Porcine pseudorabies virus specific detection primer probe, detection kit and application thereof

Abstract

The invention provides a porcine pseudorabies virus specific detection primer probe, a detection kit and application thereof, and belongs to the technical field of pathogenic bacterium detection. The porcine pseudorabies virus specific detection primer probe comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO: 1, a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a probe with a nucleotide sequence as shown in SEQ ID NO: 3. The primer probe and the detection kit thereof can efficiently and accurately detect the porcine pseudorabies virus and the variant thereof, and have good detection specificity and sensitivity.

Description

Technical Field

[0001] The invention belongs to the technical field of pathogen detection, and in particular relates to a porcine pseudorabies virus-specific detection primer probe, a detection kit and applications thereof. Background Art

[0002] Pseudorabies virus is a double-stranded DNA virus belonging to the family Herpesviridae, the subfamily Alphaherpesvirinae, and the genus Varicella Herpesvirus. It is spherical or ellipsoidal with a diameter of 150 to 180 nm. The DNA molecular weight is 150 kb. The virus consists of a lipid capsid, a capsule, and a nucleolus containing genetic material. Pigs are the reservoir of the virus. To achieve the purpose of purification, the latent virus in pigs must be eradicated. The main clinical symptoms of infection with the virus include fever, diarrhea, vomiting, and neurological symptoms such as paddling movements of the limbs and intermittent convulsions. Pregnant sows will experience miscarriage, stillbirth, or mummified fetuses after infection. After infection, boars will have enlarged and atrophied testicles and lose their breeding ability, causing huge economic losses to the pig industry.

[0003] It is an endemic livestock epidemic in most parts of the world. Moreover, pseudorabies is not easy to distinguish from other swine infectious diseases. Porcine parvovirus, pseudorabies, and blue ear disease can cause sow abortion and mummified fetuses, and it is difficult to distinguish and identify them based on symptoms alone. Therefore, it is of great significance to establish a detection method with strong specificity and high sensitivity for its diagnosis. Common laboratory diagnostic methods for pseudorabies virus include ordinary PCR detection, real-time fluorescence quantitative PCR, ELISA antibody detection, etc. Among them, real-time fluorescence quantitative PCR detection has the characteristics of rapidity and high specificity, and is often used as one of the primary means of etiological laboratory detection.

[0004] Compared with conventional PCR, real-time fluorescence quantitative PCR can monitor the amount of target DNA in real time during the reaction. Although the current real-time fluorescence quantitative PCR method has made progress in PRV detection, it still has several limitations. Existing primer designs may have different detection sensitivities for PRV, which may lead to inconsistency in the test results and affect the accuracy of the test results. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a porcine pseudorabies virus-specific detection primer probe that can efficiently and accurately detect porcine pseudorabies virus and its variants.

[0006] The present invention provides a porcine pseudorabies virus-specific detection primer probe, comprising a primer pair and a probe; the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 2;

[0007] The nucleotide sequence of the probe is shown in SEQ ID NO:3.

[0008] Preferably, the ends of the probe are modified with a fluorescent group and a quenching group, respectively.

[0009] Preferably, the fluorescent group includes at least one of the following: FAM, fluorescein, Cy3 and Cy5;

[0010] The quenching group includes at least one of the following: BHQ-1, BHQ-2, BHQ-3 and MAX.

[0011] The invention provides a porcine pseudorabies virus detection kit, comprising the primer probe and a qPCR detection reagent.

[0012] Preferably, the qPCR detection reagent includes Premix Ex Taq.

[0013] Preferably, it also includes a standard;

[0014] The standard product is a recombinant plasmid containing the DNA fragment of the gB gene of porcine pseudorabies virus.

[0015] Preferably, the nucleotide sequence of the porcine pseudorabies virus gB gene DNA fragment is shown in SEQ ID NO:4.

[0016] The invention provides application of the primer probe in preparing a reagent or a kit for detecting porcine pseudorabies virus.

[0017] The present invention provides an application of the primer probe in preparing a reagent or a kit for identifying pseudorabies virus and other common viruses that infect pigs. The other common viruses that infect pigs include at least one of the following: porcine circovirus type 2, classical swine fever virus, swine influenza virus, porcine epidemic diarrhea, porcine transmissible gastroenteritis and porcine Japanese encephalitis.

[0018] The present invention provides a method for detecting porcine pseudorabies virus for non-disease diagnosis purposes, comprising the following steps:

[0019] Extracting genomic DNA from the sample to be tested;

[0020] The extracted genomic DNA is used as a template, and the primer probe is used to perform fluorescence quantitative PCR detection, and the fluorescence quantitative PCR amplification result;

[0021] The qualitative or quantitative results of the sample to be tested are obtained based on the fluorescence quantitative PCR amplification results.

[0022] Preferably, the reaction system of the fluorescent quantitative PCR is 20 μL: 10 μL of Premix Ex Taq, 0.4 μL of forward primer and reverse primer respectively, 0.6 μL of probe, 1 μL of DNA template, and 20 μL of ddH2O is used to make up;

[0023] The reaction procedure of the fluorescent quantitative PCR is: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 6 s, annealing at 60°C for 30 s, and 40 cycles.

[0024] The present invention provides a primer probe for specific detection of porcine pseudorabies virus, including a primer pair and a probe; the primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:2; the nucleotide sequence of the probe is shown in SEQ ID NO:3. The present invention uses the conservative sequence gB gene of porcine pseudorabies virus as a template to design a primer probe. Experiments show that compared with primer probes designed in the same batch, the primer probe protected by the present invention not only has good specificity and can only achieve positive detection of porcine pseudorabies virus, but also has good detection sensitivity, with a detection sensitivity of 10×10 1 At the same time, the primer probe is also widely applicable to the detection of different porcine pseudorabies virus strains in clinical samples.

[0025] The present invention provides a method for detecting pseudorabies virus in pigs for non-disease diagnosis purposes, and adopts the pseudorabies virus-specific detection primer probe described in the above technology to perform fluorescent quantitative PCR detection, which has the characteristics of simple and rapid detection, is suitable for on-site rapid detection, and is helpful for timely diagnosis and control of the spread of PRV. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The standard curve for detecting porcine pseudorabies virus provided by the present invention;

[0027] Figure 2 The specific detection results of the primers and probes for detecting pseudorabies virus of pigs provided by the present invention; wherein 1: PRV; 2: PCV-2, 3: CSFV, 4: SIV, 5: PEDV, 6: TGEV, 7: JEV;

[0028] Figure 3 The sensitivity test results of the primer probe for detecting pseudorabies virus of pigs provided by the present invention; 1 to 6 are: 1.0×10 6 , 10×10 5 copies / μL, 10×10 4 copies / μL, 10×10 3 copies / μL, 10×10 2copies / μL, 10×10 1 copies / μL;

[0029] Figure 4-1 , Figure 4-2 and Figure 4-3 The test results of clinical samples of the porcine pseudorabies virus detection primer probe provided by the present invention;

[0030] Figure 5 The sensitivity test results of the primer probe in combination 2 are shown in Figure 2. The amplification curves from left to right are obtained by amplifying the following concentration samples: 1.0×10 6 copies / μL, 1.0×10 5 copies / μL, 1.0×10 4 copies / μL, 1.0×10 3 copies / μL, 1.0×10 2 copies / μL, 1.0×10 1 copies / μL;

[0031] Figure 6 This is the specific detection result of the primer probe in combination 2. DETAILED DESCRIPTION

[0032] The invention provides a porcine pseudorabies virus-specific detection primer probe, comprising a primer pair and a probe; the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO:1 (GAGTACGTGCGCAACAACCACAA) and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:2 (GTGCCGAGCGCGTTCAGG); the nucleotide sequence of the probe is as shown in SEQ ID NO:3 (ACCGCCTTCGACCGCGACGAGAAC).

[0033] In the present invention, the primer probe is designed using the gB gene of porcine pseudorabies virus as a template. The ends of the probe are preferably modified with a fluorescent group and a quenching group, respectively. The fluorescent group preferably includes at least one of the following: FAM, fluorescein, Cy3 and Cy5. The quenching group preferably includes at least one of the following: BHQ-1, BHQ-2, BHQ-3 and MAX. In an embodiment of the present invention, the 5' end of the probe is modified with a FAM group, and the 3' end of the probe is modified with BHQ-1. The present invention does not impose any special restrictions on the source of the primer probe, and a synthesis method well known in the art can be used. In an embodiment of the present invention, the primer probe is commissioned to be synthesized by Sangon Biotech Co., Ltd.

[0034] The invention provides a porcine pseudorabies virus detection kit, comprising the primer probe and a qPCR detection reagent.

[0035] The present invention does not impose any special restrictions on the type of the qPCR detection reagent, and a premixed buffer for fluorescent quantitative PCR detection known in the art can be used, such as Premix Ex Taq, purchased from TAKARA. The primer probe is preferably packaged separately.

[0036] In the present invention, the detection kit preferably also includes a standard. The standard is preferably a recombinant plasmid containing a DNA fragment of the gB gene of the pseudorabies virus of porcine. The nucleotide sequence of the DNA fragment of the gB gene of the pseudorabies virus of porcine is preferably as shown in SEQ ID NO:4 (GAGTACGTGCGCAACAACCACAAGGTGACCGCCTTCGACCGCGAC GAGAACCCCGTCGAGGTGGACCTGCGCCCCTCGCGCCTGAACGCGCT CGGCAC). There is no special restriction on the backbone plasmid of the recombinant plasmid, and a plasmid well known in the art can be used, such as a PUC18 vector. The present invention has no special restrictions on the preparation method of the recombinant plasmid, and a preparation method of the recombinant plasmid well known in the art can be used, such as synthesizing the recombinant plasmid by a gene synthesis method or cloning the recombinant plasmid by a homologous recombination method.

[0037] The present invention provides the use of the primer probe in preparing a reagent or a kit for detecting porcine pseudorabies virus. The primer probe or a kit containing the primer probe can be used to detect infection of porcine pseudorabies virus.

[0038] The present invention provides the use of the primer probe in preparing a reagent or kit for identifying pseudorabies virus and other common viruses that infect pigs. The other common viruses that infect pigs preferably include at least one of the following: porcine circovirus type 2, classical swine fever virus, swine influenza virus, porcine epidemic diarrhea, porcine transmissible gastroenteritis and porcine Japanese encephalitis.

[0039] In the present invention, the primer probe is used to perform fluorescence quantitative PCR detection on the sample to be tested, and only the sample infected with pseudorabies virus can be positively detected, while the detection results are all negative for common viruses that infect pigs, such as porcine circovirus-2, classical swine fever virus, swine influenza virus, porcine epidemic diarrhea, porcine transmissible gastroenteritis and porcine Japanese encephalitis. It can be seen that the infection of pseudorabies virus and other common viruses that infect pigs can be distinguished based on the primer probe or the kit.

[0040] The present invention provides a method for detecting porcine pseudorabies virus for non-disease diagnosis purposes, comprising the following steps:

[0041] Extracting genomic DNA from the sample to be tested;

[0042] The extracted genomic DNA is used as a template, and the primer probe is used to perform fluorescence quantitative PCR detection, and the fluorescence quantitative PCR amplification result;

[0043] The qualitative or quantitative results of the sample to be tested are obtained based on the fluorescence quantitative PCR amplification results.

[0044] The present invention extracts genomic DNA from a sample to be tested.

[0045] In the present invention, the sample to be tested preferably includes pig blood, saliva, tissue or organ, etc. The source of the sample to be tested preferably includes dead pigs or pork. The present invention has no particular limitation on the method for extracting genomic DNA from the sample to be tested, and any method for extracting animal DNA known in the art, such as a kit method, can be used.

[0046] After extracting genomic DNA, the present invention uses the extracted genomic DNA as a template and adopts the primer probe to perform fluorescent quantitative PCR detection to obtain an amplification curve.

[0047] In the present invention, the reaction system of the fluorescent quantitative PCR is preferably 20 μL: 10 μL of Premix Ex Taq, 0.4 μL of forward primer and reverse primer, 0.6 μL of probe, 1 μL of DNA template, and 20 μL of ddH2O. The reaction procedure of the fluorescent quantitative PCR is preferably: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 6 s, annealing at 60°C for 30 s, and 40 cycles. The present invention has no special restrictions on the instrument used for fluorescent quantitative PCR detection, and a fluorescent quantitative PCR instrument known in the art can be used.

[0048] The qualitative or quantitative results of the sample to be tested are obtained based on the fluorescence quantitative PCR amplification results.

[0049] When making a qualitative judgment, the Ct value is obtained according to the amplification curve obtained by fluorescent quantitative PCR amplification, and the Ct value is used to judge whether the sample to be tested is infected with pseudorabies virus:

[0050] When the Ct value is ≤18, the sample to be tested is judged to be infected with porcine pseudorabies virus;

[0051] When the Ct value is greater than 18, it is determined that the sample to be tested is not infected with pseudorabies virus.

[0052] When the results are quantitatively determined, a standard curve is drawn using a standard substance, and the fluorescence signal intensity of the sample to be tested is brought into the standard curve formula to calculate the number of copies of the virus in the sample to be tested. The standard curve formula is shown in Formula I:

[0053] Y=-0.2418×X+10.59 formula I

[0054] Where Y represents the CT value of the standard, X represents the initial value of the standard, and R 2 =0.9997.

[0055] The following is a detailed description of a porcine pseudorabies virus-specific detection primer probe, a detection kit and applications thereof provided by the present invention in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0056] Example 1

[0057] A method for designing a primer probe for specific detection of porcine pseudorabies virus

[0058] Based on the conserved sequence gB gene (Gene ID: 80532586) of PRV queried in the NCBI database as a template, primers and probes were designed using Oligo software, and the specific sequences are shown in Table 1. The designed primers and probes were commissioned to be synthesized by Sangon Gene Technology Co., Ltd.

[0059] Table 1 Sequences of designed primers and probes

[0060]

[0061] Example 2

[0062] Method for constructing a recombinant plasmid containing a conservative gene of swine pseudorabies virus as a positive standard

[0063] The genomic DNA of pseudorabies virus was extracted from tissue materials confirmed to be infected with pseudorabies virus, and PCR amplification was performed using primer pairs. The PCR amplification product was recovered and purified after electrophoresis detection, and connected to the PUC18 vector, which was then transformed into competent cells. After culture, the recombinant plasmid was extracted using a plasmid extraction kit, and the recombinant plasmid containing the target fragment of the expected length of 98 bp was obtained by sequencing, which was the positive standard. The target fragment is: GAGTACGTGCGCAACAACCAC AAGGTGACCGCCTTCGACCGCGACGAGAACCCCGTCGAGGTGGACCTGCGCCCCTCGCGCCTGAACGCGCTCGGCAC (SEQ ID NO: 4).

[0064] Example 3

[0065] A specific detection kit for porcine pseudorabies virus, comprising the following reagents:

[0066] Example 1 Design of synthetic primer probe set (combination 1);

[0067] Premix Ex Taq reaction solution;

[0068] The positive standard prepared in Example 2.

[0069] Example 4

[0070] The method for using the porcine pseudorabies virus specific detection kit described in Example 3 comprises the following steps:

[0071] The standard recombinant plasmid was diluted to the following gradient concentrations: 1.0×10 3 , 1.0×10 4 copies / μL, 1.0×10 5 copies / μL, 1.0×10 6 copies / μL, 1.0×10 7 copies / μL;

[0072] The recombinant plasmids with gradient concentrations were used as templates, and the primer probe set (combination 1) was used to prepare the qPCR reaction system. The reaction system was 20 μL: 10 μL Premix Ex Taq (Probe qPCR), 0.4 μL each of upstream and downstream primers, 0.6 μL of probe, 1 μL of template, and 20 μL was made up with ddH2O.

[0073] The prepared qPCR reaction system was placed in a fluorescent quantitative PCR instrument and the reaction conditions were set as follows: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 6 s, annealing temperature at 60°C, annealing time for 30 s, and 40 cycles.

[0074] Draw a standard curve based on the concentration of the recombinant plasmid and the fluorescence signal value (see Figure 1 ), and the regression equation is shown in Formula I: Y = -0.2418 × X + 10.59 Formula I

[0075] Among them, Y represents the CT value of the recombinant plasmid, X represents the initial amount of the recombinant plasmid, and R 2 =0.9997.

[0076] The genomic DNA of the sample to be tested is amplified by qPCR according to the above method to obtain an amplification curve, and the Ct value of the amplification curve is used to determine whether the sample to be tested is infected with porcine pseudorabies virus:

[0077] When the Ct value is ≤18, the sample to be tested is judged to be infected with porcine pseudorabies virus;

[0078] When the Ct value is greater than 18, it is determined that the sample to be tested is not infected with pseudorabies virus.

[0079] Alternatively, the fluorescence signal value of the sample to be tested is substituted into the standard curve equation to calculate the copy number of the porcine pseudorabies virus in the sample to be tested.

[0080] Example 5

[0081] Specificity test

[0082] The genomes of porcine circovirus-2 (PCV-2), classical swine fever virus (CSFV), swine influenza virus (SIV), porcine epidemic diarrhea (PEDV), porcine transmissible gastroenteritis (TGEV) and Japanese encephalitis (JEV) viruses were extracted as amplification templates, and qPCR amplification was performed using the kit of Example 3 according to the method described in Example 4. At the same time, PRV standard plasmid was introduced as a positive control, and sterilized water was used as a negative control for detection to verify its specificity.

[0083] Results Figure 2 .Depend on Figure 2 It can be seen that the kit only obtains an amplification curve for the PRV standard plasmid and obtains a positive detection result, while the amplification results for PCV-2, CSFV, SIV, PEDV, TGEV and JEV are the same as the negative control results. Therefore, the kit has good detection specificity for PRV.

[0084] Example 6

[0085] Sensitivity test

[0086] The PRV recombinant plasmid standard was prepared to 1.0×10 1 ~10×10 7 The recombinant plasmids with gradient concentrations were used as amplification templates, and the fluorescent quantitative PCR reaction was performed using the kit described in Example 3 according to the method described in Example 4. The sensitivity of the fluorescent quantitative PCR system was determined by detecting the minimum copy number of the standard plasmid that could amplify the curve.

[0087] Results Figure 3 .Depend on Figure 3 It can be seen that the kit can detect 1.0×10 1 copies / μL concentration of the recombinant plasmid.

[0088] Example 7

[0089] Clinical sample testing

[0090] 1. Source of disease material: pigs in the pig farm with symptoms of diarrhea, vomiting, and convulsions;

[0091] 2. Detection method: Fluorescence quantitative PCR detection was performed using the kit described in Example 3 to verify the feasibility and accuracy of this method in actual clinical samples.

[0092] Results Figure 4-1 , Figure 4-2 and Figure 4-3 , the test result was positive for pseudorabies virus.

[0093] As can be seen from the results of the above examples, the primer probes for specific detection of porcine pseudorabies virus provided by the present invention can efficiently and specifically amplify the genomic fragments of porcine pseudorabies virus during PCR amplification. The design of the primers takes into account the genetic variability of the virus, ensuring wide applicability among different strains, and providing strong support for the veterinary field and animal health management. The application potential of this set of primer probes is not only of broad significance in the monitoring of porcine pseudorabies virus, but also provides experience for reference for the detection of other animal pathogens.

[0094] Comparative Example 1

[0095] The concentration of the primer-probe pair described in combination 2 of Example 1 was 1.0×10 6 copies / μL, 1.0×10 5 copies / μL, 1.0×10 4 copies / μL, 1.0×10 3 copies / μL, 1.0×10 2 copies / μL, 1.0×10 1 The sensitivity test was performed on the pig serum sample with a concentration of 100 copies / μL. The reaction system for fluorescence quantitative PCR detection was 20μL: 10μL Premix Ex Taq, 0.4μL forward primer and 0.4μL reverse primer, 0.6μL probe, 1μL DNA template, and 20μL ddH2O was used to make up. The reaction procedure of the fluorescence quantitative PCR was preferably: pre-denaturation at 95℃ for 2min; denaturation at 95℃ for 6s, annealing at 60℃ for 30s, and 40 cycles.

[0096] The sensitivity test results are shown in Figure 5 .Depend on Figure 5 It can be seen that the detection sensitivity of the primer probe in combination 2 is 10×10 2 copies / μL.

[0097] Comparative Example 2

[0098] The primer probes of combination 2 in Example 1 were used to specifically detect samples of porcine circovirus-2, classical swine fever virus, swine influenza virus, porcine epidemic diarrhea, porcine transmissible gastroenteritis and porcine Japanese encephalitis. The reaction system for fluorescence quantitative PCR detection was 20 μL: 10 μL of Premix Ex Taq, 0.4 μL of forward primer and reverse primer, 0.6 μL of probe, 1 μL of DNA template, and 20 μL of ddH2O was used to make up. The reaction procedure of the fluorescence quantitative PCR was preferably: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 6 s, annealing at 60°C for 30 s, and 40 cycles.

[0099] Test results are shown in Figure 6 .Depend on Figure 6 It can be seen that the primers in combination 2 have good specificity.

[0100] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A porcine pseudorabies virus-specific detection primer probe, characterized in that: Includes primer pairs and probes; The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 2; The nucleotide sequence of the probe is shown in SEQ ID NO:

3.

2. The porcine pseudorabies virus-specific detection primer probe according to claim 1, characterized in that: The ends of the probes are modified with a fluorescent group and a quenching group, respectively.

3. The porcine pseudorabies virus-specific detection primer probe according to claim 2, characterized in that: The fluorescent group includes at least one of the following: FAM, fluorescein, Cy3 and Cy5; The quenching group includes at least one of the following: BHQ-1, BHQ-2, BHQ-3 and MAX.

4. A porcine pseudorabies virus detection kit, characterized in that: The method comprises the primer probe and qPCR detection reagent according to any one of claims 1 to 3.

5. The porcine pseudorabies virus detection kit according to claim 4, characterized in that: The qPCR detection reagent includes Premix Ex Taq.

6. The porcine pseudorabies virus detection kit according to claim 4, characterized in that: Also includes standards; The standard product is a recombinant plasmid containing the DNA fragment of the gB gene of porcine pseudorabies virus.

7. The porcine pseudorabies virus detection kit according to claim 6, characterized in that: The nucleotide sequence of the porcine pseudorabies virus gB gene DNA fragment is shown in SEQ ID NO:

4.

8. Use of the primer probe according to any one of claims 1 to 3 in the preparation of a reagent or a kit for detecting porcine pseudorabies virus.

9. Use of the primer probe according to any one of claims 1 to 3 in the preparation of reagents or kits for identifying pseudorabies virus and other common viruses that infect pigs, wherein the other common viruses that infect pigs include at least one of the following: porcine circovirus type 2, classical swine fever virus, swine influenza virus, porcine epidemic diarrhea, porcine transmissible gastroenteritis and porcine encephalitis B.

10. A method for detecting porcine pseudorabies virus for non-disease diagnosis purposes, characterized in that: The following steps are involved: Extracting genomic DNA from the sample to be tested; Using the extracted genomic DNA as a template, and using the primer probe described in any one of claims 1 to 3 to perform fluorescent quantitative PCR detection to obtain fluorescent quantitative PCR amplification results; Obtaining qualitative or quantitative results of the sample to be tested based on the fluorescence quantitative PCR amplification results; Preferably, the reaction system of the fluorescent quantitative PCR is 20 μL: 10 μL of Premix Ex Taq, 0.4 μL of forward primer and reverse primer respectively, 0.6 μL of probe, 1 μL of DNA template, and 20 μL of ddH2O is used to make up; The reaction procedure of the fluorescent quantitative PCR is: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 6 s, annealing at 60°C for 30 s, and 40 cycles.

Images