bp, 866bp, and 1950bp, respectively. The electrophoresis bands that met the target fragment size were cut and recovered, and the recovery steps were referred to the instructions of the Thermo GeneJET gel recovery kit. The recovered amplification products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the 18S rDNA-ITS1-5.8SrDNA-ITS2-28S rDNA sequences of Pseudo-Dactylus anguillatus and Pseudo-Dactylus short-hook were obtained by splicing the sequences, with a total length of about 3897bp.

[0045] Table 1 Primers required for amplification of ITS, 18s rDNA, 28s rDNA, and 18+28s rDNA sequences of Pseudomonas anguillarum and Pseudomonas shorthookii

[0046]

[0047] S4 Pseudogyctolagus sequence alignment, obtaining differential bases

[0048] The 18S rDNA-ITS1-5.8S rDNA-ITS2-28S rDNA sequences of Dactylum anguillarum and Dactylum short hook were compared, and 5 different bases were obtained, which were named SNP1 (G / A), SNP2 (A / G), SNP3 (A / G), SNP4 (G / T), and SNP5 (T / C). The above steps were repeated in subsequent batches of Dactylum samples to verify the conservation of the 5 different bases.

[0049] S5 TaqMan-SNP primer verification

[0050] Table 2 TaqMan-SNP primers and probes

[0051]

[0052]

[0053] Sequences containing 5 differential bases and SNPs were input into Primer Express 3.0.1 software and verified according to the following conditions:

[0054] ① The Tm value of the primer is between 58℃ and 60℃, and the Tm value of the probe is between 65℃ and 67℃;

[0055] ② The primer length is between 18bp and 30bp, the optimal length is 20bp, and the probe length is between 13bp and 20bp;

[0056] ③ The GC content of primers and probes should be between 30% and 60%; excessive repetition of the same base should be avoided, and there should not be 4 or more consecutive G bases;

[0057] ④The SNP site is close to the center of the probe;

[0058] ⑤ The base at the 5' end of the probe must not be G, and the base at the 3' end of the primer must not be A, to avoid more than 3 identical bases;

[0059] ⑥ The primer itself must not form a circular hairpin structure;

[0060] ⑦ Primers themselves, primers and probes, and primers should not form more than three consecutive pairs;

[0061] ⑧The length of the amplified product is between 50bp and 80bp.

[0062] The SNP sites and the corresponding primers and probes were verified by software scoring to obtain the primers and probes in Example 1, as shown in Table 2.

[0063] The probe 2A / G Probe1 5' end is labeled with a FAM fluorescent group, and the 3' end is labeled with an MGB quencher group, which is used to detect Dactylorhiza anguillarum; the probe 2A / G Probe2 5' end is labeled with a VIC fluorescent group, and the 3' end is labeled with an MGB quencher group, which is used to detect Dactylorhiza anguillarum. When detecting Dactylorhiza anguillarum DNA, the FAM fluorescence signal is enhanced; when detecting Dactylorhiza anguillarum, the VIC fluorescence signal is enhanced. The above primers and probes were sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. Through verification, the primers and probes in Example 1 have the highest score values.

[0064] Example 3

[0065] This embodiment provides a method for TaqMan-SNP genotyping detection, the steps of which are:

[0066] Preparation of DNA template: S1 is the same as the extraction of nucleic acid from the Dactylopidae sample in step S2 of Example 2, and the obtained Dactylopidae and Dactylopidae DNA are used as DNA templates;

[0067] TaqMan fluorescent quantitative PCR was performed using TIANGEN SuperReal fluorescent quantitative premix reagent (probe method). The reaction system for 10 μL was as follows: 1 μL DNA template (the concentrations of Dactylopidae and Dactylopidae DNA were 10 μmol / L, respectively), 5 μL 2×SuperReal PreMix (Probe), 0.5 μL each of the first primer and the second primer (10 μmol / L), 0.5 μL each of the two probes (10 μmol / L), 0.2 μL 50×ROX Reference Dye, and the total volume was filled up to 10 μL with ddH2O.

[0068] The reaction conditions of TaqMan fluorescence quantitative PCR are as follows: 95℃ pre-denaturation for 10min, 95℃ denaturation for 15s, 62℃ annealing and extension for 1min, each step with a heating and cooling rate higher than 3.5℃ / sec, and the above steps are repeated for 45 cycles, and the fluorescence signal is collected after each cycle. A blank control is set, and ddH2O is used instead of DNA template for the experiment;

[0069] The above experiment was performed on the ThermoFisher ABIQuantStudio 6Flex real-time fluorescence quantitative PCR instrument (SNP-Taqman fluorescence quantitative PCR reaction process diagram, as shown in Figure 1 The fluorescence signal changes of FAM and VIC dyes of each sample were monitored in real time on QuantStudio Real-Time PCRSoftware v1.7.2, with the final fluorescence signal intensity of FAM and VIC dyes of each sample after amplification as the horizontal and vertical axes, respectively.

[0070] The present invention can achieve relative quantitative detection by calculating the relationship between the number of insect bodies or nucleic acid copies and the Ct value of the amplification curve, such as Figure 2 As shown, Figure 2 is a schematic diagram of the implementation process, which can identify the sample as Dactylorhiza anguillarum or Dactylorhiza shorthookii. The fluorescence signal intensity scatter plot of the detection result is constructed as shown in Figure 3 As shown in the figure, the scatter points of the blank control are near the 0 point, the scatter points of the Pseudomonas anguillaris sample are at the far end of the X axis, and the scatter points of the Pseudomonas short-hook sample are at the far end of the Y axis. Thus, successful identification can be achieved.

[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A nucleic acid molecule for genotyping Dactylum anguillarum and Dactylum brevis, characterized in that: It comprises a primer set, wherein the primer set comprises a first primer and a second primer, wherein the first primer has a sequence as shown in SEQ ID NO.1; and the second primer has a sequence as shown in SEQ ID NO.

2.

2. The genotyping nucleic acid molecule of Dactylopidae anguillarum and Dactylopidae shorthook as claimed in claim 1, characterized in that: The method comprises a probe set, wherein the probe set comprises a first probe and a second probe, wherein the first probe has a sequence as shown in SEQ ID NO.3; and the second probe has a sequence as shown in SEQ ID NO.

4.

3. The genotyping nucleic acid molecule of Pseudomonas anguillaris and Pseudomonas shorthookii as claimed in claim 2, characterized in that: The first probe is labeled with a FAM fluorescent group at the 5' end and a MGB quencher at the 3' end for detecting Dactylopidae anguillarum; the second probe is labeled with a VIC fluorescent group at the 5' end and a MGB quencher at the 3' end for detecting Dactylopidae anguillarum.

4. A kit for genotyping Dactylum anguillarum and Dactylum shorthookii, characterized in that: The method comprises a TaqMan fluorescent quantitative PCR reaction solution, wherein the PCR reaction solution comprises a first primer, a second primer, a first probe and a second probe.

5. The genotyping kit for Pseudomonas anguillarum and Pseudomonas shorthookii as claimed in claim 4, characterized in that: The PCR reaction solution comprises DNA templates of genes of Dactylopidae anguillarum and Dactylopidae shorthook.

6. The genotyping kit for Pseudomonas anguillarum and Pseudomonas shorthookii as claimed in claim 4, characterized in that: The reaction conditions of fluorescence quantitative PCR were as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, and annealing and extension at 62°C for 1 min. The heating and cooling rate was set higher than 3.5°C / sec in each step.

7. The genotyping kit for Pseudomonas anguillarum and Pseudomonas shorthookii as claimed in claim 4, characterized in that: The fluorescence quantitative PCR is carried out on a real-time fluorescence quantitative PCR instrument, and the fluorescence signal changes of the two dyes FAM and VIC of each sample are monitored in real time. The fluorescence signal intensity of the two dyes FAM and VIC is used as the horizontal axis and the vertical axis to construct a fluorescence signal intensity scatter plot to identify whether the sample is anguillarum or short-hook anguillarum.

Images