Cas12f nuclease mutant, its application and kit

Abstract

The present invention provides a Cas12f nuclease mutant, and one or more arbitrary mutations in the following sites are performed on the basis of the Cas12f nuclease with an amino acid sequence such as SEQ ID No.2: 115, 119, 180, 364, 401, 447. Also disclosed are its encoding gene, expression vector, host bacteria, kit and application. The present invention mutates on the basis of the wild-type Cas12f nuclease, and the obtained mutant has a significantly improved cutting efficiency compared to the wild type, with an average increase of 1.3-2.2 times, which is more suitable for gene editing and improves editing efficiency.

Description

Technical Field

[0001] The patent of this invention relates to a Cas12f nuclease mutant, its application and kit, and belongs to the field of biotechnology. Background Art

[0002] The full name of CRISPR is Clustered Regularly Interspaced Short Palindromic Repeats, which is like many identical small segments, and then evenly inserting them into a randomly arranged DNA. These sequences are called repeats, and the randomly arranged DNA that separates them is called spacer. The full name of Cas is CRISPR associated, which together with the CRISPR sequence constitutes the CRISPR / Cas system. The CRISPR / Cas system is widely used in biological and medical fields such as disease model establishment, anti-cancer drug development, and stem cell therapy.

[0003] In the CRISPR / Cas system, the most studied and used Cas effector protein is Cas9, but it is difficult to be efficiently delivered by adeno-associated virus (AAV) vectors due to its large molecular size (more than 1,000 amino acids), thus limiting its application in areas such as gene therapy. For example, the maximum carrying capacity of the adeno-associated virus delivery system is 4,700 nucleotides, which is not much longer than the gene encoding Streptococcus pyogenes Cas9 (4,200 nucleotides), resulting in no space for the assembly of other regulatory elements.

[0004] To this end, researchers are actively looking for Cas effector proteins that are relatively small but can still perform the "scissors" function. Among them, the most compact type of CRISPR effector nuclease Cas12f (400-700 amino acids) has attracted much attention due to its small molecular weight. At present, there are relatively few studies on the nuclease Cas12f. This application hopes to further improve its performance by mutating it. Summary of the invention

[0005] The object of the present invention is to provide a Cas12f nuclease mutant with higher in vitro cleavage activity.

[0006] The technical solution adopted by the present invention is:

[0007] A Cas12f nuclease mutant is a protein described in any of the following a1-a3 enzyme mutations:

[0008] a1: Based on the amino acid sequence of the Cas12f nuclease shown in SEQ ID No. 2, one or more of the following sites are mutated at random: 115, 119, 180, 364, 401, 447; these sites are sites of the binding region of the Cas12f nuclease and sgRNA / dsDNA, and the charge of the amino acid residues at these sites is optimized, and the wild-type amino acid residues are mutated from neutral or acidic to alkaline or neutral to improve the binding ability of the two;

[0009] a2: a protein having substantially the same cleavage efficiency obtained by replacing and / or deleting and / or adding one or more amino acid residues other than the aforementioned mutation in the amino acid sequence shown in a1;

[0010] a3: A protein having more than 90% sequence identity with the protein of a1, or at least 95%, 96%, 97%, 98%, 99%, 99.5% or 99.8% sequence identity, and having a cleavage efficiency substantially equivalent to that of the protein of a1.

[0011] Preferably, the mutation is selected from one or more combinations of Q115L, E119L, S180R, I364K, T386K, E393A, E401A or E447K. These sites are sites where the Cas12f nuclease binds to the sgRNA / dsDNA binding region, and the charge of the amino acid residues at these sites is optimized, and the neutral or acidic mutation of the wild-type amino acid residues is changed to alkaline or neutral to improve the binding ability of the two.

[0012] Preferably, a label is also included, and the label is used to separate, purify and / or track the functional domain, peptide or protein of the Cas12f nuclease. More preferably, the label is a histidine (His) tag, a V5 tag, a FLAG tag, an influenza hemagglutinin (HA) tag, a Myc tag, a VSV-G tag, a thioredoxin (Trx) tag. Fluorescent proteins, such as green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), HcRED and DsRed; Glutathione-S-transferase (GST), horseradish peroxidase (HRP) or luciferase reporter proteins.

[0013] The description of the mutation in the present invention is a description of the mutation recognized by those skilled in the art. Taking the mutation of one of the sites as an example, Q115L, it means that the glutamine (Q) at position 115 of the amino acid sequence shown in SEQ ID NO: 2 is mutated to leucine (L), that is, the glutamine (Q) at position 115 is replaced by leucine (L).

[0014] As used herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. Percent sequence identity can be calculated by any method known in the art, for example using the BLOSUM62 matrix, with reference to Henikoff et al. NAS 89 (22):10915-10919 (1992) The method described in .

[0015] The encoding gene of the above-mentioned Cas12f nuclease mutant.

[0016] The expression vector or host bacteria of the above-mentioned Cas12f nuclease mutant.

[0017] The application of the above-mentioned Cas12f nuclease mutants in gene editing in vitro.

[0018] The present invention also discloses a composition or a kit containing the above-mentioned Cas12f nuclease mutant.

[0019] The present invention also discloses a gene editing kit containing the above-mentioned Cas12f nuclease mutant.

[0020] The present invention also discloses a method for cutting a target nucleic acid, wherein the target nucleic acid is contacted with the above-mentioned Cas12f nuclease mutant, composition or kit.

[0021] The present invention mutates the wild-type Cas12f nuclease, and the obtained mutant has significantly improved cutting efficiency compared with the wild type, with an average increase of 1.3-2.2 times, which is more suitable for gene editing and improves editing efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Schematic diagram of the cleavage results of the p11-LacY-wtx1 fragment by the wild-type and various mutants of Cas12f nuclease.

[0023] Figure 2 Schematic diagram of the cleavage results of the EMX1 gene fragment by the wild-type and various mutants of Cas12f nuclease.

[0024] Figure 3 Schematic diagram of the cleavage results of the KEX2 gene fragment by the wild-type and various mutants of Cas12f nuclease. DETAILED DESCRIPTION

[0025] The specific implementation modes of the present invention are further described below in conjunction with the accompanying drawings, but the description of the embodiments does not impose any limitation on the protection scope of the present invention.

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by technicians in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0027] Unless otherwise specified, the materials and instruments used in the following examples can be obtained from conventional commercial channels.

[0028] Example 1 Construction of Cas12f mutant plasmid

[0029] Using the pET-21b plasmid containing wild-type Cas12f (sequence as shown in SEQ ID NO.1) as a template, different Cas12f mutant fragments were amplified using point mutation primers. The wild-type Cas12f protein sequence is shown in Seq ID NO. 2. The amino acid mutation sites corresponding to the mutants are shown in the following table.

[0030]

[0031] The amplification system was shown in the table below using TOYOBO KOD DNA polymerase. The amplification fragments of the genes of the mutants were obtained by amplification.

[0032]

[0033] The obtained Cas12f mutant fragment was connected to the pET-21b plasmid using the Yishen homologous recombination kit to obtain the recombinant plasmid. The mutant recombinant plasmid was then transformed into BL21 (DE3) cells by chemical transformation, and single colonies were selected to expand the culture and extract the plasmid, which was then verified by sequencing.

[0034] Example 2: Purification of Cas12f mutant protein

[0035] 1. Expression of Cas12f mutant proteins: Inoculate each mutant bacterial solution at a ratio of 1% into 800 mL of fresh 2×YT liquid medium and culture at 37°C and 220 rpm until OD 600 When the value was about 0.8, 0.1 mM IPTG was added and cultured at 16°C and 220 rpm for about 18 h to induce the expression of exogenous proteins and collect the bacterial liquid of each mutant.

[0036] 2. Bacterial disruption: centrifuge at 4℃, 5500rpm for 15min and discard the supernatant; lyse the bacteria with lysis buffer A according to the weight of the bacteria, add 4.5g of bacteria to 45mL of lysis buffer A, stir with magnetic stirring at 4℃ for 30min, stir with a stirrer until the bacteria are thawed and evenly dispersed in the lysis solution, and no lumps of bacteria are observed. Before lysis, add PMSF to 2mM for ultrasonic disruption, and the disruption conditions are: φ6, 60%, ultrasonic 3' stop 5', 15min / time*2, ice bath. After the end, centrifuge at 12000g for 30min and take the supernatant.

[0037] 3. Nickel column purification

[0038] The purification procedure and purification buffer are shown in the following table:

[0039]

[0040] Buffer A: 20mM Tris; 800mM NaCl; 10%Glycerol; pH7.6

[0041] Buffer B: 20mM Tris; 500mM NaCl; 0.5M imidazole; 10% Glycerol; pH7.6

[0042] Buffer C: 20mM Tris; 1.5M NaCl; 10% Glycerol; pH7.6

[0043] 4. HE purification

[0044] The purification procedure and purification buffer are shown in the following table:

[0045]

[0046] Buffer D: 20mM Tris; 100mM NaCl; 1mM DTT; 0.1mM EDTA; 10% Glycerol; pH7.6

[0047] Buffer E: 20mM Tris; 2M NaCl; 1mM DTT; 0.1mM EDTA; 10% Glycerol; pH7.6

[0048] Before loading, the sample needs to be diluted with Buffer D to a conductivity of about 18mS / cm. If there is precipitation after dilution, it needs to be filtered with a filter membrane.

[0049] 5. Preparation of protein stock solution

[0050] The target protein sample was dialyzed into Buffer G at a ratio of 1:100. After dialysis, 50% volume of glycerol was added and the mixture was thoroughly mixed and filtered through a 0.22 μm filter membrane. The purity of each mutant was detected by electrophoresis and the protein concentration was estimated.

[0051] Buffer G: 40mM Tris; 1M NaCl; 2mM DTT; 0.2mM EDTA; 10% Glycerol; pH8.0

[0052] Example 3: In vitro cleavage experiment of Cas12f mutant

[0053] 1. Preparation of Cas12f mutants for in vitro cleavage of DNA substrates

[0054] ① Using the p11-LacY-wtx1 plasmid as a template, amplify the plasmid cleavage sequence containing the cleavage target, the sequence is shown in SEQ ID NO: 3. Amplification primer sequence:

[0055] p11-LacY-wtx1-F:ACAAAGCGGGACCAAAGCCA (SEQ ID NO:22)

[0056] p11-LacY-wtx1-R:GAGTTCGGCATGGGGTCAGG (SEQ ID NO:23)

[0057] ②Using the 293 cell genome as a template, amplify the human EMX1 gene sequence containing the cleavage target, the sequence is shown in SEQ ID NO: 4. Amplification primer sequence:

[0058] EMX1-F: GTGTTGCGGAGGGAGTGGACTTAGGG (SEQ ID NO: 24)

[0059] EMX1-R: GGCAGCAGCTAGGCTGAGGGTCGCTGA (SEQ ID NO:25)

[0060] ③ Using the GS115 yeast genome as a template, amplify the yeast KEX2 gene sequence containing the cleavage target site, the sequence is shown in SEQ ID NO: 5. Amplification primer sequence:

[0061] KEX2-F:GAGCTCCTGTTGTGATGGACAA (SEQ ID NO:26)

[0062] KEX2-R: TGCCATAAATCCAGCTTTGTGG (SEQ ID NO: 27)

[0063] 2. Preparation of Cas12f mutants for sgRNA cleavage in vitro

[0064] sgRNA was transcribed using the Yisheng T7 High Yield RNA Synthesis Kit. The in vitro transcription system is shown in the table below. The corresponding DNA template was chemically synthesized by Bioengineering (italics represent T7 promoter sequences, underlined fonts represent sgRNA backbone sequences, and bold fonts represent target sequences)

[0065]

[0066] p11-LacY-wtx1 substrate corresponds to the transcription template sequence of sgRNA: TAATACGACTCACTATAGGG ACCGCT TCACCGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACA AAGAAAGGAATGCAAC CACCTATAAAAGAGAGAGCC TTTTATTTTTT (SEQ ID NO:28)

[0067] EMX1 substrate corresponds to the transcription template sequence of sgRNA:

[0068] TAATACGACTCACTATAGGG ACCGCTTCACCGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGA GAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAAGAAAGGAATGCAAC GAGCCTCTTCCTCGAGACTGCGT TTT TATTTTTT (SEQ ID NO:29)

[0069] KEX2 substrate corresponds to the transcription template sequence of sgRNA:

[0070] TAATACGACTCACTATAGGG ACCGCTTCACCGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGA GAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAAGAAAGGAATGCAAC ATATCAATTGCCCCAACTGTTAT TTT TATTTTTT (SEQ ID NO:30)

[0071] After in vitro transcription, add 2 uL DNase I and digest the DNA template at 37℃ for 15 min. Then perform phenol / chloroform purification: add 115μL RNase-free H2O and 15μL 3M sodium acetate (pH 5.2) to 20 μL reaction mixture and mix well. Extract once with an equal volume of phenol / chloroform (1:1) and then extract twice with an equal volume of chloroform. Collect the supernatant and transfer it to a new RNase-free EP tube. Add 2 volumes of anhydrous ethanol to precipitate RNA. After mixing well, place at -20℃ for at least 30 minutes, centrifuge at maximum speed at 4℃ for 15 minutes, and collect the precipitate. Add 500 μL of 70% chilled ethanol to wash the RNA precipitate. Add DEPC water to dissolve the RNA and determine the RNA concentration using nanodrop.

[0072] 3. In vitro cleavage experiment of Cas12f mutant

[0073] ① Configure the Cas12f in vitro cleavage system according to the following table:

[0074]

[0075] Then add 4 μL 6× DNA loading and mix well. Run 1.5% agarose gel electrophoresis at 170V for 30 min. Image the gel under a gel imager. The cleavage effects of the three substrates are as follows: Figures 1-3 shown.

[0076] ② The grayscale analysis of substrate and cleavage product bands was performed using ImageJ and other software to calculate the cleavage efficiency. Cutting efficiency % = (grayscale value of cleavage substrate 1 + grayscale value of cleavage substrate 2) / (grayscale value of cleavage substrate 1 + grayscale value of cleavage substrate 2 + grayscale value of remaining substrate) × 100%, and the cleavage rate is shown in the following table. The mutant mutation site is designed to optimize the binding of sgRNA to dsDNA. Among them, MT1, MT2, MT3, MT6, MT7, and MT8 mutants significantly improved the cleavage activity, and the cleavage activity was increased by an average of more than 1.7 times compared with the wild type.

[0077]

[0078] The applicant declares that the present invention illustrates the detailed method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed method, that is, it does not mean that the present invention must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A Cas12f nuclease mutant, characterized in that The following proteins: A mutation is performed on the basis of the Cas12f nuclease whose amino acid sequence is shown in SEQ ID No. 2, and the mutation is S180R.

2. The Cas12f nuclease mutant according to claim 1, characterized in that Also included is a tag, which is used to separate, purify and / or track the functional domain, peptide or protein of the Cas12f nuclease.

3. The Cas12f nuclease mutant according to claim 2, characterized in that The tag is a His tag, a V5 tag, a FLAG tag, a HA tag, a Myc tag, a VSV-G tag, a Trx tag, a fluorescent protein, GST, HRP or luciferase.

4. the coding gene of the Cas12f nuclease mutant described in any one of claims 1-3.

5. an expression vector or a host bacteria of the Cas12f nuclease mutant according to any one of claims 1 to 3.

6. Application of the Cas12f nuclease mutant according to any one of claims 1 to 3 in in vitro gene editing.

7. A composition or kit, characterized in that A Cas12f nuclease mutant comprising the Cas12f nuclease mutant described in any one of claims 1 to 3.

8. A gene editing kit, characterized in that Containing the Cas12f nuclease mutant according to any one of claims 1 to 3 or the encoding gene according to claim 4.

9. A method for cutting a target nucleic acid, characterized in that The target nucleic acid is contacted with the Cas12f nuclease mutant of any one of claims 1 to 3, the composition of claim 7, or the kit.

Images