Double-display phage as well as construction method and application thereof

Abstract

The invention relates to the technical field of gene engineering, and particularly discloses a double-display phage as well as a construction method and application thereof, and the construction method comprises the following steps: synthesizing a pM8A plasmid as shown in SEQ ID NO.1 and a pM8C plasmid as shown in SEQ ID NO.2; the preparation method comprises the following steps: inserting a gene segment for coding RGD peptide into NcoI and HindIII restriction enzyme cutting sites of a pM8A plasmid to obtain a pM8A-RGD plasmid, inserting a gene segment for coding BMP2 peptide into NcoI and HindIII restriction enzyme cutting sites of a pM8C plasmid to obtain a pM8C-BMP2 plasmid, co-transfecting the pM8A-RGD plasmid and the pM8C-BMP2 plasmid into a TG1 competent cell, adding a helper phage, incubating, and purifying to obtain the double-display phage pM8-RGD-BMP2. The double-display phage provided by the invention has the effects of promoting proliferation of the mesenchymal stem cells and promoting osteogenic differentiation of the mesenchymal stem cells.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a double-display phage and a construction method and application thereof. Background Art

[0002] Osteoporosis is a systemic bone disease caused by various reasons. Its main characteristics are decreased bone density and bone quality, damage to bone microstructure, increased bone brittleness, and a state prone to fractures. Osteoporosis is mainly divided into primary and secondary types. Primary osteoporosis is further divided into postmenopausal osteoporosis, senile osteoporosis, and idiopathic osteoporosis. Symptoms of osteoporosis include pain, spinal deformity, and brittle fractures. These symptoms may lead to pain, functional impairment in daily life, or more serious complications, such as chest deformity that affects cardiopulmonary function. The diagnosis of osteoporosis is mainly based on dual-energy X-ray absorptiometry and other related symptoms. Treatment includes lifestyle adjustments, the use of basic supplements for bone health, drug intervention, and surgical treatment when necessary.

[0003] BMP-2 is a bone morphogenetic protein, a hydrophobic protein secreted by the bone matrix, and a member of the transforming growth factor superfamily. BMP-2 has the function of inducing undifferentiated mesenchymal stem cells and fibroblasts to differentiate into osteoblasts, and can regulate the differentiation of osteoblasts and chondroblasts, induce ectopic bone formation and promote fracture healing. BMP-2 is an initiator of bone formation, which can accelerate bone reconstruction and is an ideal target gene for bone repair gene therapy.

[0004] However, the dosage of BMP-2 used in clinical practice is "superphysiological". This high dosage of BMP-2 often leads to complications such as ectopic osteogenesis, inflammation, tumor formation, and osteolysis, which significantly reduces the efficiency of osteogenesis and results in less than optimal results. The large-scale use of BMP-2 also brings a heavy economic burden to patients. Therefore, it is urgent to develop a new product for promoting osteogenesis. Summary of the invention

[0005] In order to develop an effective method for reducing the dosage of BMP-2 while ensuring the osteogenic efficiency, the present invention provides a dual-display phage and its construction method and application. The dual-display phage provided by the present invention has the effect of promoting the proliferation of mesenchymal stem cells and promoting the osteogenic differentiation of mesenchymal stem cells.

[0006] The present invention provides a dual display phage, which is prepared by the following steps: Synthesize the pM8A plasmid shown in SEQ ID NO.1 and the pM8C plasmid shown in SEQ ID NO.2 for future use; The gene fragment encoding RGD peptide was obtained by PCR amplification and inserted into the pM8A plasmid. Nco I and Hind III restriction site to obtain pM8A-RGD plasmid; The gene fragment encoding BMP2 peptide was obtained by PCR amplification and inserted into the pM8C plasmid Nco I and Hind III restriction site to obtain pM8C-BMP2 plasmid; The pM8A-RGD plasmid and the pM8C-BMP2 plasmid were co-transfected into TG1 competent cells, and then helper phage was added for incubation and purified to obtain the dual display phage pM8-RGD-BMP2.

[0007] The present invention designs and synthesizes pM8A plasmid vector and pM8C plasmid vector, further obtains pM8A-RGD plasmid and pM8C-BMP2 plasmid, co-transfects pM8A-RGD plasmid and pM8C-BMP2 plasmid into TG1 competent cells, and then adds helper phage for incubation and purification to obtain a double display phage pM8-RGD-BMP2 with a length of about 1.3 μm. The BMP2 binding peptide displayed by the obtained double display phage pM8-RGD-BMP2 promotes the osteogenic differentiation of mesenchymal stem cells.

[0008] The present invention also provides a method for constructing the dual display phage, comprising the following steps: Synthesize the pM8A plasmid shown in SEQ ID NO.1 and the pM8C plasmid shown in SEQ ID NO.2 for future use; The gene fragment encoding RGD peptide was obtained by PCR amplification and inserted into the pM8A plasmid Nco I and Hind III restriction site to obtain pM8A-RGD plasmid; The gene fragment encoding BMP2 peptide was obtained by PCR amplification and inserted into the pM8C plasmid Nco I and Hind III restriction site to obtain pM8C-BMP2 plasmid; The pM8A-RGD plasmid and the pM8C-BMP2 plasmid were co-transfected into TG1 competent cells, and then helper phage was added for incubation and purified to obtain the dual display phage pM8-RGD-BMP2.

[0009] Furthermore, the amplification primers for the gene fragment encoding the RGD peptide are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0010] Furthermore, the amplification primers for the gene fragment encoding the BMP2 peptide are shown in SEQ ID NO.3 and SEQ ID NO.5.

[0011] Furthermore, the pM8A-RGD plasmid and the pM8C-BMP2 plasmid were co-transfected into TG1 competent cells by heat shock treatment.

[0012] Furthermore, the heat shock treatment is as follows: 90 ng to 100 ng of the constructed pM8A-RGD plasmid and pM8C-BMP2 plasmid are added to 80 μl to 90 μl of TG1 competent cells, mixed, and then quickly placed in a 42°C water bath for heat shock for 60 seconds, taken out and placed in ice for 2 minutes.

[0013] Furthermore, the heat-shocked cells are inoculated in LB culture medium to obtain a culture, and then the precipitate is collected after centrifugation and inoculated in LB solid culture medium containing ampicillin and chloramphenicol to obtain a dual-display phage culture.

[0014] Furthermore, the purification process is as follows: the double-display phage culture is centrifuged at 4000rpm~4500rpm for 25min~30min to remove bacteria, a mixture of polyethylene glycol and sodium chloride is added to the supernatant and mixed, and the mixture is allowed to stand at 4°C for 14h~16h and then centrifuged at 10000rpm~12000rpm for 30min~35min to obtain the double-display phage pM8-RGD-BMP2.

[0015] The present invention also provides the use of the dual-display phage in preparing a product for promoting bone differentiation, wherein the product uses the dual-display phage as the only effective ingredient.

[0016] Furthermore, the product has the function of promoting the proliferation of mesenchymal stem cells and promoting the osteogenic differentiation of mesenchymal stem cells.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention designs and synthesizes pM8A plasmid vector and pM8C plasmid vector. pM8A plasmid vector and pM8C plasmid vector can be Nco I and Hind III inserts the p8 protein gene carrying the exogenous polypeptide gene into the vector, expresses the recombinant protein of the polypeptide and p8 protein, and completes phage display under the action of auxiliary phage. At the same time, the pM8A plasmid vector and the pM8C plasmid vector carry the ampicillin resistance gene AmpR and the chloramphenicol resistance gene CmR, respectively, which can greatly facilitate the subsequent positive clone screening. Subsequently, the RGD peptide and BMP2 peptide on the surface of the phage are used to jointly promote the proliferation and osteogenic differentiation of mesenchymal stem cells.

[0018] The pM8-RGD-BMP2 dual display phage prepared by the present invention has a large specific surface area, so it can carry a large amount of molecular drugs, can simultaneously express the dual functionality of RGD peptide and BMP2, and rely on the RGD peptide and BMP2 peptide on the surface of the phage to jointly promote the proliferation and osteogenic differentiation of mesenchymal stem cells, thereby improving the osteogenesis efficiency, thereby indirectly reducing the dosage of BMP-2. The pM8-RGD-BMP2 dual display phage prepared by the present invention will have great clinical application value for the repair of alveolar bone or other parts of bone defects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 This is a transmission electron microscope characterization image of the bacteriophage prepared in Example 1; In the figure, A is a transmission electron microscopy characterization of pM8A-RGD phage; B is a transmission electron microscopy characterization of pM8C-BMP2 phage; C is the transmission electron microscopy characterization of pM8-RGD-BMP2 phage.

[0021] Figure 2 This is a graph showing the CCK8 experimental results of the bacteriophage prepared in Example 1 on the proliferation of mesenchymal stem cells.

[0022] Figure 3 This is an experiment on the effect of the bacteriophage prepared in Example 1 on the osteogenic differentiation of mesenchymal stem cells; In the figure, A is a graph showing the alkaline phosphatase reaction results of blank, wild type, pM8C-BMP2, pM8A-RGD and pM8-RGD-BMP2 phages and mesenchymal stem cells on the 14th day after incubation from left to right; B is the statistical result of the absorbance value of the ALP reaction in Figure A at 405nm. DETAILED DESCRIPTION

[0023] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0024] Example 1: A dual-display phage and a method for constructing the same.

[0025] 1. Experimental Materials and Methods 1. Experimental materials and sources Wild M13 phage was purchased from New England Biolabs, catalog number: N0315S; PCR kit was purchased from Kangwei Century, catalog number: CW3314S; QIAquick Gel Extraction Kit plasmid recovery kit was provided by Qiagen, catalog number: 28704; T4 DNA ligase was provided by New England Biolab, catalog number: M0202V; helper phage was provided by EnglandBiolabs, catalog number: N0315S.

[0026] 2. Preparation of pM8A-RGD plasmid (1) Preparation of pM8A plasmid Through DNA design, a pM8A plasmid carrying the ampicillin resistance gene AmpR was synthesized with a length of 4212 bp, and its sequence is shown in SEQ ID NO.1.

[0027] SEQ ID NO.1:

[0028] (2) Preparation of pM8A-RGD plasmid The RGD peptide sequence is CRGDC, and an upstream primer RGD-F and a downstream primer RGD-R are designed to amplify a gene fragment encoding the RGD peptide; the sequence of the upstream primer RGD-F is shown in SEQ ID NO.3, and the sequence of the downstream primer RGD-R is shown in SEQ ID NO.4.

[0029] SEQ ID NO.3: 5'-ATCCATGGCGTGCCGCGGCGATTGCGATCCCGCAAAAGCG-3'; SEQ ID NO. 4: 5'-GCAAGCTTTTATCAGCTTGCTTTCGAG-3'.

[0030] Then, the wild M13 phage genome was used as a template, RGD-F and RGD-R were used as primers, and a PCR kit was used to perform a PCR reaction according to the procedure in Table 1 to obtain a recombinant DNA fragment encoding the fusion protein of RGD peptide and phage p8, which was recorded as DNA RGD , and its gene sequence is shown in SEQ ID NO.7.

[0031] SEQ ID NO.7: TGCCGCGGCGATTGC.

[0032] Table 1 PCR program

[0033] use Nco I and Hind III double digestion of DNA RGD Insert into pM8A plasmid to obtain pM8A-RGD plasmid. Nco The I sequence is CCATGG; Hind The III sequence is AAGCTT. The specific construction process is as follows: Construction of pM8A-RGD plasmid: The successfully sequenced pM8A plasmid was cloned to obtain a large number of pM8A plasmids. Nco I and Hind III restriction endonucleases for pM8A plasmid and DNA RGDThe gene fragment was digested overnight at 37°C; the fragment was recovered using the QIAquickGel Extraction Kit plasmid recovery kit. The two recovered DNA fragments were connected at 16°C for 12 h using T4 DNA ligase to obtain the pM8A-RGD plasmid; 100 ng of the successfully constructed pM8A-RGD plasmid was added to 80 μl of JM109 competent cells and mixed, and placed on ice for 20 min. The mixture was quickly placed in a 42°C water bath for heat shock for 60 s, taken out and placed in ice for 2 min. 1 ml of LB culture medium was added at 150 rpm and cultured at 37°C for 1 h. The culture was centrifuged at 4000 rpm for 5 min, and the precipitate was resuspended with 100 μl, smeared on the surface of 50 μg / ml ampicillin-resistant LB solid culture medium, and cultured at 37°C overnight to obtain anti-positive clones. Ampicillin-resistant clones were selected for DNA sequencing.

[0034] 3. Preparation of pM8C-BMP2 plasmid (1) Preparation of pM8C plasmid The pM8C plasmid carrying the chloramphenicol resistance gene CmR was designed and synthesized, the sequence of which is shown in SEQ ID NO.2 and has a length of 4044 bp.

[0035] SEQ ID NO.2:

[0036] (2) Preparation of pM8C-BMP2 plasmid The BMP2 peptide sequence is shown in SEQ ID NO.6; a downstream primer BMP2-R is designed to amplify a gene fragment encoding the BMP2 peptide, and the sequence of the downstream primer BMP2-R is shown in SEQ ID NO.5.

[0037] SEQ ID NO.5: ATCCATGGCGAAAATCCCGAAAGCGAGCTCTGTTCCGACCGAACTGTCTGCGATCAGCACCCTGTACCTGGCGTCTGATCCCGCAAAAGCG.

[0038] SEQ ID NO.6: KIPKASSVPTELSAISTLYLAS.

[0039] Using the wild M13 phage genome as a template and RGD-F and BMP2-R as primers, a PCR experiment was performed according to the procedure in Table 1 to amplify a recombinant DNA fragment encoding the BMP2 peptide and the phage p8 protein, which was recorded as DNA BMP2 , the sequence is shown as SEQID NO.8.

[0040] SEQ ID NO.8: AAAATCCCGAAAGCGAGCTCTGTTCCGACCGAACTGTCTGCGATCAGCACCCTGTACCTGGCGTCT.

[0041] use Nco I and Hind III Double digestion of recombinant DNA BMP2 Insert the pM8C plasmid to obtain the pM8C-BMP2 plasmid. The details are as follows: Construction of pM8C-BMP2 plasmid: The pM8C vector that was successfully sequenced was cloned to obtain a large number of pM8C plasmids. Nco I and Hind III restriction endonucleases for pM8C plasmid and DNA BMP2Perform restriction digestion at 37°C overnight; use QIAquick GelExtraction Kit plasmid recovery kit to recover fragments. The two recovered DNA fragments were connected by T4 DNA ligase at 16°C for 12h to obtain pM8C-BMP2; the ligation product was transformed into JM109 competent cells according to the transformation steps in the construction process of pM8A-RGD plasmid. Positive screening was performed using 70μg / ml chloramphenicol double-resistant LB solid medium, and chloramphenicol-resistant clones were selected for DNA sequencing.

[0042] 4. Construction of dual display phage Pipette 100ng of the successfully constructed pM8A-RGD plasmid and pM8C-BMP2 plasmid, add 80μl of TG1 competent cells and mix well, and place on ice for 20min. Quickly place the mixture in a 42℃ water bath for heat shock for 60s, take it out and insert it into ice for 2min. Add 1ml LB medium and culture at 150rpm and 37℃ for 1h to obtain the culture. Centrifuge the culture at 4000rpm for 5min, resuspend the precipitate with 100μl, apply it on the surface of 50μg / ml ampicillin and 70μg / ml chloramphenicol double-antibody LB solid culture medium, and culture overnight at 37℃ to obtain double-antibody positive clones. Pick the positive clones in 5mL double-antibody LB culture medium, culture at 180rpm to the logarithmic phase, add 3μl helper phage and incubate for 30min. Add the incubated bacteria to 100ml LB culture medium, culture at 160rpm and 37℃ for 16h to obtain double-display phage culture.

[0043] The dual-display phage culture was centrifuged at 4000 rpm for 30 min to remove bacteria, and the supernatant was added to a 1 / 6 volume of a mixed solution of 16.6% polyethylene glycol and 2.5 M sodium chloride, mixed evenly, and allowed to stand at 4°C overnight and then centrifuged at 12000 rpm for 30 min to purify the dual-display phage pM8-RGD-BMP2.

[0044] 5. Characterization of pM8A-RGD, pM8C-BMP2, and pM8-RGD-BMP2 phages using transmission electron microscopy 5 μl of purified pM8A-RGD, pM8C-BMP2 and pM8-RGD-BMP2 phage solutions were respectively added to the copper grid and incubated for 10 min. After the surface liquid was dried with filter paper, 2 μl of uranyl acetate was immediately added and incubated for 20 s, and then the residual staining liquid was dried with filter paper. Then TEM microscopy was performed.

[0045] The results are as follows Figure 1 As shown, the present invention successfully prepared pM8A-RGD, pM8C-BMP2 and pM8-RGD-BMP2 filamentous phages with a length of about 1.3 μm.

[0046] Example 2: Application of the pM8A-RGD, pM8C-BMP2 and pM8-RGD-BMP2 phages prepared in Example 1 in promoting osteogenic differentiation.

[0047] 1. Using CCK8 assay to test the effects of pM8A-RGD, pM8C-BMP2 and pM8-RGD-BMP2 phages on mesenchymal stem cell proliferation Resuspend rat bone marrow mesenchymal stem cells in complete medium, count the cells under a microscope and dilute appropriately. Plate them in a 96-well cell culture plate, seeding approximately 1×10 cells per well. 4 Place the cells in a 37°C CO2 incubator overnight and replace with 1×10 12 pfu / ml complete medium of phage. After incubating mesenchymal stem cells with phage solution at 37℃ for 1 day and 3 days, carefully discard the remaining medium and wash with sterile PBS. Add 100μl serum-free low-glucose DMEM medium + 10μl CCK8 reagent to the wells and mix carefully. Incubate in a 37℃ CO2 constant temperature incubator for 3 hours and measure the OD value at 450nm.

[0048] The results are as follows Figure 2 As shown, the absorbance values ​​of the pM8A-RGD, pM8C-BMP2 and pM8-RGD-BMP2 phage treatment groups were significantly higher than those of the control group and the wild-type phage group. This indicates that the peptides displayed by the pM8A-RGD, pM8C-BMP2 and pM8-RGD-BMP2 phages all have the ability to promote stem cell proliferation.

[0049] 2. Evaluation of the effects of pM8A-RGD, pM8C-BMP2 and pM8-RGD-BMP2 phages on osteogenic differentiation of mesenchymal stem cells using an alkaline phosphatase quantitative detection kit and ALP staining Resuspend rat bone marrow mesenchymal stem cells in complete medium, count the cells under a microscope and dilute appropriately. Plate them in a 24-well cell culture plate, seeding approximately 6×10 cells per well. 5 The cells were cultured in a 37°C CO2 incubator. After the cells were observed to be attached to the wall and the cell density was about 80%, the cells were replaced with 1×10 12 pfu / ml of complete culture medium containing phage.

[0050] ALP quantification kit and BCA protein detection kit were used to calculate ALP activity. After incubation of mesenchymal stem cells with phage solution at 37°C for 7 and 14 days, the remaining culture medium was carefully discarded and the cells were rinsed with sterile PBS. The cells were lysed with appropriate cell or tissue lysis buffer, and the ALP activity of MSCs was determined by the standardized amount of p-nitrophenol and protein in the same well. The content of p-nitrophenol was measured at OD = 405nm. The amount of protein was measured at OD = 562nm.

[0051] ALP activity was detected using the BCIP / NBT alkaline phosphatase colorimetric kit. After incubating mesenchymal stem cells with the phage solution at 37°C for 14 days, the remaining culture medium was carefully discarded, rinsed with sterile PBS, fixed with 4% paraformaldehyde for 30 minutes at room temperature, and rinsed with sterile water. An appropriate amount of BCIP / NBT staining working solution was added, and the cells were incubated at room temperature in the dark for 30 minutes until the color developed to the expected depth. The BCIP / NBT staining working solution was removed and the color reaction was terminated by washing with sterile water. Observe under a microscope.

[0052] The results are as follows Figure 3 As shown in the figure, after mesenchymal stem cells were incubated with phage, the alkaline phosphatase of the pM8C-BMP2 and pM8-RGD-BMP2 groups was significantly higher than that of the control group on the 7th and 14th days. There was no significant difference between the other groups and the control group. This shows that the BMP2 binding peptides displayed by pM8C-BMP2 and pM8-RGD-BMP2 phages promoted the osteogenic differentiation of mesenchymal stem cells.

[0053] It should be noted that both double display phage and pM8-RGD-BMP2 represent pM8-RGD-BMP2 phage.

[0054] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.

[0055] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A dual display phage, It is characterized in that The dual display phage is prepared by the following steps: Synthesize the pM8A plasmid shown in SEQ ID NO.1 and the pM8C plasmid shown in SEQ ID NO.2 for future use; The gene fragment encoding RGD peptide was obtained by PCR amplification and inserted into the pM8A plasmid. Nco I and Hind III restriction site to obtain pM8A-RGD plasmid; The gene fragment encoding BMP2 peptide was obtained by PCR amplification and inserted into the pM8C plasmid Nco I and Hind III restriction site to obtain pM8C-BMP2 plasmid; The pM8A-RGD plasmid and the pM8C-BMP2 plasmid were co-transfected into TG1 competent cells, and then helper phage was added for incubation and purified to obtain the dual display phage pM8-RGD-BMP2.

2. A method for constructing a dual display phage, It is characterized in that The steps include: Synthesize the pM8A plasmid shown in SEQ ID NO.1 and the pM8C plasmid shown in SEQ ID NO.2 for future use; The gene fragment encoding RGD peptide was obtained by PCR amplification and inserted into the pM8A plasmid. Nco I and Hind III restriction site to obtain pM8A-RGD plasmid; The gene fragment encoding BMP2 peptide was obtained by PCR amplification and inserted into the pM8C plasmid Nco I and Hind III restriction site to obtain pM8C-BMP2 plasmid; The pM8A-RGD plasmid and the pM8C-BMP2 plasmid were co-transfected into TG1 competent cells, and then helper phages were added for incubation and purified to obtain the dual display phage pM8-RGD-BMP2 according to claim 1.

3. The method for constructing a dual display phage according to claim 2, It is characterized in that The primers for amplifying the gene fragment encoding the RGD peptide are shown in SEQ ID NO.3 and SEQ ID NO.

4.

4. The method for constructing a dual display phage according to claim 2, It is characterized in that The primers for amplifying the gene fragment encoding the BMP2 peptide are shown in SEQ ID NO.3 and SEQ ID NO.

5.

5. The method for constructing a dual display phage according to claim 2, It is characterized in that The pM8A-RGD plasmid and pM8C-BMP2 plasmid were co-transfected into TG1 competent cells by heat shock treatment.

6. The method for constructing a dual display phage according to claim 5, It is characterized in that The heat shock treatment is as follows: 90 ng to 100 ng of the constructed pM8A-RGD plasmid and pM8C-BMP2 plasmid are added to 80 μl to 90 μl of TG1 competent cells, mixed evenly, and then quickly placed in a 42° C. water bath for heat shock for 60 seconds, and then taken out and placed in ice for 2 minutes.

7. The method for constructing a dual display phage according to claim 6, It is characterized in that The heat-shocked cells are inoculated in LB culture medium to obtain a culture, and then the precipitate is collected after centrifugation and inoculated in LB solid culture medium containing ampicillin and chloramphenicol to obtain a double-display phage culture.

8. The method for constructing a dual display phage according to claim 7, It is characterized in that The purification process is as follows: the double display phage culture is centrifuged at 4000rpm-4500rpm for 25min-30min to remove bacteria, a mixture of polyethylene glycol and sodium chloride is added to the supernatant and mixed, and the mixture is allowed to stand at 4°C for 14h-16h and then centrifuged at 10000rpm-12000rpm for 30min-35min to obtain the double display phage pM8-RGD-BMP2.

9. Use of the dual display phage according to claim 1 in preparing a product promoting osteogenic differentiation, It is characterized in that The product uses double-display phage as the only active ingredient.

10. Use of the dual display phage according to claim 9 in preparing a product promoting osteogenic differentiation, It is characterized in that The product has the function of promoting the proliferation of mesenchymal stem cells and promoting the osteogenic differentiation of mesenchymal stem cells.

Images