Peptide vaccine based on tetrahedral framework nucleic acid and application thereof

Abstract

The invention discloses a peptide vaccine, which adopts tetrahedral framework nucleic acid as a carrier, encapsulates polypeptide inside and carries CpG ODNs outside. After the polypeptide is coupled with the hand, the coupled product and the DNA single chain of the tetrahedral framework nucleic acid are encapsulated in the framework through cohesive end hybridization. According to the peptide vaccine, a model epitope peptide from ovalbumin (OVA) and an M2e epitope peptide from influenza A virus are packaged respectively, necessary protection on polypeptide is provided, the stability of the polypeptide in serum and enzyme environments is remarkably improved, the integrity of an antigen is reserved, and the immunogenicity of the antigen is ensured. Meanwhile, the CpG ODNs are integrated on the framework nucleic acid, so that the immunogenicity of the antigen is greatly enhanced, the recruitment of immune cells is effectively promoted, and strong cell and humoral immune response is induced.

Description

Technical Field

[0001] The present invention specifically relates to a peptide vaccine based on tetrahedral framework nucleic acid and its application. Background Art

[0002] Vaccination is one of the most effective medical interventions to prevent the spread of infectious diseases. Peptide vaccines, as an emerging and highly anticipated vaccine candidate, are achieved by carefully designing specific epitope components of pathogens. Epitopes are composed of short-chain amino acid sequences that can be recognized by the immune system and stimulate immune responses. Compared with traditional vaccines using inactivated or attenuated pathogens, peptide vaccines can trigger more accurate and effective immune responses, avoiding potential problems such as autoimmune diseases, infection risks, and allergic reactions. However, peptide vaccines face challenges such as poor stability, weak immunogenicity, and low delivery efficiency. Therefore, they are usually required to be combined with additional delivery systems or adjuvants to enhance their immunogenicity and ensure that they can effectively stimulate immune responses in practical applications.

[0003] Nanoparticles are excellent delivery systems for peptide vaccines. They can mimic the size and morphology of pathogens, stimulate immune responses similar to attenuated vaccines, and maintain high selectivity for peptide vaccines. Currently, a variety of nanoparticles such as liposomes, virus-like particles, and polymers have been widely used in the delivery of peptide vaccines. However, despite their great potential, they still face many challenges. For example, liposomes often have physical stability problems such as low drug loading, rapid drug leakage, and vesicle fusion due to insufficient thermodynamic stability. Therefore, liposome-based delivery systems often require a large amount of antigen to overcome these problems, resulting in an increase in vaccine production costs. Recently, Yang Li et al. designed optimized aromatized liposomes, which significantly improved drug loading efficiency and prolonged its effectiveness, but the physical stability problem caused by the inherent phospholipid bilayer structure of liposomes has not been completely solved. In addition, viral vectors are limited in their scope of application due to their complex production process and potential toxicity, immune and inflammatory responses, insertional mutagenesis, and carcinogenicity. Similarly, the application of polymer carriers is also restricted by the unclear impact of antigen immunogenicity, difficulty in large-scale production, uncertain biocompatibility, and potential risks of long-term side effects.

[0004] Tetrahedral framework nucleic acid (TDN) is a nucleic acid molecule formed by self-assembly of multiple DNA single strands through complementary base pairing. It has good in vivo stability and has shown great research potential as a drug delivery platform in recent years. TDN occupies a unique position in nanoparticle delivery systems due to its efficient self-assembly mode, high controllability of physicochemical properties, and high customizability and scalability under editability. CN117797252A proposes a viral polypeptide-protein subunit combination vaccine based on DNA nanotechnology and a preparation method thereof. By coupling viral B cell epitope peptides to the four vertices of tetrahedral framework nucleic acid, a viral peptide vaccine was successfully prepared. However, carrying peptide segments on the outside of TDN failed to effectively protect the polypeptide active ingredients, thereby affecting its immunogenicity, and ultimately leading to a reduction in vaccine potency. Summary of the invention

[0005] To solve the above problems, the present invention provides a peptide vaccine, which uses a tetrahedral framework nucleic acid as a carrier, encapsulates a polypeptide inside, and carries CpG ODNs outside;

[0006] The polypeptide is connected to the DNA single strand of the tetrahedral framework nucleic acid through a handle and is encapsulated inside the tetrahedral framework nucleic acid;

[0007] The amino acid sequence of the polypeptide is shown in SEQ ID NO.1 or 2;

[0008] The nucleotide sequence of the handle is shown in SEQ ID NO.3;

[0009] The nucleotide sequence of the CpG ODNs is shown in SEQ ID NO.8.

[0010] Furthermore, the CpG ODNs are carried outside the tetrahedral framework nucleic acid through sticky end hybridization.

[0011] Furthermore, the polypeptide is coupled to the handle through click chemistry, and the coupling product is hybridized with the DNA single strand of the tetrahedral framework nucleic acid through the sticky end and is encapsulated inside the tetrahedral framework nucleic acid.

[0012] Furthermore, the four single-stranded DNA sequences of the tetrahedral framework nucleic acid are shown in SEQ ID NOs. 4 to 7.

[0013] Furthermore, the nucleotide sequence of the single-stranded DNA in the tetrahedral framework nucleic acid hybridized with the coupling product is shown in SEQ ID NO.6.

[0014] The present invention also provides a method for preparing the aforementioned peptide vaccine, which comprises the following steps:

[0015] 1) Take a peptide and modify it with an alkynyl group to obtain peptide-pra; take a handle and modify it with an azide group to obtain handle-N3;

[0016] 2) Mix peptide-pra and handle-N3, and use click chemistry coupling method to obtain handle-peptide;

[0017] 3) Take handle-peptide and four DNA single strands, add them to TM buffer, maintain at 70℃ for 10 minutes, quickly cool to 4℃ and maintain for more than 20 minutes to obtain TDN-peptide;

[0018] 4) TDN-peptide and CpG ODNs were mixed in equal moles at room temperature to obtain the peptide vaccine TDN-peptide-CpG (TPVax).

[0019] Furthermore, in step 2), the molar ratio of peptide-pra to handle-N3 is 1 to 3:1.

[0020] The amino acid sequence of the peptide-pra is SIINFEKL-pra or

[0021] SLLTEVETPIRNEWGCRCNDSSD-pra;

[0022] The nucleotide sequence of handle-N3 is GGTTGTTGGGT-N3.

[0023] Furthermore, in step 3), the four DNA single strands and the handle-peptide in the TM buffer have equimolar concentrations.

[0024] Furthermore, in step 4), the mixing time is 30 minutes.

[0025] Finally, the present invention provides a use of the above peptide vaccine in preparing influenza vaccine.

[0026] The peptide vaccine of the present invention uses a specific tetrahedral framework nucleic acid as a carrier, and encapsulates the antigenic epitope peptides from positions 257-264 of the model antigen ovalbumin (OVA) and the epitope peptides from the M2e protein of influenza A virus respectively inside it through specific handles, providing necessary protection for the peptides. In the serum and enzyme environment, the stability of the peptide is significantly improved, thereby maintaining the integrity of the antigen and ensuring its immunogenicity. The experimental results show that the peptide vaccine based on the tetrahedral framework nucleic acid can not only promote the cell uptake of the polypeptide, but also enhance the aggregation of the peptide vaccine in the lymph nodes, further ensuring its immune effect.

[0027] The present invention integrates CpG ODNs into tetrahedral framework nucleic acids, significantly improving the immunogenicity of the delivered antigens, especially showing significant enhancement in recruiting immune cells and inducing strong cellular and humoral immune responses. Experimental results confirmed that the TDN-based peptide vaccine effectively promoted the activation of dendritic cells and the secretion of cytokines, while demonstrating its effectiveness in establishing a broad and lasting adaptive immune response, especially in Th-1-biased cellular response, antibody production, and memory response formation. Significant progress has been made. In addition, the distribution of the vaccine is uniquely limited to the injection site and inguinal lymph nodes, and it has shown excellent tolerance in mouse experiments, accompanied by minimal off-target effects and inflammatory responses, demonstrating its excellent biocompatibility and its practical application potential for preventing influenza.

[0028] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0029] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1.Synthesis and characterization of TPVax; (a) Schematic diagram of the synthesis of FITC-OVA-handle and the corresponding 2% agarose gel electrophoresis results (1. FITC-OVA, 2. FITC-OVA-handle, 3. FITC-2OVA-handle, 4. FITC-3OVA-handle); (b) PAGE electrophoresis results of TDN binding site titration; (c) PAGE electrophoresis results of TDN loaded with multiple OVAs; (d) PAGE electrophoresis verification diagram of the successful synthesis of O@TPVax (1. S1, 2. S2, 3. anti-handle-S3-8, 4. S4, 5. handle-OVA, 6. CpG, 7. TDN, 8. TO, 9. O@TPVax); (e) Particle size distribution of TDN, TO and O@TPVax measured by DLS; (f) Zeta potential of TDN, TO and O@TPVax analyzed by DLS; (g) Representative transmission electron microscopy (TEM) images of TDN, TO and O@TPVax, with scale bars of 50 nm and 10 nm, respectively; (h) Representative atomic force microscopy (AFM) images of TDN, TO and O@TPVax, with scale bars of 100 nm and 10 nm, respectively; (i) Representative cryo-electron microscopy (Cryo-EM) images of TDN, TO and O@TPVax, with scale bars of 50 nm and 10 nm, respectively.

[0031] Figure 2.TDN exoskeleton improves the stability of peptide antigens, promotes cellular uptake and accumulation in inguinal lymph nodes; (a) Schematic diagram of the mechanism of FRET OVA for determining peptide stability; (b) Comparison of the stability of free FRET OVA and TDN-FRET OVA in a pancreatic environment (n=3); (c) Comparison of the stability of free FRET OVA and TDN-FRET OVA in serum (37°C) (n=3); (d) Schematic diagram of the mechanism of BMDCs (bone marrow-derived dendritic cells) uptake of materials; (e) Flow cytometry histogram of material uptake by cells; (f) Analysis of the percentage of material uptake by BMDCs (n=3); (g) Fluorescence image of BMDCs uptake of materials (60 times magnification, n=3), scale bar is 20μm; (h) Verification of the in vivo enrichment of Cy5-O@TPVax vaccine in inguinal lymph nodes (iLNs ) Schematic diagram of the process; (i) In vivo fluorescence imaging at 3 hours and 6 hours after intramuscular injection of Cy5-O, Cy5-T, Cy5-TO and Cy5-O@TPVax, respectively (n=3); (j) Quantitative analysis of fluorescence signals at 3 hours and 6 hours in (i) (n=3); (k) Ex vivo fluorescence imaging of iLNs removed from mice 6 hours after treatment (n=3); (l) Quantitative analysis of fluorescence signals in (k) (n=3), scale bar is 20μm. Data are expressed as mean ± standard deviation (SD), and P values ​​are marked as: ns (no significant difference), (P<0.05), (P<0.01), (P<0.001), **** (P<0.0001).

[0032] Figure 3 .The CpG-modified TDN exoskeleton significantly enhanced the immunogenicity of the antigen and the activation effect of dendritic cells (DCs); (a) Schematic diagram for verifying the ability of O@TPVax to activate BMDCs; (b) Schematic diagram of the DC maturation process; (c) Representative scanning electron microscopy (SEM) images of BMDCs after different treatments, scale bar is 20 μm; (d&e) Representative images of DC maturation and the percentage of mature cells analyzed by flow cytometry (n=3); (f) PCR analysis of the expression levels of TNF-α, IL-1β and IL-12a genes in BMDCs after different treatments (n=3); (g) ELISA quantitative analysis of the expression levels of proinflammatory cytokines TNF-α, IL-1β and IL-12p70 in BMDCs after different treatments (n=4); (h) Schematic diagram for verifying the ability of O@TPVax to activate DCs in iLNs; (i&j) Representative images of DC maturation in iLNs and the percentage of mature cells analyzed by flow cytometry (n=3). The data are expressed as mean ± standard deviation (SD), and the P values ​​are marked as: ns (no significant difference), (P < 0.05), (P < 0.01), (P < 0.001), **** (P < 0.0001).

[0033] Figure 4 .TPVax induces in vitro B cell and T cell activation; (a) Schematic diagram of the process for verifying the ability of TPVax to amplify B cells in vitro; (b, c) Flow cytometric analysis of B cell proliferation 24 hours after material treatment (n = 3): (b) TDN, OVA, TO, O@TPVax, (c) TDN, M2e, TM, M@TPVax; (d) Schematic diagram of the process for verifying TPVax's in vitro activation of B cells; (e, f) Flow cytometric analysis of B cell activation 24 hours after material treatment (n = 3): (e) TDN, OVA, TO, O@TPVax, (f) TDN, M2e, TM, M@TPVax; (g) Schematic diagram of the process for verifying TPVax's in vitro activation of T cells; (h) Schematic diagram of the T cell activation process; (i, j) Flow cytometric analysis of (i) Th1 and (j) Th2 CD4 + Percentage of T cell activation (n=3). Data are expressed as mean ± standard deviation (SD), and P values ​​are marked as: ns (no significant difference), (P<0.05), (P<0.01), (P<0.001), **** (P<0.0001).

[0034] Figure 5 .TPVax promotes DC maturation and humoral immune response in vivo; (a) Schematic diagram of vaccination scheme and analysis of humoral immune response; (b, c) Representative images and percentages of DC maturation in iLNs analyzed by flow cytometry (n = 4); (d) M2e-specific IgG titer in serum (n = 5); (e) Fluorescence imaging of IgG in spleen (n = 4), scale bar 100 μm; (f) Representative images and percentages of M2e-specific memory B cell response in iLNs analyzed by flow cytometry (n = 3); (g) Representative images and percentages of M2e-specific memory B cell response in spleen analyzed by flow cytometry (n = 3). Data are expressed as mean ± standard deviation (SD), and P values ​​are marked as: ns (no significant difference), (P < 0.05), (P < 0.01), (P < 0.001), **** (P < 0.0001).

[0035] Figure 6 .TPVax enhances cellular immune response in vivo; (a) Schematic diagram of vaccination regimen and cellular immune response analysis; (b, c) Flow cytometry detection of M2e-specific (b) CD4 + and (c) CD8 + Statistics of T cell responses (n=4); (d) Flow cytometry analysis of M2e-specific CD3 + CD4 + and CD3 + CD8+ T cell statistics (n=4); (e, f) Flow cytometry detection of M2e-specific (e) CD4 + and (f) CD8 + Statistics of T cell responses (n=4), the detection process is the same as (b, c); (g) Flow cytometric analysis of M2e-specific CD3 + CD4 + and CD3 + CD8 + Statistics of T cells (n=4); (h,i) Statistics of M2e-specific central memory T cell responses in (h)iLNs and (i) spleens by flow cytometry (n=3). Data are presented as mean ± standard deviation (SD), and P values ​​are marked as: ns (no significant difference), (P<0.05), (P<0.01), (P<0.001), **** (P<0.0001).

[0036] Figure 7 .PAGE image verifies the synthesis of M@TPVax (1.S1, 2.S2, 3.anti-handle-S3-8, 4.S4, 5.handle-M2e, 6.CpG, 7.TDN, 8.TM, 9.M@TPVax)

[0037] Figure 8 .Representative transmission electron microscopy (TEM) images of M@TPVax.

[0038] Fig. 9 .Representative atomic force microscopy (AFM) images of M@TPVax.

[0039] Fig.10 .Representative cryo-electron microscopy (Cryo-EM) images of M@TPVax.

[0040] Fig.11 The cell counting kit-8 (CCK8) method was used to detect the cytotoxicity of OVA, TDN, TO and O@TPVax on BMDCs.

[0041] Fig.12 .Ex vivo fluorescence imaging of major organs of mice 6 hours after treatment.

[0042] Fig.13 . Changes in body weight of mice after immunization.

[0043] Fig.14 .Hematoxylin and eosin (HE) staining of major organs of immunized mice on day 21. DETAILED DESCRIPTION

[0044] Example 1. Construction of TPVax peptide vaccine of the present invention

[0045] 1. Synthesis of handle-peptide

[0046] 1) Alkyne-modified peptides to make peptide-pra:

[0047] The 257-264 antigen epitope peptide of the model antigen ovalbumin (OVA) (amino acid sequence SEQ ID NO.1: SIINFEKL) and the epitope peptide from the M2e protein of influenza A virus (amino acid sequence SEQ ID NO.2: SLLTEVETPIRNEWGCRCNDSSD) were respectively modified with an alkynyl group to obtain peptide-pra in which propargylglycine (pra) was introduced into one end of the epitope peptide, namely OVA-pra (SIINFEKL-pra) and M2e-pra (SLLTEVETPIRNEWGCRCNDSSD-pra);

[0048] 2) Azide modification of handle to make handle-N3

[0049] The handle (nucleotide sequence SEQ ID NO.3: GGTTGTTGGGT) was modified with azide to obtain an azide group (-N3) which was attached to handle-N3 at one end of the nucleotide sequence.

[0050] (GGTTGTTGGGT-N3);

[0051] 3) Click chemistry coupling

[0052] Mix 10ul of 10mM CuSO4, 29.86ul of DMSO, and 3.54ul of 28.3mM TBTA, let stand for 5 minutes, then add 6.6ul of 600uM peptide-pra (OVA-pra or M2e-pra) and 10ul of 200uM hanldle-N3, mix, and incubate at room temperature overnight. Finally, use DNA ethanol precipitation method to remove uncoupled peptides to obtain handle-peptide.

[0053] 2. Synthesis of TDN-peptide

[0054] 1) TDN consists of 4 DNA strands forming an outer frame with a side length of 21 bp,

[0055] S1 (SEQ ID NO.4):

[0056] ATTTATCACCCGCCATAGGAGACGTATCACCAGGCAGTTGAGACGA

[0057] ACATTCCTAAGTCTGAA

[0058] S2 (SEQ ID NO.5):

[0059] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGA

[0060] TGGGCATGCTCTTCCCGTTAAATTATCTACCACAACTCAC

[0061] antihandle-S3-8(SEQ ID NO.6):

[0062] cccaacaaccGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGG

[0063] AAGAGCATGCCCATCCACTCCTATG

[0064] S4 (SEQ ID NO.7):

[0065] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGA

[0066] TGGGCATGCTCTTCCCGTTAAATTATCTACCACAACTCAC

[0067] 2) Synthesis procedure

[0068] The handle-peptide synthesized above and four DNA single strands (S1, S2, antihandle-S3, S4) were dissolved in TM Buffer (50mM MgCl2 and 10mM Tris-HCl, pH 8.0) in equal moles, and the final concentration of the five oligonucleotide chains was 1000nM. After thorough mixing, they were quickly heated to 70°C, and then quickly cooled to 4°C after 10 minutes and maintained for more than 20 minutes to obtain TDN-peptide.

[0069] 3. Construction of TPVax vaccine

[0070] 1) CpG ODNs are artificially synthesized single-stranded oligodeoxynucleotides, and their nucleotide sequence (SEQ ID NO.8) is TCCATGACGTTCCTGACGTTGTGAGTTGTGGTAGATAATTT

[0071] 2) Synthesis procedure

[0072] The CpG ODNs and the TDN-peptide synthesized above were mixed in equal moles at room temperature for 30 minutes to obtain the obtained product.

[0073] The beneficial effects of the present invention are further illustrated by test examples below:

[0074] Experimental Example 1 Preparation and characterization of peptide vaccines based on TDN multifunctional exoskeleton

[0075] 1 Construction of peptide vaccines based on TDN multifunctional exoskeleton

[0076] 1.1 Methods

[0077] 1) Synthetic TDN

[0078] Four framework DNA strands (S1–S4, sequences in Table 1) were added in equimolar concentrations into TM buffer (50 mM MgCl2 and 10 mM Tris-HCl, pH 8.0). TDN was successfully synthesized by a two-step process of heating to 95 °C for 10 min followed by cooling at 4 °C for 20 min.

[0079] Table 1 Four framework DNA chains

[0080]

[0081] 2) Synthesis of TDN-OVA (TO) and TDN-M2e (TM)

[0082] The handle-peptide was synthesized by coupling peptide-pra with handle-N3 through click chemistry. To construct TDN-peptide, equimolar amounts of handle-peptide were mixed with framework DNA chains (S1–S4). The homogenous mixture was heated to 70°C for 10 min in TM buffer (50 mM MgCl2 and 10 mM Tris-HCl, pH 8.0) and then cooled to 4°C for 20 min. TDN-OVA (TO) and TDN-M2e (TM) were synthesized according to the above method, with the only difference being that the handle-peptide was handle-OVA and handle-M2e, respectively. OVA refers to the 257-264th antigen epitope peptide of the model antigen ovalbumin (OVA), and its amino acid sequence is SEQ ID NO.1; M2e is the epitope peptide of the M2e protein of influenza A virus, and its amino acid sequence is SEQ ID NO.2. During the synthesis process, the relevant sequences in Table 2 were also involved to verify success.

[0083] Table 2 Fluorescently labeled peptide sequences

[0084]

[0085] 3) Synthesis of O@TPVax and M@TPVax

[0086] In order to construct the TPVax vaccine, CpG ODNs were assembled onto TDN-peptide. First, TDN-peptide was prepared as described above. Then, equimolar CpG ODNs were mixed with TDN-peptide at room temperature for 30 minutes to obtain TDN-peptide-CpG (TPVax). The construction of O@TPVax and M@TPVax followed the same method, with the only difference being that the TDN-peptides used were TDN-OVA (TO) and TDN-M2e (TM), respectively. The successful coupling of handle-peptide and the assembly of TPVax vaccine were confirmed by polyacrylamide gel electrophoresis (PAGE). The specific nucleotide sequences involved are shown in Table 3.

[0087] Table 3 Nucleotide sequences involved in the assembly process

[0088]

[0089] 1.2 Results

[0090] To construct a peptide vaccine based on the TDN multifunctional exoskeleton, peptides were first extracted from OVA, a model antigen protein widely used in vaccine research. Next, these peptides were coupled to the handle, and FITC-labeled OVA-handle (FITC-OVA-handle) was successfully synthesized by click chemistry. The results of 2% agarose gel electrophoresis confirmed the successful synthesis of FITC-OVA-handle and its variants FITC-2OVA-handle and FITC-3OVA-handle ( Figure 1 a).

[0091] Traditionally, vectors are loaded onto the TDN exoskeleton by direct incubation or sticky end ligation. However, the uncertainty of drug loading, unexpected biostability, and nonspecific effects limit the application of this design. To this end, a new method was designed to precisely encapsulate vectors onto the TDN exoskeleton at predetermined locations. This method achieves efficient encapsulation by hybridizing the peptide-handle with TDN through the sticky end. Therefore, the location of the sticky end is crucial for encapsulation efficiency. In order to verify the ideal peptide encapsulation site, the OVA-handle was bound to the 5th to 10th sites of the antihandle-S3 of TDN (achieved by pairing the specific nucleotide sequence of the handle with the complementary sequence of the antihandle-S3 sticky end). Polyacrylamide gel electrophoresis (PAGE) results showed that the TDN connected to site 8 had the fastest migration rate, and its electrophoretic band was closest to the native TDN. This result demonstrated the successful encapsulation of OVA at site 8 of TDN and established site 8 as an ideal binding site for peptide loading. Therefore, site 8 was selected as the optimal site for peptide encapsulation in subsequent experiments ( Figure 1 b).

[0092] The synthesis of OVA-encapsulated TDN (TDN-OVA) was further confirmed by electrophoresis, in which OVA was labeled with FITC and S2 of TDN was labeled with Cy5. The colocalization of FITC and Cy5 fluorescence in PAGE analysis confirmed the successful loading of OVA onto TDN. Notably, the yield of TDN-OVA was superior to that of variants with multiple OVAs (TDN-2OVA and TDN-3OVA), with not only higher yield but also fewer byproducts ( Figure 1 c) Therefore, a single OVA-loaded TDN was chosen as the structural basis for the peptide vaccine.

[0093] Given that CpG ODNs can induce humoral and cellular immune responses, CpG was further integrated into TDN through the sticky ends to construct a TDN-based peptide vaccine. PAGE analysis confirmed that TDN-OVA-CpG (O@TPVax) loaded with both OVA and CpG was successfully synthesized ( Figure 1 d).

[0094] Using the same method, TDN-M2e-CpG (M@TPVax) loaded with influenza A virus M2e protein epitope peptide and CpG was constructed, and its successful synthesis was confirmed by PAGE ( Figure 7 2. Characterization of peptide vaccines based on TDN multifunctional exoskeleton

[0095] 2.1 Methods

[0096] The synthesis of handle-peptide was verified by 2% agarose electrophoresis, while the construction of TDN, TDN-peptide and TPVax was confirmed by 8% polyacrylamide gel electrophoresis (PAGE). To further verify the preparation of the vaccine, its morphology was observed using cryo-electron microscopy (Cryo-EM), transmission electron microscopy (TEM) and atomic force microscopy (AFM). In addition, the average particle size and zeta potential of the vaccine were measured by dynamic light scattering (DLS).

[0097] 2.2 Results

[0098] Dynamic light scattering (DLS) characterized the particle sizes of TDN, TO, and O@TPVax, which were 16.24±2.98nm, 16.28±2.75nm, and 18.98±3.89nm, respectively. Figure 1 e). In addition, the zeta potentials of TDN, TO, and O@TPVax were measured to be -5.69±5.13mV, -3.14±7.31mV, and -5.73±5.78mV, respectively. Figure 1 f). The size range of 10-20 nm and slightly negatively charged potential provide TDN-based vaccines with optimal conditions for efficient cellular uptake and targeted lymph node accumulation, enhancing their potential for vaccine delivery and immune stimulation.

[0099] Transmission electron microscopy (TEM) morphology characterization showed that TDN, TO, and O@TPVax had consistent triangular profiles and uniform size distribution ( Figure 1 g). Further analysis by atomic force microscopy (AFM) and cryo-electron microscopy (Cryo-EM) confirmed the 10-20 nm size range of the nanoparticles and their successful preparation ( Figure 1 h&i). Similarly, the successful preparation of M@TPVax and its triangular profile were confirmed by TEM, AFM, and Cryo-EM ( Figure 8-10 ). In conclusion, from synthesis to characterization, the comprehensive investigation approach not only demonstrated the successful construction of TDN-based functionalized peptide vaccines, but also highlighted the precision of cargo encapsulation and its potential to induce targeted immune responses.

[0100] Experimental Example 2: The powerful potential of TDN-based multifunctional exoskeleton as a delivery platform

[0101] 1. TDN multifunctional exoskeleton improves peptide stability

[0102] 1.1 Methods

[0103] In order to verify the stability of the peptide, the peptide was encapsulated in TDN using the Foster resonance energy transfer (FRET) technique to construct a TDN-FRET peptide vaccine (peptide sequence is shown in Table 1). The FRET peptide and TDN-FRET peptide were incubated with pancreatin at 37°C, and different time intervals (0, 1, 2, 3, 6, 12 and 24 hours) were set. Subsequently, the optical density (OD) was measured at 450 nm using a microplate reader (VarioskaLUX multi-mode microplate reader, Thermo Fisher, MA, USA), and the absorbance was calibrated at 570 nm. In order to evaluate the stability of the FRET peptide in serum, fetal bovine serum (Corning, New York, USA) was used for the experiment. The same time intervals were incubated at a 10% serum concentration, and the OD value was then measured again using a microplate reader, and the absorbance was calibrated at 570 nm to ensure accurate measurement.

[0104] 1.2 Results

[0105] To determine whether the TDN-based multifunctional exoskeleton can provide structural protection for the encapsulated polypeptide, a commonly used FRET polypeptide was integrated into the TDN framework. The polypeptide uses EDANS as a donor and DABCYL as a quencher, and the two are placed in close proximity so that the fluorescence is quenched. Only after EDANS and DABCYL are separated by enzyme cleavage, the fluorescence can be detected, so that the stability of the polypeptide can be evaluated by the fluorescence signal of the FRET system ( Figure 2 a).

[0106] The FRET peptide was encapsulated in TDN to form a TDN-FRET peptide structure, and the enzymatic stability was compared with that of the free FRET peptide. The results showed that the TDN-FRET peptide had significantly enhanced stability; after 24 hours of enzyme treatment, more than 11% of the encapsulated peptide was still present, while the free peptide was almost completely degraded within 12 hours ( Figure 2 b). Similarly, the stability of the FRET peptide and TDN-FRET peptide in goat serum was measured. The half-life of the FRET peptide was less than 2 hours and it was almost completely degraded within 12 hours, while the TDN-FRET peptide showed a significant increase in stability; after 12 hours of serum incubation, more than 27% of the peptide was still present, and about 13% remained intact after 24 hours. The half-life of the encapsulated FRET peptide was extended to 6 hours, four times that of the free peptide ( Figure 2 c).

[0107] These results indicate that the TDN-based multifunctional exoskeleton provides effective physical protection for the peptides and significantly improves the stability of the peptides in the enzyme and serum environment. This protective effect may be due to the spatial isolation effect brought by the TDN structure, which limits the contact of the enzyme with the encapsulated peptides and creates a stable microenvironment for the peptides to ensure their integrity.

[0108] 2. TDN multifunctional exoskeleton increases cellular uptake of peptides

[0109] 2.1 Methods

[0110] 2.1.1 Cell culture

[0111] BMDCs were obtained from C57BL / 6 mice by flushing bone marrow cells in femurs and tibias. Red blood cells were removed using red blood cell lysis buffer (BioLegend, USA). Subsequently, cells were cultured in RPMI 1640 culture medium supplemented with 1% penicillin / streptomycin solution, 10% fetal bovine serum, 1% HEPES, 0.1mM β-mercaptoethanol, 20ng / ml mouse IL-4 (Invitrogen, USA) and 20ng / ml mouse granulocyte-macrophage colony stimulating factor (GM-CSF) (Invitrogen, USA). Immature BMDCs were collected on the 6th day for further study.

[0112] 2.1.2 Cytotoxicity assay

[0113] To evaluate the effects of OVA, TDN, TO, and O@TPVax on the activity of BMDCs, CCK-8 assay was performed. First, 8 × 10 3 BMDCs were cultured overnight. After 24 hours of starvation, the cells were treated with serum-free medium containing 250 nM OVA, TDN, TO, and O@TPVax. Subsequently, the cells were incubated with CCK-8 solution (MCE, HY-K0301, USA) for 1 hour, and the cell activity was measured by the OD value at 450 nm.

[0114] 2.1.3 Cellular uptake experiments

[0115] BMDCs were cultured overnight in 6-well plates at 37°C and 5% CO2. For flow cytometric analysis, cells were treated with 250 nM FITC-labeled OVA (FITC-O), FITC-labeled TO (FITC-TO), Cy5-labeled TDN (Cy5-T), and Cy5-labeled TO (Cy5-TO) for 24 h. After treatment, cells in 6-well plates were washed and collected into flow cytometry tubes. Cellular uptake efficiency was quantified by flow cytometry (FC500 Beckman, IL, USA). For confocal microscopy analysis, BMDCs were exposed to 250 nM FITC-labeled OVA (FITC-O), Cy5-labeled TDN (Cy5-T), and TO labeled with FITC and Cy5 (FITC-Cy5-TO) for 24 h. After washing three times to remove unabsorbed materials, cells were fixed with 4% formaldehyde for 30 min, and cell nuclei were stained with DAPI. Finally, the images were observed under a confocal microscope (FV3000; Olympus, Tokyo, Japan).

[0116] 2.2 Results

[0117] Cellular uptake is one of the key steps in the maturation of dendritic cells. As a promising delivery platform, one of the advantages of TDN is that it can significantly improve the efficiency of cellular uptake. To explore the effect of cellular uptake of TDNs, bone marrow-derived dendritic cells (BMDCs) were extracted and cultured from mice. After BMDCs were co-cultured with FITC-labeled OVA (FITC-O) and FITC-labeled TO (FITC-TO) for 24 hours, flow cytometry was used to detect and quantify the FITC fluorescence signal ( Figure 2 d). The results showed that the fluorescence intensity of FITC-TO was 2.4 times higher than that of FITC-O, which significantly improved the cellular uptake efficiency of OVA (from 20% to 48%).

[0118] Subsequently, the experiment was repeated using Cy5-labeled TDN (Cy5-T) and Cy5-labeled TO (Cy5-TO), and the results showed that the uptake efficiency of both groups exceeded 90% ( Figure 2 e&f). In addition, confocal laser scanning microscopy (CLSM) was used to further observe the cell internalization of BMDCs ( Figure 2d). In order to more intuitively observe the uptake of TO in BMDCs, TO labeled with both FITC and Cy5 (FITC-Cy5-TO) was used. CLSM images showed that BMDCs treated with FITC-Cy5-TO exhibited strong FITC fluorescence in the cytoplasm, while BMDCs treated with FITC-O showed lower FITC fluorescence signals. In addition, BMDCs treated with Cy5-T and FITC-Cy5-TO showed strong Cy5 fluorescence signals in both the cytoplasm and nuclear regions, and significant colocalization of FITC and Cy5 fluorescence was observed in BMDCs treated with FITC-Cy5-TO ( Figure 2 g).

[0119] These results indicate that TDN delivery significantly enhances cellular uptake efficiency, which facilitates antigen presentation and subsequent dendritic cell activation of immune responses. At the same time, the results of in vitro cytotoxicity experiments showed that there was no significant difference in the cell activity of BMDCs after co-culture with 250nM concentration of OVA, TDN, TO and O@TPVax for 24 hours, indicating that the TDN-based vaccine delivery system has good biocompatibility ( Fig.11 ). Overall, the experimental results highlight the great potential of TDNs as a vaccine delivery platform, which not only has excellent biocompatibility but also can efficiently deliver immunogenic substances to immune cells.

[0120] 3. TDN multifunctional exoskeleton increases vaccine lymph node accumulation

[0121] 3.1 Methods

[0122] 3.1.1 Animal culture

[0123] All animal experiments followed the ethical standards set by the Animal Ethics Committee of West China School of Stomatology, Sichuan University. Female C57BL / 6 mice aged 6–8 weeks and weighing 18–20 g were used in the experiments and housed in an environment with a 12-h light / 12-h dark cycle and a 7-day acclimatization period.

[0124] 3.1.2 In vivo imaging

[0125] Mice were inoculated with OVA, Cy5-labeled TDN (Cy5-T), Cy5-labeled TO (Cy5-TO), and Cy5-labeled O@TPVax (Cy5-O@TPVax) in the right leg by intramuscular injection, with a dose of 5 μg of peptide per mouse. At 3 and 6 hours after injection, the mice were placed under the IVIS imaging system (PerkinElmer) for fluorescence imaging. In addition, the right inguinal lymph nodes and major organs were removed 6 hours later for fluorescence imaging.

[0126] 3.2 Results

[0127] Another major advantage of the TDN platform is that its nanoparticles have a diameter of less than 100 nm, and nanoparticles of this size are known to preferentially enter lymph nodes, thereby promoting the activation of dendritic cells and primary T cells. Before evaluating the immune response induced by the functionalized peptide vaccine, fluorescence imaging was used to monitor its biodistribution, especially its enrichment in the inguinal lymph nodes (iLNs). Therefore, Cy5-T, Cy5-TO, and Cy5-O@TPVax were prepared using Cy5-labeled S2, and the biodistribution of these vaccines and their accumulation in iLNs were described by Cy5 fluorescence detection. Mice received intramuscular injections in the right leg, followed by in vivo imaging system (IVIS) analysis at 3 and 6 hours after injection, and further imaging of the right iLNs and major organs was performed 6 hours later ( Figure 2 h).

[0128] At two time points, Cy5-T, Cy5-TO, and Cy5-O@TPVax showed significant fluorescence signals at the injection site, and the fluorescence intensity gradually weakened over time ( Figure 2 i&j). This decrease in fluorescence intensity suggests that the material migrated from the injection site and partially translocated to iLNs, which is consistent with the higher fluorescence enrichment observed in the lymph nodes after 6 hours ( Figure 2 k&l). This migration is critical for antigen delivery to lymph nodes, optimizing antigen exposure to resident dendritic cells, T cells, and B cells, helping to stimulate an effective immune response and improving the immunogenicity of the vaccine.

[0129] Furthermore, it is very important to avoid systemic toxicity and ensure that the distribution of the vaccine is confined to the site of administration and draining lymph nodes. Notably, the experimental results showed that these formulations did not accumulate significantly in major organs such as the liver, heart, spleen, lungs, and kidneys, highlighting their targeted delivery efficiency ( Fig.12 ). Therefore, the results showed that the TDN-based vaccine showed significant enrichment in iLNs, providing conditions that promote dendritic cell maturation. At the same time, the excellent biosafety and minimized non-targeted distribution further demonstrated the potential of this platform in clinical translation.

[0130] 4. CpG-modified TDN multifunctional exoskeleton enhances the immunogenicity of peptides and activates dendritic cells

[0131] 4.1 Methods

[0132] 4.1.1 In vitro dendritic cell maturation, gene expression, and cytokine production

[0133] Dendritic cell maturation, gene expression, and cytokine production were evaluated in BMDCs. Cells were cultured overnight in 6-well plates at 37°C and 5% CO2. The next day, cells were treated with 250 nM OVA, TDN, TO, and O@TPVax for 24 h. After treatment, culture supernatants were collected for ELISA of TNF-α, IL-12p70, and IL-1β. Cells were washed with PBS and dehydrated with different concentrations of ethanol (25%, 50%, 75%, and 100%), followed by air drying and gold sputter coating for analysis of cell surface morphology by scanning electron microscopy (SEM).

[0134] For flow cytometry analysis, cells were first blocked with anti-mouse CD16 / 32 antibody, followed by staining with APC-Cy7-labeled anti-mouse CD45 antibody, FITC-labeled anti-mouse CD11c antibody, PE-labeled anti-mouse MHCII antibody, APC-labeled anti-mouse CD80 antibody, and PE-Cy7-labeled anti-mouse CD86 antibody at 4° C. for 30 minutes. Subsequently, the stained cells were analyzed using flow cytometry (FC500Beckman, Illinois, USA).

[0135] Gene expression evaluation was based on the same treated cells as flow cytometry. After treatment, cells were washed three times with cold PBS and lysed using TRIzol reagent (Invitrogen, USA). RNA extraction and purification were performed according to the instructions of the RNApure total RNA extraction kit (RP1202, BioTeke, Jiangsu, China). Subsequently, reverse transcription of total RNA was performed according to the instructions of the PrimeScript RT kit (Takara Bio, Shiga, Japan). Finally, qPCR analysis was performed using the SYBR Premix Ex TaqII kit on the QuantStudio 6 detection system (Thermo Fisher, USA), and mRNA expression was normalized using β-actin as an internal reference. The primer sequences for TNF-α, IL-12a, IL-1β and β-actin are shown in Table 4.

[0136] Table 4 Primer sequences

[0137]

[0138] The cell culture supernatant was frozen at -80 °C until cytokine ELISA detection. The experiments strictly followed the instructions of the mouse TNF-α ELISA kit (Multi Sciences, Hangzhou, China), the mouse IL-12p70 kit (MultiSciences, Hangzhou, China), and the mouse IL-1β ELISA kit (Multi Sciences, Hangzhou, China). Finally, the OD value was read at 450 nm using a microplate reader (VarioskaLUX multi-mode microplate reader, Thermo Fisher, MA, USA), and the absorbance was calibrated at 570 nm to ensure the accuracy of the measurement.

[0139] 4.1.2 In vivo dendritic cell maturation

[0140] Twenty-four hours after each mouse was injected with OVA, TDN, TO, and O@TPVax (5 μg peptide / mouse), inguinal lymph nodes were collected. Subsequently, the lymph nodes were ground, rinsed, filtered, and resuspended in FACS buffer. The collected cell suspension was first blocked with anti-mouse CD16 / 32 antibody, and then stained with APC-Cy7-labeled anti-mouse CD45 antibody, FITC-labeled anti-mouse CD11c antibody, PE-labeled anti-mouse MHCII antibody, APC-labeled anti-mouse CD80 antibody, and PE-Cy7-labeled anti-mouse CD86 antibody at 4°C for 30 minutes. Afterwards, the stained cells were analyzed by flow cytometry (FC500 Beckman, IL, USA).

[0141] 4.2 Results

[0142] The TDN-based multifunctional exoskeleton shows great potential in the delivery of efficient peptide vaccines. To evaluate the role of TDNs in enhancing dendritic cell (DC) activation and inducing a strong immune response, we first tested the ability of functionalized peptide vaccines to activate BMDCs in vitro. BMDCs from C57BL / 6 mice were co-cultured with OVA, TDN, TO, and O@TPVax for 24 hours, and then the maturation of BMDCs was analyzed by flow cytometry (the marker was CD11c + MHCII + CD80 + CD86 + ,See Figure 3a&b). Scanning electron microscopy (SEM) further provided visual evidence of morphological changes in BMDCs. Control cells were relatively round with fewer dendritic processes, while BMDCs exposed to OVA, TDN, TO, and O@TPVax displayed more complex dendritic structures, especially O@TPVax-treated BMDCs, which showed significant dendritic extension, cell membrane ruffles, and spindle-like morphology, indicating a higher degree of maturity and readiness for antigen presentation ( Figure 3 c).

[0143] Furthermore, flow cytometry results quantitatively confirmed that OVA and TO only induced moderate maturation of BMDCs, whereas O@TPVax significantly increased the proportion of mature BMDCs ( Figure 3 d&e). Given the known role of CpG ODNs in stimulating DC maturation and proinflammatory cytokine release, we further analyzed the expression levels of TNF-α, IL-12p70, and IL-1β genes by qPCR and quantified the secretion of these cytokines using ELISA. After 24 h of culture, TOC significantly enhanced the cytokine response, while TO had relatively little effect on cytokine expression ( Figure 3 f&g). This result indicates that CpG modification plays a key role in eliciting a strong immune response on the TDN platform, further demonstrating the importance of this modification in enhancing vaccine efficacy.

[0144] To verify the in vivo effect, DCs were collected from the inguinal lymph nodes (iLNs) of mice 24 h after immunization and their maturity (CD11c + MHCII + CD80 + CD86 + ,See Figure 3 h). The results showed that OVA, TDN, and TO moderately increased the expression of MHCII, but had limited effects on CD80 and CD86. However, O@TPVax significantly enhanced the maturation of DCs in vivo, as shown by a significant increase in the proportion of mature DCs ( Figure 3 i&j). These results suggest that CpG-modified TDNs not only enhance the immunogenicity of the delivered peptides but also significantly promote the maturation of DCs, which is critical for an effective vaccine response.

[0145] The mechanisms by which O@TPVax induces DC maturation in vivo may be multiple. First, CpG ODNs directly activate DCs to prepare for the initiation of immune responses. Second, the targeted delivery system of TDNs effectively delivers antigens to lymph nodes, which serve as the main site of immune responses. In addition, TDNs enhance the uptake of peptides by dendritic cells, a key step in DC maturation. Finally, the TDN exoskeleton maintains the structural integrity of the peptides and prolongs the duration of immune stimulation, thereby enhancing the overall immune response.

[0146] 5. CpG-modified TDN multifunctional exoskeleton enhances B cell and T cell activation in vitro

[0147] 5.1 Methods

[0148] 5.1.1 In vitro B cell proliferation and activation

[0149] Splenocytes were obtained from C57BL / 6 mice. Briefly, the spleen was ground and mashed, and red blood cells were lysed using red blood cell lysis buffer (BioLegend, USA). Subsequently, splenocytes were obtained after centrifugation and filtration and resuspended in PBS. For carboxyfluorescein succinimidyl ester (CFSE) staining, 2*10^7 splenocytes were suspended in 10mL PBS, and 1μL 8mM CFSE (BioLegend) was added and dissolved in DMSO. The cell suspension was incubated in a cell incubator at 37°C for 15 minutes. Subsequently, CFSE-stained splenocytes were collected by centrifugation and resuspended in 1640 culture medium.

[0150] To evaluate B cell activation, unstained splenocytes were co-cultured with 250 nM OVA, TDN, TO, and O@TPVax in 6-well plates. After 24 h incubation, splenocytes were collected by centrifugation, resuspended in FACS buffer, and labeled with PE anti-mouse CD19 antibody and APC anti-mouse CD80 antibody for 30 min at 4 °C. Finally, B cell activation was analyzed by flow cytometry (FC500 Beckman, IL, USA).

[0151] To evaluate B cell proliferation, 5*10^5 CFSE-stained splenocytes were co-cultured with 250nM OVA, TDN, TO, and O@TPVax in 200μL 1640 medium in a round-bottom 96-well plate. After 3 days of incubation, splenocytes were collected by centrifugation, resuspended in FACS buffer, and labeled with PE anti-mouse CD19 antibody for 30 minutes at 4°C. Subsequently, cell proliferation was evaluated by quantifying CFSE fluorescence dilution by flow cytometry.

[0152] 5.1.2 In vitro CD4 + T cell activation

[0153] Splenocytes were obtained from C57BL / 6 mice according to the above procedure. Naive T cells (CD3 + CD4 + The successful isolation of naive T cells was confirmed by flow cytometry. BMDCs were co-cultured with 250 nM M2e, TDN, TM, and M@TPVax in 6-well plates for 24 h. + Naive T cells were co-cultured with treated BMDCs at a ratio of 1:5 to 1:10 for 24 hours. After 24 hours of incubation, the cells were washed and resuspended. First, surface labeling was performed with Pacific-blue anti-mouse CD3a and FITC anti-mouse CD4, and after incubation for 30 minutes, the cells were fixed and permeabilized using the Cytofix / Cytoperm kit (BD Bioscience, USA). Next, the cells were divided into two groups and intracellular staining was performed with APC anti-mouse IFN-γ and APC anti-mouse IL-4 for 30 minutes. Finally, the stained cells were analyzed by flow cytometry.

[0154] 5.2 Results

[0155] Based on the powerful ability of CpG-modified TDNs in promoting dendritic cell maturation, we used this versatile platform to construct another peptide vaccine. Specifically, the influenza virus M2e peptide was encapsulated and CpG was conjugated to TDN to create TDN-M2e (TM) and TDN-M2e-CpG (M@TPVax) vaccines. To evaluate their effects on B cell proliferation, CFSE-stained splenocytes from C57BL / 6 mice were co-cultured with OVA, TDN, TO, O@TPVax, M2e, TM, and M@TPVax for 3 days. Subsequently, B cells (CD19 + )'s proliferation ( Figure 4 a). The results showed that OVA, TO and O@TPVax significantly induced B cell proliferation, with O@TPVax having the most significant effect ( Figure 4 b). In contrast, TDN alone had a minor effect on B cell proliferation. In the M2e-related vaccine group, M@TPVax significantly increased B cell proliferation to 22%, which was much higher than the induction levels of M2e (10%) and TM (11%) ( Figure 4 c) These results indicate that, although TDN-peptide can stimulate B cell proliferation, incorporation of peptides and CpG ODNs onto TDN significantly enhances this effect.

[0156] Next, we investigated the ability of CpG-modified TDNs to activate B cells. Splenocytes from C57BL / 6 mice were co-cultured with the vaccine for 24 h, and the expression of B cells (CD19 + ) Figure 4 d). The results showed that the O@TPVax group significantly increased the expression of CD80 and CD86 ( Figure 4 e). Similarly, M@TPVax significantly improved CD80 + and CD86 + The proportion of B cells, while M2e and TM only had a significant effect on CD86 expression, with a smaller effect on CD80 ( Figure 4 f). These results suggest that CpG-modified TDNs play a key role in B cell activation and have the potential to enhance immune responses.

[0157] In addition, considering that CpG-modified TDNs enhanced B cell activation, we further explored its effect on T cell activation induced by BMDCs treatment. BMDCs from C57BL / 6 mice were co-cultured with M2e, TDN, TM, and M@TPVax for 24 h and then with CD4 + T cells were co-cultured and T cell activation was analyzed by flow cytometry ( Figure 4 g&h). The results showed that M2e, TM, and M@TPVax all induced M2e-specific CD4 + T cells, but the induction effect of M@TPVax was significantly higher than that of M2e and TM ( Figure 4 i) In addition, these vaccine groups induced CD4 + T cells expressed low levels of the type 2 (Th2) cytokine IL-4, indicating that they elicited a Th1-biased T cell immune response in vitro ( Figure 4 j).

[0158] 6. Peptide vaccines based on TDN multifunctional exoskeleton activate dendritic cells and enhance humoral immune response

[0159] 6.1 Methods

[0160] 6.1.1 In vivo immunization

[0161] Mice were immunized by intramuscular injection of M2e and M@TPVax, using a first-boost strategy with 5 μg of peptide per mouse twice a week apart. Body weight was monitored every 3 days during the experiment. On days 21 and 60, mice were sacrificed and inguinal lymph nodes and spleens were collected for flow cytometry analysis (FC500 Beckman, IL, USA). In addition, serum samples were isolated from mouse blood on day 21, and after incubation at room temperature for 30 minutes, the samples were centrifuged at 10,000 g for 5 minutes and stored at -20°C for subsequent ELISA testing.

[0162] 6.1.2 In vivo dendritic cell activation

[0163] Spleens of mice were collected on day 21 after immunization with M2e and M@TPVax (5 μg peptide per mouse) under a prime-boost strategy. Spleens were ground, mashed, and erythrocytes were lysed with erythrocyte lysis buffer (BioLegend, USA). After centrifugation and filtration, splenocytes were resuspended in FACS buffer. After blocking with anti-mouse CD16 / 32 antibody, the cell suspension was stained with APC-Cy7-labeled anti-mouse CD45 antibody, FITC-labeled anti-mouse CD11c antibody, PE-labeled anti-mouse MHCII antibody, APC-labeled anti-mouse CD80 antibody, and PE-Cy7-labeled anti-mouse CD86 antibody for 30 min at 4°C. Finally, analysis was performed by flow cytometry (FC500 Beckman, IL, USA).

[0164] 6.1.3M2e-specific IgG titer

[0165] Antigen-specific IgG levels were determined by ELISA. Using Greiner (Germany) 96-well microtiter plates, M2e peptide (5 μg / ml in PBS) was coated overnight at 4°C. The plates were blocked with blocking buffer (1x PBS, 0.05% Tween-20, 2% BSA) for 1 hour and then washed three times in PBST. Diluted serum samples were added for incubation, and after washing, HRP-conjugated goat anti-mouse IgG antibody (Invitrogen, USA) was added. After four PBST washes, the plates were developed using the TMB substrate kit (BD Pharmingen, USA) according to the manufacturer's recommendations. The OD values ​​were measured at a wavelength of 450 nm using a microplate reader (VarioskaLUX, Thermo Fisher, MA, USA) and calibrated at a wavelength of 570 nm to ensure accurate measurements. The endpoint titer was the maximum serum dilution factor at which the OD value reached more than twice the blank mean.

[0166] 6.1.4 Immunofluorescence (IF) staining

[0167] Immunofluorescence staining was used to evaluate the expression of IgG in the spleen. Samples were fixed for 30 min and treated with 0.5% Triton X-100 and 5% goat serum for 10 min and 1 h, respectively. Samples were then stained with diluted secondary antibodies (IgG, 1:200) and nuclear staining with DAPI for 10 min. PBS was used to rinse between each step (5 min, three times). Finally, images were captured using a laser scanning confocal microscope (FV3000; Olympus, Tokyo, Japan).

[0168] 6.1.5 In vivo memory B cell stimulation

[0169] On day 60 after intramuscular immunization with M2e and M@TPVax (5 μg peptide per mouse), mice were sacrificed and inguinal lymph nodes and spleens were collected. Inguinal lymph nodes and spleens were ground, rinsed, filtered and resuspended according to the above method to obtain single-cell suspensions. Subsequently, the collected cells were blocked with anti-mouse CD16 / 32 antibodies and stained with PE-labeled anti-mouse CD19 antibodies and APC-labeled anti-mouse CD27 antibodies for 30 minutes at 4°C. Finally, the presence of memory B cells was detected by flow cytometry (FC500 Beckman, IL, USA).

[0170] 6.2 Results

[0171] To further evaluate the immunogenicity and mechanism of action of peptide vaccines constructed based on the TDN multifunctional exoskeleton, we investigated the activation of dendritic cells (DCs) in a mouse model using a first-boost strategy. C57BL / 6 mice were randomly divided into three groups: (I) PBS, (II) M2e, and (III) M@TPVax. On days 0 and 14, the vaccine was administered to mice by intramuscular injection (5 μg of peptide per mouse). On day 21, inguinal lymph nodes (iLNs) were collected and the proportion of mature DCs (CD11c + MHCII + CD80 + CD86 + )( Figure 5 a). The results showed that both M2e and M@TPVax increased the maturation of DCs, but the proportion of mature DCs induced by M@TPVax was significantly higher than that of M2e ( Figure 5 b&c). These results demonstrate that TDN-based functionalized peptide vaccines can enhance the immunogenicity of peptides and promote antigen presentation.

[0172] Next, the humoral immune responses of these vaccines in mice were evaluated ( Figure 5a). On day 21, the M2e-specific IgG titers in serum samples were analyzed by endpoint dilution ELISA. The results showed that M@TPVax significantly enhanced the production of M2e-specific antibodies, with antibody titers reaching 10^4 to 10^5, which was significantly higher than that of the M2e group ( Figure 5 d). Immunofluorescence staining further showed that the IgG expression level of M@TPVax in the spleen was also higher than that of the M2e group, further confirming that M@TPVax had a stronger antibody induction ability than M2e ( Figure 5 e). These results are consistent with previous findings, indicating that M@TPVax effectively promoted the proliferation and activation of B cells, thereby enhancing the B cell-mediated humoral immune response.

[0173] Since M@TPVax induced efficient M2e-specific antibody production, we further explored its effect on B cell immune memory. On day 60, iLNs and spleen samples were collected and analyzed by flow cytometry for M2e-specific memory B cells (CD19 + CD27 + )( Figure 5 a). The results showed that the M@TPVax group significantly increased the number of memory B cells in iLNs and spleen compared with the M2e group ( Figure 5 f&g), indicating that the vaccine has a significant improvement effect on long-term humoral immunity.

[0174] In addition, the safety of the vaccine was evaluated. The vaccine dose did not significantly affect the body weight of mice ( Fig.13 At the same time, 21 days after booster vaccination, hematoxylin and eosin (H&E) staining results showed that there was no obvious damage to the main organs of the mice ( Fig.14 ). Taken together, these results indicate that the TDN-based functional peptide vaccine can effectively induce antibody production and long-term protection, and does not cause obvious side effects at the tested doses, showing good safety.

[0175] 7. Peptide vaccines based on TDN multifunctional exoskeleton enhance cellular immune response

[0176] 7.1 Methods

[0177] On day 21 after immunization, spleens were collected from C57BL / 6 mice. The spleens were ground, lysed, centrifuged, filtered, and resuspended in FACS buffer to obtain single-cell suspensions. To detect specific T cells, 2 million splenocytes were incubated in 6-well plates with 2 μg of M2e peptide, 1 μg / ml Brefeldin A (BD Bioscience, USA) and purified hamster anti-mouse CD28 antibody for 6 hours at 37°C. After incubation, the cells were washed and stained with Zombie Aqua (ZombieAqua TM , Biolegend, USA) in order to identify living cells. Next, the cell suspension was blocked with anti-mouse CD16 / 32 antibody for 20 minutes, followed by peripheral staining, labeled with Pacific-blue anti-mouse CD3a, FITC anti-mouse CD4, and BV605 anti-mouse CD8a for 30 minutes. After washing, the cells were fixed and permeabilized using the Cytofix / Cytoperm kit (BD Bioscience, USA). The cells were then divided into two groups for intracellular staining, one group was stained with PE-Cy7 anti-mouse TNF-α, APC anti-mouse IFN-γ, and BV711 anti-mouse IL-2, and the other group was stained with APC anti-mouse IL-4 and PE anti-mouse IL-17, all incubated for 30 minutes. Finally, the stained cells were analyzed by flow cytometry (FC500 Beckman, IL, USA). For sorting strategies, antibody lists, and catalog numbers, see Fig. 9 .

[0178] To verify the memory immune response of T cells, inguinal lymph nodes and spleens were collected from C57BL / 6 mice on day 60. The inguinal lymph nodes were ground, rinsed, filtered, and resuspended in FACS buffer to obtain a single cell suspension. The spleen was also ground, mashed, and red blood cells were removed using red blood cell lysis buffer (BioLegend, USA). After centrifugation and filtration, the spleen cells were resuspended in FACS buffer. Subsequently, the collected cells were blocked with anti-mouse CD16 / 32 antibodies, followed by labeling with Pacific-blue anti-mouse CD3a, FITC anti-mouse CD4, PE anti-mouse CD44, and BV421 anti-mouse CD62L antibodies for 30 minutes at 4°C. Finally, the stained cells were analyzed by flow cytometry (FC500 Beckman, Illinois, USA).

[0179] 7.2 Results

[0180] The cellular immune responses induced by the M2e and M@TPVax vaccines were further investigated. Mice were vaccinated twice with a prime-boost strategy, 2 weeks apart. One week after the booster dose, inguinal lymph nodes (iLNs) and spleens were extracted from immunized mice and stimulated with the M2e peptide pool ( Figure 6 a) Antigen-specific CD4 in lymph nodes measured by flow cytometry + and CD8 + The results showed that M@TPVax significantly induced M2e-specific CD4 T cells expressing Th1 cytokines (IFN-γ, IL-2, and TNF-α). + T cells, while M2e is effective for CD4 + There was little effect on cytokine expression by T cells. Importantly, neither vaccine induced expression of Th2 cytokines (IL-4 and IL-17) by CD4 + T cells, indicating that the vaccine triggered a Th1-biased immune response ( Figure 6 b) Similarly, M@TPVax stimulates M2e-specific CD8 + T cells also expressed Th1 cytokines (IFN-γ, IL-2, and TNF-α) better than M2e ( Figure 6 c) In addition, M@TPVax significantly increased CD3 + CD4 + and CD3 + CD8 + T cells, while M2e only slightly increased CD3 + CD8 + The proportion of T cells to CD3 + CD4 + T cells had little effect ( Figure 6 d) These results indicate that TDN-based functionalized vaccines are able to induce strong M2e-specific Th1 and CD8+ T cell immune responses in lymph nodes.

[0181] Next, we assessed the antigen-specific CD4 + and CD8 + T cell response ( Figure 6 a). Consistent with the results in lymph nodes, M@TPVax significantly enhanced the expression of M2e-specific CD4 + The ability of T cells to produce Th1 cytokines (IFN-γ, IL-2, and TNF-α) far exceeded the response induced by M2e. Notably, neither M@TPVax nor M2e led to CD4 + The upregulation of Th2 cytokines (IL-4 and IL-17) in T cells further confirmed the Th1-biased immune response in the spleen and lymph nodes ( Figure 6e). In addition, M@TPVax significantly enhanced the M2e-specific CD8 + T cells expressed Th1 cytokines (IFN-γ, IL-2, and TNF-α), whereas M2e only slightly increased M2e-specific CD8 + T cells ( Figure 6 f) CD3 in spleen + CD4 + and CD3 + CD8 + Analysis of T cells showed that M@TPVax immunization significantly increased the proportion of these two T cell subsets, while M2e had little effect on these two types of T cells ( Figure 6 g). These results further confirmed that the TDN-based functionalized vaccine induced comprehensive M2e-specific Th1 and CD8 + Strong immunogenicity of T cell responses.

[0182] In addition, to evaluate the immune memory effect of the vaccine, we detected the M2e-specific CD4 + Central memory T cells (CD3 + CD4 + CD44highCD62Lhigh) level ( Figure 6 a). Compared with the M2e group, M@TPVax immunization significantly increased the number of memory T cells in iLNs and spleen ( Figure 6 h&i). These results suggest that TDN-based functionalized vaccines can not only induce strong immediate immune responses, but also have the potential to establish long-lasting immunity.

[0183] In summary, the peptide vaccine of the present invention uses a specific tetrahedral framework nucleic acid as a carrier, and encapsulates the 257-264 antigen epitope peptide from the model antigen ovalbumin (OVA) and the epitope peptide from the influenza A virus M2e protein inside the carrier through a specific handle, which provides the necessary protection for the peptide and significantly enhances its stability in serum and enzyme environments, thereby retaining the integrity of the antigen and ensuring its immunogenicity. At the same time, by integrating CpG ODNs into the tetrahedral framework nucleic acid, the immunogenicity of the delivered antigen is further improved. The results of animal experiments show that the vaccine of the present invention is uniquely limited to the injection site and inguinal lymph nodes in terms of distribution, exhibits excellent tolerance, minimal off-target effects and inflammatory reactions, is suitable for the prevention of influenza, and has significant practical application value.

Claims

1. A peptide vaccine, characterized in that: The vaccine uses a tetrahedral framework nucleic acid as a carrier, with peptides encapsulated inside and CpG ODNs on the outside; The polypeptide is connected to the DNA single strand of the tetrahedral framework nucleic acid through a handle and is encapsulated inside the tetrahedral framework nucleic acid; The amino acid sequence of the polypeptide is shown in SEQ ID NO.1 or 2; The nucleotide sequence of the handle is shown in SEQ ID NO.3; The nucleotide sequence of the CpG ODNs is shown in SEQ ID NO.

8.

2. The peptide vaccine according to claim 1, characterized in that: The CpG ODNs are carried on the outside of the tetrahedral framework nucleic acid through sticky end hybridization.

3. The peptide vaccine according to claim 1, characterized in that: The polypeptide is coupled with the handle through click chemistry, and the coupling product is connected with the DNA single strand of the tetrahedral framework nucleic acid through sticky end hybridization and is encapsulated inside the tetrahedral framework nucleic acid.

4. The peptide vaccine according to claim 1, characterized in that: The four single-stranded DNA sequences of the tetrahedral framework nucleic acid are shown in SEQ ID NOs. 4 to 7.

5. The peptide vaccine according to claim 4, characterized in that: The nucleotide sequence of the single-stranded DNA in the tetrahedral framework nucleic acid hybridized with the coupling product is shown in SEQ ID NO.

6.

6. A method for preparing the peptide vaccine according to any one of claims 1 to 5, characterized in that: It includes the following steps: 1) Take a peptide and modify it with an alkynyl group to obtain peptide-pra; take a handle and modify it with an azide group to obtain handle-N3; 2) Mix peptide-pra and handle-N3, and use click chemistry coupling method to obtain handle-peptide; 3) Take handle-peptide and four DNA single strands, add them to TM buffer, maintain at 70℃ for 10 minutes, quickly cool to 4℃ and maintain for more than 20 minutes to obtain TDN-peptide; 4) Take TDN-peptide and CpG ODNs, mix them in equal moles at room temperature to obtain.

7. The preparation method according to claim 6, characterized in that: Step 2) the molar ratio of peptide-pra to handle-N3 is 1 to 3:1; The amino acid sequence of the peptide-pra is SIINFEKL-pra or SLLTEVETPIRNEWGCRCNDSSD-pra; The nucleotide sequence of handle-N3 is GGTTGTTGGGT-N3.

8. The preparation method according to claim 6, characterized in that: Step 3) The four DNA single strands and the handle-peptide in the TM buffer have equimolar concentrations.

9. The preparation method according to claim 6, characterized in that: Step 4) The mixing time is 30 minutes.

10. Use of the peptide vaccine according to any one of claims 1 to 5 in the preparation of influenza vaccine.

Images