Method for increasing cell size, recombinant Escherichia coli and application of recombinant Escherichia coli

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a method for increasing the size of bacteria, recombinant escherichia coli and application of the recombinant escherichia coli. According to the present invention, the microbial cell morphology and the division mode are modified by regulating the microbial cell morphology related protein, such that the characteristics of the microbial cells are optimized so as to improve the application value of the microbial cells in the fields of biological manufacturing and the like. Specifically, escherichia coli with enhanced minE gene or weakened expression of any one or more of mreB, minC, minD, dacA and ftsZ genes is taken as a chassis strain, and the cell size is increased by heterologous expression of DivIVA. According to the invention, large-size cells which can be split, cultured and inherited are obtained, a larger production space is provided for producing some intracellular / extracellular products, the method can be applied to the production of various biomacromolecules, and a new solution is provided for enhancing the production efficiency of target products. Meanwhile, the increased cell morphology is beneficial to the processes of cell interception, adsorption, precipitation, product separation and the like, and the overall production efficiency is improved.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a method for increasing cell size, recombinant Escherichia coli and applications thereof. Background Art

[0002] Microorganisms are increasingly used as cell factories to produce high value-added products such as protein macromolecules and small molecule chemicals. Traditional methods to improve cell production efficiency include optimizing cell metabolic pathways, such as enhancing pathway gene expression, inactivating competitive inhibition pathways, or domesticating cell tolerance. There are few studies on enhancing production by regulating cell volume. On the other hand, studies have shown that cell volume and surface area can be increased by ultraviolet irradiation and other methods (Allison DP. Giant cells of Escherichia coli: a morphological study. J Bacteriol. 1971 Dec; 108 (3): 1390-401.), but this phenomenon may be a precursor to cell death and cannot divide and stably inherit. Manipulating genes related to cell morphology to control cell shape and division mode as a new strategy provides more possibilities for building efficient microbial cell factories. This change is divisible, culturable, and heritable. After morphological modification, the cell growth rate is increased, the volume is enlarged, and the surface area is increased. Due to easy sedimentation, the downstream separation process can also be simplified, which can improve production efficiency and reduce production costs.

[0003] At present, only a few genes such as mreB and ftsZ have been reported to improve the production of intracellular and extracellular products by modifying cell shape and division mode. It is necessary to further explore the rational application of more cell morphology-related genes. DivIVA is a membrane-bound protein and a member of the cell division-related system Min system. It can sense membrane curvature, recruit other proteins to the two poles and the division septum, and participate in the spatial regulation of bacterial septum formation. DivIVA is highly conserved in Gram-positive bacteria, participates in many different processes, and acts as a scaffold for proteins that need to be localized at the cell division site or cell pole. Heterologous expression of DivIVA in Escherichia coli can regulate cell growth physiological activities such as Escherichia coli cell division, chromosome separation, and cell wall synthesis. At present, most of the research on DivIVA focuses on the division mechanism rather than regulating cell size. Further application in the production of biomolecules has not been reported. There are no reports on the transformation of strains by combining other cell division-related genes, such as mreB, minC, minD, minE, ftsZ, dacA, etc.

[0004] Among them, the actin-like gene mreB is closely related to the enzyme that synthesizes the peptidoglycan layer of the cell. It participates in the maintenance of cell morphology by regulating the bacterial cell wall synthesis pathway. Studies have found that when mreB of rod-shaped bacteria such as Escherichia coli and Salmonella mutates, the cells become spherical. In Escherichia coli, the proteins of the Min system include MinC, MinD and MinE. MinC and MinD control the Z ring in the middle of the cell by preventing the FtsZ complex from assembling outside the middle of the cell. MinE is a negative regulator of minCD and has two functional domains. The N-terminal structure can specifically release the polymerization of minCD on the cell membrane, thereby inhibiting the function of minCD; the C-terminal domain can recognize the three potential division sites of the cell, control MinE in the middle of the cell, and limit the minCD complex to the two poles of the cell. In the case of inactivated minCD, the cell divides at the two poles and in the middle of the cell to form small cells without DNA; overexpression of the N-terminal domain of MinE can also promote the formation of small cells. Escherichia coli penicillin-binding protein 5 (PBP5) is a dd-carboxypeptidase encoded by the dacA gene that plays a key role in maintaining cell shape. Its functional loss leads to abnormal cell division, causing the cells to form small spherical cells and fibrous cells with small cells from the initial rod-shaped morphology. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a method for increasing cell size in view of the deficiencies of the prior art.

[0006] The technical problem that the present invention needs to solve is to provide a recombinant Escherichia coli with increased cell size.

[0007] The final technical problem to be solved by the present invention is to provide the application of the above-mentioned recombinant Escherichia coli in the fermentation production of biological macromolecules.

[0008] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0009] A method for increasing cell size, wherein the cell size in Escherichia coli is increased by heterologously expressing the cell division protein DivIVA in a chassis strain.

[0010] A recombinant Escherichia coli with increased cell size, characterized in that the chassis strain is constructed by heterologously expressing the cell division protein DivIVA.

[0011] The chassis strain is the original Escherichia coli, or the original Escherichia coli strain with enhanced expression of the topological specificity factor minE gene, or the original Escherichia coli strain with weakened expression of any one or several protein genes among the actin-like protein mreB, Z ring protein gene ftsZ, division factors minC, MinD or penicillin binding protein dacA.

[0012] Preferably, the chassis strain is Escherichia coli in which the expression of any one of the actin-like protein encoding gene mreB, the division factor minC and the penicillin binding protein gene dacA is weakened.

[0013] Wherein, the original Escherichia coli is any one of BL21 (DE3) wild bacteria or MG1655 (DE3) wild bacteria.

[0014] Preferably, the chassis strain is any one or a combination of BL21(DE3) wild bacteria, MG1655(DE3) wild bacteria, BL21(DE3)△minC, MG1655(DE3)△minC, BL21(DE3)△mreB, MG1655(DE3)△mreB, BL21(DE3)△dacA and MG1655(DE3)△dacA.

[0015] Among them, the BL21(DE3)△minC and MG1655(DE3)△minC strains are obtained by inactivating minC from BL21(DE3) wild bacteria and MG1655(DE3) wild bacteria, respectively; the BL21(DE3)△mreB and MG1655(DE3)△mreB strains are obtained by inactivating mreB from BL21(DE3) wild bacteria and MG1655(DE3) wild bacteria, respectively; the BL21(DE3)△dacA and MG1655(DE3)△dacA strains are obtained by inactivating dacA from BL21(DE3) wild bacteria and MG1655(DE3) wild bacteria, respectively.

[0016] The gene inactivation method is CRISPR / Cas9 editing technology ([1] Jiang, Y, et al., Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system[J]. or MUCICAT technology or λ-red homologous recombination technology ([2] Madyagor, M. et al., 2011. Gene replacement techniques for Escherichia coli genome modification[J].).

[0017] Among them, the cell division protein DivIVA has an amino acid sequence length as shown in SEQ ID NO.1, or a sequence with a sequence similarity of greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80% or greater than 90% to SEQID NO.1.

[0018] Wherein, the amino acid sequence shown in SEQ ID NO.1 is derived from Bacillus subtilis 168.

[0019] Preferably, the cell division protein DivIVA can be derived from any one of those listed in Table 1. In some embodiments of the present invention, the cell division protein DivIVA is an amino acid sequence as shown in SEQ ID NO.1, and the corresponding nucleotide sequence is as shown in SEQ ID NO.2.

[0020] Among them, the actin-like protein mreB has an amino acid sequence as shown in SEQ ID NO.3, and a corresponding nucleotide sequence as shown in SEQ ID NO.4; the cleavage factor minC has an amino acid sequence as shown in SEQ ID NO.5, and a corresponding nucleotide sequence as shown in SEQ ID NO.6; the penicillin-binding protein dacA has an amino acid sequence as shown in SEQ ID NO.7, and a corresponding nucleotide sequence as shown in SEQ ID NO.8; the cleavage factor minD is shown in SEQ ID NO.9, and a corresponding nucleotide sequence as shown in SEQ ID NO.10; the topological specific factor minE is shown in SEQ ID NO.11, and a corresponding nucleotide sequence as shown in SEQ ID NO.12; the Z ring protein gene ftsZ is shown in SEQ ID NO.13, and a corresponding nucleotide sequence as shown in SEQ ID NO.14.

[0021] Table 1 Sources of cell division protein DivIVA

[0022]

[0023] Among them, the heterologous expression of the cell division protein DivIVA is any one of the following two expression methods: Expression method 1: the cell division protein gene divIVA is transferred into Escherichia coli for expression by plasmid overexpression; Expression method 2: multi-copy genome integration expression of the cell division protein gene divIVA on the Escherichia coli genome.

[0024] Specifically, the first expression method is to construct the cell division protein gene divIVA into an overexpression plasmid after fusing EGFP through Linker, and then transform it into Escherichia coli for expression; the second expression method is to construct an integration fragment integrating the cell division protein gene divIVA and the lacI gene fragment into the first integration expression plasmid to obtain a recombinant plasmid, and then transform the recombinant plasmid and the second integration expression plasmid into Escherichia coli together.

[0025] Among them, in expression method 1, the overexpression plasmid includes but is not limited to pETDuet, pET28a, pACYCDuet, pCOLADuet and other plasmids. As long as the plasmid in the prior art can meet the expression of the divIVA gene in Escherichia coli, it is suitable for the present invention.

[0026] In some embodiments of the present invention, the overexpression plasmid is pETDuet or pET28a.

[0027] Among them, in the second expression method, the plasmid used for genome integration includes but is not limited to pQCasTns4array, pQCasTns 8array, pQCasTns dif8array, pDonor, pEcCas, pTarget and other plasmids. As long as the plasmid in the prior art can meet the requirements of integrating the divIVA gene into the Escherichia coli genome for expression, it is suitable for the present invention.

[0028] In some embodiments of the present invention, the integration expression plasmids are pDonor and pQCasTns 8array, specifically, pDonor is the first integration expression plasmid, and pQCasTns 8array is the second integration expression plasmid.

[0029] Wherein, the multi-copy genome is integrated and expressed, and the copy number thereof is 1 to 20 copies. In some embodiments of the present invention, the copy number thereof is 1 to 8 copies.

[0030] In some embodiments of the present invention, the morphology of strains overexpressing the divIVA gene was characterized by microscopic observation, and it was found that different strains exhibited different cell enlargement effects. The morphology of wild BL21 (DE3) and wild MG1655 (DE3) bacteria was mostly short rods with a length of 2 μm. After genetic engineering, the cells were enlarged, and the cell diameter was greater than 3 μm, greater than 4 μm, greater than 5 μm, greater than 6 μm, greater than 7 μm, greater than 8 μm, greater than 9 μm, greater than 10 μm, greater than 11 μm, greater than 12 μm, greater than 13 μm, greater than 14 μm, greater than 15 μm, greater than 16 μm, greater than 17 μm, greater than 18 μm, greater than 19 μm or greater than 20 μm. The enlarged cell morphology includes lengthening, widening, rounding, branching, and filamentous, snake-like, dumbbell-shaped, elliptical, spherical, and tadpole-shaped.

[0031] The method for constructing the above-mentioned recombinant Escherichia coli is also within the scope of protection of the present invention.

[0032] Before constructing the recombinant E. coli, firstly, the protein sequence of any desired cell division protein DivIVA is found from NCBI. For example, in some embodiments of the present invention, DivIVA is derived from Bacillus subtilis 168, and the sequence is shown in SEQ ID NO: 1. Then, according to the codon usage preference of E. coli, the nucleotide sequence of the cell division protein gene divIVA is codon optimized, the divIVA gene sequence is artificially synthesized in the pET28a plasmid, and then EGFP is fused to the N-terminus of divIVA, and a linker is added in the middle to obtain the recombinant plasmid pET28a-divIVA-EGFP.

[0033] In some embodiments of the present invention, the construction method is any one of the following two construction methods:

[0034] (I) The first construction method of recombinant Escherichia coli:

[0035] (1) Using pET28a-divIVA-EGFP plasmid as a template, amplify the divIVA-EGFP fragment;

[0036] (2) connecting the divIVA-EGFP fragment obtained in step (1) with the linearized vector pETDuet to screen and obtain the correct recombinant plasmid pETDuet-divIVA-EGFP;

[0037] (3) The recombinant plasmid obtained in step (2) is transformed into host Escherichia coli to obtain recombinant Escherichia coli expressing DivIVA.

[0038] (II) The second construction method of recombinant Escherichia coli:

[0039] This method integrates the codon-optimized divIVA gene fragment into the appropriate site on the reported genome, and integrates it into one or more meaningless sites in the Escherichia coli genome through MUCICAT gene editing technology ([3]Yang S, et al., Orthogonal CRISPR-associated transposases for parallel and multiplexed chromosomal integration[j].).

[0040] (I) Using pETDuet-divIVA-EGFP plasmid as template, divIVA+lacI gene fragment was obtained by PCR amplification;

[0041] (II) constructing the divIVA+lacI gene fragment obtained in step (I) between LE and RE of the pDonor plasmid to obtain the pDonor-divIVA-lacI plasmid;

[0042] (III) electroporating the pDonor-divIVA-lacI plasmid and the pQCasTns-8array plasmid constructed in step (II) into the host Escherichia coli, spreading them on a plate containing resistance and culturing until colonies grow;

[0043] (IV) After resuspending the colonies obtained in step (III), anhydrotetracycline was used to induce plasmid expression so as to simultaneously insert integration fragments into eight sites of the genome. Finally, colony PCR was used to verify and screen recombinant E. coli that had integrated 1 to 8 copies of divIVA.

[0044] Wherein, in step (III), the resistance contained includes kanamycin sulfate resistance and chloramphenicol resistance.

[0045] Wherein, in step (IV), the concentration of the anhydrotetracycline is 100 to 1000 ng / mL.

[0046] The application of the above recombinant E. coli in microbial fermentation is also within the scope of protection of the present invention. The main purpose of the application is to use the recombinant E. coli to improve the production efficiency of the microbial fermentation process.

[0047] The fermentation is shake flask fermentation, specifically, the recombinant Escherichia coli is cultured in LB medium to obtain seed liquid, and then the strain seed liquid is inoculated into the fermentation medium at a 2% v / v inoculation amount, and the culture is continued until the bacterial OD is 600 =0.6~0.8, then add IPTG to induce fermentation.

[0048] By manipulating various genes related to microbial morphology to change their shape, cells with enlarged size can be obtained. When the cell volume and surface area increase, the space that can accommodate intracellular biomolecules increases, and more space per unit biomass can be used to produce and accommodate intracellular products, thereby improving the production efficiency of intracellular biomacromolecules. Enlarged cells are easier to settle, which is conducive to new production processes such as cell retention, adsorption, precipitation, and product separation.

[0049] The enlarged cell size will make the enlarged cell longer, wider, rounder, and branched, and the cell morphology will be filamentous, snake-like, dumbbell-like, elliptical, spherical, or tadpole-like.

[0050] Wherein, the biological macromolecules include any one of nucleic acids, proteins, and intracellular polysaccharides.

[0051] Specifically, the nucleic acid includes any one or a combination of DNA, RNA or plasmid; the protein includes any one or a combination of green fluorescent protein, glucose dehydrogenase, xylose reductase, and cytidine deaminase; the polysaccharide includes any one or a combination of hyaluronic acid, starch, dextran, cellulose, oligosaccharides, and polysaccharides.

[0052] Furthermore, the DNA includes any one or a combination of double-stranded DNA, single-stranded DNA or oligonucleotide (oligo DNA), and the RNA includes any one or a combination of double-stranded RNA (dsRNA) or single-stranded RNA (ssRNA), such as any one or a combination of messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), hairpin RNA (hpRNA), interfering RNA (siRNA), and micro RNA (miRNA).

[0053] Specifically, the fluorescence intensity of green fluorescent protein was determined by taking the same volume and adding it to an ELISA plate, reading the result with an ELISA reader at an excitation wavelength of 485 nm and an emission wavelength of 526 nm, and then converting the result to the unit OD. 600 .

[0054] Specifically, the xylose reductase and glucose dehydrogenase unit enzyme activity is defined as: 1 mmol of NADH produced per milliliter of sample per minute is defined as one unit of enzyme activity. The determination method is: the fermentation broth is centrifuged to collect the cells, and the same OD is controlled. 600 After suspending in 10 mL PBS, ultrasonically disrupt the enzyme. The supernatant obtained by centrifugation after ultrasonic disruption is the crude enzyme solution. The corresponding substrate is added to the crude enzyme solution for reaction and then detected using a UV-visible spectrophotometer at 340 nm.

[0055] The fermentation medium is LB medium or TB medium; preferably, the TB medium is a phosphorus-reduced TB medium. If there is no special explanation, the fermentation medium is generally a phosphorus-reduced TB medium.

[0056] The LB medium has a formula of 5-15 g / L peptone, 1-5 g / L yeast powder, and 5-10 g / L sodium chloride; the TB medium has a formula of 5-15 g / L peptone, 5-30 g / L yeast powder, 5-15 g / L disodium hydrogen phosphate dodecahydrate, 1-5 g / L potassium dihydrogen phosphate, and 1-10 mL / L glycerol; the reduced phosphorus TB medium has a formula of 5-15 g / L peptone, 5-30 g / L yeast powder, 5-10 g / L disodium hydrogen phosphate dodecahydrate, 1-3 g / L potassium dihydrogen phosphate, and 1-10 mL / L glycerol.

[0057] Preferably, the LB medium has a formula of: 10 g / L peptone, 5 g / L yeast powder, and 10 g / L sodium chloride.

[0058] Preferably, the reduced-phosphate TB culture medium has a formula of: 12 g / L peptone, 24 g / L yeast powder, 9.4 g / L disodium hydrogen phosphate dodecahydrate, 2.2 g / L potassium dihydrogen phosphate, and 4 mL / L glycerol.

[0059] Wherein, the LB medium or reduced phosphorus TB medium includes 0.1-20 mM Mg 2+ , 0.1~2.0mM Ca 2+ , any one component or a combination of several components selected from the group consisting of 0.1% to 2% NaCl and 0.1 to 200 mM sorbitol.

[0060] Preferably, the LB medium or reduced-phosphate TB medium comprises any one component or a combination of several components selected from 1% to 2% NaCl and 60 to 160 mM sorbitol.

[0061] More preferably, the LB medium or the reduced-phosphate TB medium comprises 150 mM sorbitol.

[0062] The fermentation conditions are as follows: temperature 18-37°C, rotation speed 150-250 rpm, and when the OD 600 =0.6-0.8, add 0.01-2.0 mM isopropyl-β-D-thiogalactoside, and the total fermentation time is 8-72 h.

[0063] Preferably, the fermentation conditions are as follows: temperature 20°C, rotation speed 200 rpm, and when the OD 600 =0.6-0.8, add 0.2 mM isopropyl-β-D-thiogalactoside, and the total fermentation time is 24 h.

[0064] The present invention also performs cell physiological characterization on the strain overexpressing the divIVA gene, including determination of cell dry weight, total RNA, and total protein content.

[0065] Beneficial effects:

[0066] (1) The present invention can effectively increase the volume of Escherichia coli cells and the surface area of ​​single cells by enhancing the expression of divIVA, while causing changes in the total sugar and total protein contents, thereby providing a larger production space for the production of some intracellular or extracellular products and improving production efficiency.

[0067] (2) The present invention obtains Escherichia coli cells with various morphologies by strengthening the expression of divIVA and further strengthening minE, or weakening the expression of mreB, minC, minD, ftsZ or dacA, including cells that become longer, wider, rounder, branched, filamentous, snake-like, dumbbell-like, elliptical, spherical, and tadpole-like. A new cell morphology is constructed, and the enlarged cell morphology is conducive to new production processes such as cell retention, adsorption, precipitation, and product separation.

[0068] (3) The present invention provides an application for increasing the production of proteins, nucleic acids, and intracellular polysaccharides in recombinant Escherichia coli, which significantly increases the expression levels of intracellular RNA, fluorescent protein, glucose dehydrogenase, xylose reductase, and cytidine deaminase. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0070] Figure 1 This is the synthetic pET28a-divIVA-EGFP map, with a size of 6604 bp.

[0071] Figure 2 This is a partial picture of the strain morphology after MG1655(DE3) expressed divIVA.

[0072] Figure 3 The morphological diagram of the strains after expressing the divIVA gene in the BL21 (DE3) series and MG1655 (DE3) series strains.

[0073] Among them, A is the morphology of the wild bacteria expressing EGFP and expressing the divIVA gene fused to EGFP; B is the morphology of the wild bacteria with inactivated minC gene fused to EGFP and expressing the divIVA gene fused to EGFP; C is the morphology of the wild bacteria with inactivated mreB gene fused to EGFP and expressing the divIVA gene fused to EGFP; D is the morphology of the wild bacteria with inactivated dacA gene fused to EGFP and expressing the divIVA gene fused to EGFP; E is the strain morphology of MG1655 (DE3) at different fermentation times after expressing divIVA; F is the strain morphology of MG1655 (DE3) at different IPTG induction concentrations after expressing divIVA.

[0074] Figure 4 This is the plasmid map of pDonor-divIVA-lacI, a tool plasmid used to integrate divIVA into the genome, with a size of 5753 bp.

[0075] Figure 5 This is a gel image showing the nucleic acid verification of the integration of different copies of divIVA into the genomes of BL21(DE3), MG1655(DE3), BL21(DE3)△minC, MG1655(DE3)△minC, BL21(DE3)△mreB and MG1655(DE3)△mreB.

[0076] Figure 6 The bright field images of the inactivated mreB integrated divIVA strain observed under a microscope. A is a bright field image of the morphology of the BL21 (DE3) inactivated mreB integrated divIVA strain observed under a microscope; B is a bright field image of the morphology of the MG1655 (DE3) inactivated mreB integrated divIVA strain observed under a microscope.

[0077] Figure 7 OD after optimization of culture medium for BL21(DE3) inactivated mreB integrated divIVA strain 600 Determination results. BD1 and MD1 represent wild bacteria BL21(DE3) and MG1655(DE3), respectively; BD3 and MD3 represent inactivated mreB in BL21(DE3) and MG1655(DE3), respectively; BD6 and MD6 represent inactivated mreB in BL21(DE3) and MG1655(DE3) and further integration of divIVA gene.

[0078] Figure 8 The electron microscope images of the strain morphology after sorbitol was added to the culture medium. The left side is BD1, which is the wild strain BL21 (DE3); the right side is BD6, which is the BL21 (DE3) strain with inactivated mreB and integrated divIVA gene.

[0079] Fig. 9 OD of BL21(DE3) and MG1655(DE3) series recombinant strains 600 , cell dry weight and the ratio of the two. Among them, BD1 and MD1 are wild bacteria BL21(DE3) and MG1655(DE3), respectively; BD2 and MD2 are inactivated minC of BL21(DE3) and MG1655(DE3), respectively; BD3 and MD3 are inactivated mreB of BL21(DE3) and MG1655(DE3), respectively; BD4 and MD4 are integrated divIVA gene of BL21(DE3) and MG1655(DE3), respectively; BD5 and MD5 are inactivated minC and further integrated divIVA gene of BL21(DE3) and MG1655(DE3), respectively; BD6 and MD6 are inactivated mreB and further integrated divIVA gene of BL21(DE3) and MG1655(DE3), respectively.

[0080] Fig.10 The results of total RNA content determination of BL21(DE3) and MG1655(DE3) series strains are shown in Figure 1. BD1 and MD1 are wild strains BL21(DE3) and MG1655(DE3), respectively; BD2 and MD2 are inactivated minC of BL21(DE3) and MG1655(DE3), respectively; BD3 and MD3 are inactivated mreB of BL21(DE3) and MG1655(DE3), respectively; BD4 and MD4 are integrated divIVA genes of BL21(DE3) and MG1655(DE3), respectively; BD5 and MD5 are inactivated minC and further integrated divIVA genes of BL21(DE3) and MG1655(DE3), respectively; BD6 and MD6 are inactivated mreB and further integrated divIVA genes of BL21(DE3) and MG1655(DE3), respectively.

[0081] Fig.11The results of total protein content determination of BL21(DE3) series and MG1655(DE3) series recombinant strains are shown in Figure 1. BD1 and MD1 are wild strains BL21(DE3) and MG1655(DE3), respectively; BD2 and MD2 are inactivated minC of BL21(DE3) and MG1655(DE3), respectively; BD3 and MD3 are inactivated mreB of BL21(DE3) and MG1655(DE3), respectively; BD4 and MD4 are integrated divIVA gene of BL21(DE3) and MG1655(DE3), respectively; BD5 and MD5 are inactivated minC and further integrated divIVA gene of BL21(DE3) and MG1655(DE3), respectively; BD6 and MD6 are inactivated mreB and further integrated divIVA gene of BL21(DE3) and MG1655(DE3), respectively.

[0082] Fig.12 The average fluorescence intensity of BL21(DE3) and MG1655(DE3) series strains after expressing EGFP. Among them, BD7 and MD7 represent wild strains BL21(DE3) and MG1655(DE3) expressing EGFP, respectively; BD8 and MD8 represent BL21(DE3) and MG1655(DE3) expressing EGFP after inactivating minC, respectively; BD9 and MD9 represent BL21(DE3) and MG1655(DE3) expressing EGFP after inactivating mreB, respectively; BD10 and MD10 represent BL21(DE3) and MG1655(DE3) expressing EGFP after integrating divIVA gene, respectively; BD11 and MD11 represent BL21(DE3) and MG1655(DE3) expressing EGFP after inactivating minC and further integrating divIVA gene, respectively; BD12 and MD12 represent BL21(DE3) and MG1655(DE3) expressing EGFP after inactivating mreB and further integrating divIVA gene, respectively.

[0083] Fig.13These are the enzyme activity measurements of glucose dehydrogenase expressed by BL21(DE3) and MG1655(DE3) series strains. Among them, BD13 and MD13 were wild bacteria BL21(DE3) and MG1655(DE3) expressing glucose dehydrogenase, respectively; BD14 and MD14 were BL21(DE3) and MG1655(DE3) expressing glucose dehydrogenase by inactivating minC, respectively; BD15 and MD15 were BL21(DE3) and MG1655(DE3) expressing glucose dehydrogenase by inactivating mreB, respectively; BD16 and MD16 were BL21(DE3) and MG1655(DE3) expressing glucose dehydrogenase by integrating divIVA gene, respectively; BD17 and MD17 were BL21(DE3) and MG1655(DE3) expressing glucose dehydrogenase by inactivating minC and further integrating divIVA gene, respectively; BD18 and MD18 were BL21(DE3) and MG1655(DE3) expressing glucose dehydrogenase by inactivating mreB and further integrating divIVA gene, respectively.

[0084] Fig.14 These are the enzyme activity measurements of xylose reductase expressed by BL21(DE3) and MG1655(DE3) series strains. Among them, BD19 and MD19 are wild bacteria BL21(DE3) and MG1655(DE3) expressing xylose reductase, respectively; BD20 and MD20 are BL21(DE3) and MG1655(DE3) expressing xylose reductase by inactivating minC, respectively; BD21 and MD21 are BL21(DE3) and MG1655(DE3) expressing xylose reductase by inactivating mreB, respectively; BD22 and MD22 are BL21(DE3) and MG1655(DE3) integrating divIVA gene to express xylose reductase, respectively; BD23 and MD23 are BL21(DE3) and MG1655(DE3) expressing xylose reductase by inactivating minC and further integrating divIVA gene, respectively; BD24 and MD24 are BL21(DE3) and MG1655(DE3) expressing xylose reductase by inactivating mreB and further integrating divIVA gene, respectively.

[0085] Fig.15These are the enzyme activity measurements of cytidine deaminase expressed by BL21(DE3) and MG1655(DE3) series strains. BD25 and MD25 represent wild bacteria BL21(DE3) and MG1655(DE3) expressing cytidine deaminase, respectively; BD26 and MD26 represent BL21(DE3) and MG1655(DE3) expressing cytidine deaminase by inactivating minC, respectively; BD27 and MD27 represent BL21(DE3) and MG1655(DE3) expressing cytidine deaminase by inactivating mreB, respectively; BD28 and MD28 represent BL21(DE3) and MG1655(DE3) expressing cytidine deaminase by integrating divIVA gene, respectively; BD29 and MD29 represent BL21(DE3) and MG1655(DE3) expressing cytidine deaminase by inactivating minC and further integrating divIVA gene, respectively; BD30 and MD30 represent BL21(DE3) and MG1655(DE3) expressing cytidine deaminase by inactivating mreB and further integrating divIVA gene, respectively. DETAILED DESCRIPTION

[0086] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0087] In the following examples, the plasmids pQCasTns-8array and pDonor were donated by Professor Yang Sheng from the Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. Unless otherwise specified, all enzymes were purchased from TAKARA, the plasmid extraction and gel recovery kits were purchased from Tiangen, and the one-step cloning kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0088] In the following examples, the molecular biology experiments such as plasmid construction, enzyme digestion, competent cell preparation, and transformation were all performed in accordance with the Molecular Cloning Experiment Guide.

[0089] The E. coli used in the following examples are BL21 (DE3) and MG1655 (DE3). The recombinant bacteria involved are shown in Table 2, which are constructed using E. coli BL21 (DE3) and MG1655 (DE3) as the starting bacteria.

[0090] Table 2 List of strains

[0091]

[0092]

[0093] In the following examples, the software Snap Gene was used for primer design during the strain construction process, and the synthesis and sequencing of the relevant primer sequences were provided by General Corporation.

[0094] In the following embodiments and drawings of the specification, EGFP and GFP have the same meaning; divIVA and DivIVA have the same meaning.

[0095] Example 1 Inactivation of minC, mreB, dacA chassis construction

[0096] 1. Construction of Donor fragment

[0097] Taking the knockout of minC gene as an example, minC up-F / R and minC down-F / R were used to perform PCR on two E. coli genomes to amplify the sequences of about 500bp upstream and downstream of the minC gene, respectively. Then, minC up-F and minC down-R were used to connect the upstream and downstream homologous arms through overlap PCR to obtain the Donor DNA fragment. After verification by nucleic acid gel electrophoresis, the target fragment was gel-recovered using Takara's MiniBEST Agarose Gel DNA Extraction Kit according to the detailed steps provided to obtain the Donor fragment of the minC gene. The Donor fragment construction process of the mreB and dacA genes is the same as above. The primer sequences for constructing the corresponding Donor DNA are shown in Table 3.

[0098] Table 3 Primer sequences for constructing Donor DNA

[0099]

[0100] 2. Construction of mutant sgRNA

[0101] (1) First, search and determine the N20 sequences of the three genes to be knocked out on the CHOPCHOP website. Using the pTargetF plasmid as a template, design upstream and downstream primers containing the corresponding N20 sequences and perform reverse PCR. The upstream and downstream primer sequences corresponding to the N20 sequences are shown in Table 4.

[0102] Table 4 Upstream and downstream primer sequences corresponding to N20 sequence

[0103]

[0104] (2) After the PCR reaction is completed, use DpnI enzyme to digest the original template in the PCR product. The digestion system is: 10×QuickCut Buffer 2μL, QuickCut DpnI 2μL, PCR product 16μL, and place at 37℃ for 1h.

[0105] (3) Take out 10-20 μL of the product obtained after digestion in step (2), add it to 100 μL of E. coli Trans1-T1 competent cells, let it stand on ice for 30 minutes, then heat shock it in a 42°C water bath for 90 seconds, let it stand on ice again for 3-5 minutes, then add 1 mL of LB liquid culture medium to it, place it in a 37°C shaker, and resuscitate it at 200 rpm for 1 hour. After the recovery, spread it on a solid culture medium containing streptomycin resistance, and culture it in a 37°C incubator for 12 hours until it grows clones. Pick a single clone strain on the plate of the obtained clone, then culture it in a liquid culture medium, extract the plasmid, and send it for testing. The results show that the N20 sequence of the three genes shows mutations, indicating that the sgRNA of the three genes was successfully constructed.

[0106] 3. Gene knockout

[0107] (1) The constructed donor DNA of minC, mreB, and dacA genes and their corresponding sgRNA were added to the BL21(DE3)-pEcCas and MG1655(DE3)-pEcCas competent cells at a ratio of 5:1, and then placed on ice for 1 min;

[0108] (2) Transfer the liquid in step (1) to a pre-cooled 2 mm electric rotating cup and let it stand for 5 minutes;

[0109] (3) When knocking out the minC, mreC, and dacA genes, place the electroporation cup in an electroporator, adjust the voltage to 2500 V, and perform an electric shock for 5 to 6 ms. Immediately add 1 mL of LB liquid culture medium, then transfer it to a 1.5 mL centrifuge tube. After reviving at 37°C for 2 h, spread it on LB solid culture medium containing Kan resistance and Str resistance, and place it in a 37°C incubator until a monoclonal strain grows.

[0110] When knocking out the mreB gene, the LB liquid culture medium in step (3) needs to be replaced with a minimal medium (MM) culture medium, and when coating, the LB solid culture medium is also replaced with an MM solid culture medium containing kanamycin sulfate resistance and streptomycin resistance.

[0111] Among them, the formula of MM (Minimal Medium) culture medium is: 1g / L ammonium sulfate, 0.2g / L magnesium sulfate, 10g / L disodium hydrogen phosphate dodecahydrate, 1.5g / L potassium dihydrogen phosphate, and 4g / L glucose.

[0112] (4) After successful electroporation, the obtained strain was subjected to a colony PCR experiment. The sequences of the verification primers used in the PCR process are shown in Table 5. After the PCR amplification is completed, nucleic acid gel electrophoresis is first performed to confirm whether the size of the amplified product is consistent with the size of the DonorDNA fragment. If the electrophoresis results show that the fragment sizes are basically consistent, the PCR product is sequenced. After comparison of the sequencing results, if the sequencing is correct, it means that the target strain has been successfully obtained.

[0113] Table 5 Primer sequences used for verification

[0114] Primer 19 minC check-F CCTTGTAATGATTGTAAGTTTTCAGCGGC Primer 20 minC check-R CAATGAAGCGGAAAGGACGTTCTTC Primer 21 mreB check-F GGAAAATCTGGCGATTCAGGTTACC Primer 22 mreB check-R CACATCACCAACACGAATATCCGTATTC Primer 23 dacA check-F ATTCACCACTGTTTGCTCAAGC Primer 24 dacA check-R AACAACACCAAAGTTCGTATCG

[0115] 4. Plasmid loss

[0116] The obtained target strain was inoculated into LB liquid medium containing kanamycin sulfate resistance, and rhamnose with a final concentration of 10mM was added for induction for 8h, then streaked on LB solid medium containing sucrose, cultured overnight at 37°C, and single clones were picked and streaked on LB solid medium without resistance, LB solid medium containing kanamycin sulfate resistance, and LB solid medium containing streptomycin resistance. If the picked strain grows normally on LB solid medium without resistance, but cannot grow on LB solid medium containing specific resistance, the plasmid is successfully lost.

[0117] Finally, this example uses BL21(DE3) and MG1655(DE3) as the starting strains, and obtains the recombinant strains BL21(DE3)△minC, MG1655(DE3)△minC, BL21(DE3)△mreB, MG1655(DE3)△mreB, BL21(DE3)△dacA and MG1655(DE3)△dacA by knocking out the minC, mreB and dacA genes respectively.

[0118] Example 2 Construction of plasmid expression divIVA strain

[0119] 1. Linearization of pETDuet vector

[0120] The pETDuet plasmid was digested with NcoI and SalI. The reaction system is shown in Table 6. The digested product was verified by nucleic acid gel electrophoresis. If the size was confirmed to be correct, gel recovery was performed.

[0121] Table 6 Enzyme digestion reaction system

[0122] Overall reaction system 100μL QuickCut Buffer 10μL Quickcut NcoI 5μL Quickcut SalI 5μL pETDuet Plasmid 50μL <![CDATA[ddH2O]]> 30μL

[0123] 2. Construction of divIVA-EGFP fusion fragment

[0124] In order to facilitate the observation of cell morphology, EGFP was fused to the divIVA gene for expression. The divIVA-EGFP fragment was synthesized by Suzhou Jinweizhi Technology Biological Co., Ltd. First, the protein sequence of the cell division protein DivIVA from Bacillus subtilis 168 was found from NCBI, the sequence is shown in SEQ ID NO.1, and the corresponding nucleotide sequence is shown in SEQ ID NO.2. Then, according to the codon usage preference of Escherichia coli, the nucleotide sequence of the cell division protein gene divIVA was codon optimized, and the optimized nucleotide sequence is shown in SEQ ID NO.15.

[0125] Using pET28a as the plasmid backbone, the N-terminus of divIVA was fused to the C-terminus of EGFP, and a linker was used in the middle to connect them. The sequence of the linker was GGTGGTTCCGGCGGCTCCGGCGGTAGCGGTGGCTCA. Figure 1 ) was used as a template, PCR was performed using primers divIVA-F and EGFP-R in Table 7, and then the divIVA-EGFP fragment was recovered by gel recovery.

[0126] Table 7 DivIVA-EGFP fragment PCR primer list

[0127]

[0128] 3. Construction of pETDuet-divIVA-GFP recombinant plasmid

[0129] The linearized vector pETDuet and the divIVA-EGFP fusion fragment were assembled using a one-step cloning kit, and the system is shown in Table 8.

[0130] Table 8 One-step cloning and ligation system

[0131] Overall reaction system 10μL 2×Basic Assembly Mix 5μL pETDuet vector fragment (5-100ng) 1~4μL divIVA-EGFP insert (5-100ng) 1~4μL <![CDATA[ddH2O]]> up to 10μL

[0132] After reacting at 50°C for 15 minutes, the recombinant product was transformed, cultured overnight, and sent for testing after the transformants grew out, thereby obtaining the pETDuet-divIVA-EGFP recombinant plasmid.

[0133] 4. Construction of recombinant strains

[0134] The overexpression plasmid pET28a-divIVA-EGFP or pETDuet-divIVA-EGFP was electroporated into the chassis strains BL21(DE3), MG1655(DE3), BL21(DE3)△minC, MG1655(DE3)△minC, BL21(DE3)△mreB, MG1655(DE3)△mreB, BL21(DE3)△dacA and MG1655(DE3)△dacA to obtain the corresponding recombinant strains.

[0135] Example 3 Morphological observation of the recombinant strain overexpressing divIVA by plasmid

[0136] 1. Strain activation: Add 5 mL of LB liquid culture medium containing corresponding resistance into a 50 mL centrifuge tube, inoculate 10 μL of wild bacteria and glycerol bacteria preserved in glycerol in Example 2, respectively, and culture at 37° C. for 12 h.

[0137] 2. Strain expansion: Take 2% of the bacterial solution and transfer it to a 250mL baffled shake flask containing 50mL LB liquid medium or reduced-phosphate TB medium and culture it at 37℃.

[0138] 3. Induction: When the bacterial solution grows to OD 600 When the pH was about 0.6 to 0.8, 0.05 mM, 0.2 mM, 1 mM or 2 mM IPTG was added for induction, and cultured at 20°C for 12 h, 24 h or 48 h.

[0139] 4. Take an appropriate amount of bacterial solution and observe the morphology of the recombinant bacteria using a 100x fluorescence microscope.

[0140] In order to facilitate the observation of cell morphological changes, the embodiment shows the cell morphology of the fluorescent protein EGFP fused to DivIVA, and the fusion of EGFP does not additionally affect the cell morphology. The Escherichia coli cell morphology is short rod-shaped, and the size is usually 1.1-1.5 μm × 2.0-6.0 μm. The present invention has different effects of expressing divIVA with plasmids in different chassis strains. Overall, the shape of the bacteria is significantly changed, and the cell volume is increased, including the cells becoming longer, wider, rounder, and branched, showing filaments, snakes, dumbbells, ellipses, spheres, and tadpoles; cells with a length greater than 3 μm, greater than 4 μm, greater than 5 μm, greater than 6 μm, greater than 7 μm, greater than 8 μm, greater than 9 μm, greater than 10 μm, greater than 11 μm, greater than 12 μm, greater than 13 μm, greater than 14 μm, greater than 15 μm, greater than 16 μm, greater than 17 μm, greater than 18 μm, greater than 19 μm, or greater than 20 μm are obtained.

[0141] Figure 2 This is a partial picture of the strain morphology after MG1655 (DE3) expressed divIVA. Figure 3 As shown in A, after overexpression of divIVA with plasmid in wild-type BL21(DE3) and MG1655(DE3), one end of the cell was enlarged and the cell was significantly elongated, with the cell length reaching 8 to 15 μm. It was also observed that some cells could reach 16 μm, 18 μm, or even more than 20 μm in length. Figure 3 As shown in B, after minC was inactivated in BL21(DE3) and MG1655(DE3), the cells changed from short rods to fibers, and the cell length could reach more than 10 μm. After divIVA was further expressed by plasmid, the cells became longer as a whole and one end tended to be enlarged, and some cells even reached a length of more than 20 μm. Figure 3 As shown in C, the strain morphology of BL21(DE3) and MG1655(DE3) showed certain differences after the inactivation of mreB. After the inactivation of mreB in BL21(DE3), most of the cell morphology changed from short rods to small spheres with a diameter of less than 1 μm. However, after the divIVA gene was expressed by a plasmid, the cell volume increased and became small spheres with a diameter of about 2 μm. After the inactivation of mreB in MG1655(DE3), the short rod shape changed into spheres of different sizes. Among them, many cells became small spheres with a diameter of about 1 to 2 μm, but during the observation, some cells were found to become large spheres with a diameter of 4 μm, 6 μm, 8 μm or even 10 μm or more. After the expression of divIVA by plasmid, the cells became large spheres with a diameter of about 6 μm. At the same time, in different batches of experiments, it was observed that the diameter of some cells could reach 8 μm, 10 μm or even 15 μm or more. As shown in Figure 3 As shown in D, in BL21 (DE3) and MG1655 (DE3), the cell morphology did not change significantly after the inactivation of dacA, with some small spherical cells; after the expression of the divIVA gene, the cells were expanded into irregular shapes, some of which could reach 3μm and 4μm in diameter, and a small number of cells with diameters exceeding 5μm, 6μm, and even exceeding 10μm were also observed. In addition, during the sampling process, it was found that as the cells were expanded, the bacteria were easier to settle, which would facilitate the separation of downstream products.

[0142] Induction time and IPTG concentration also have a certain effect on cell morphology. Figure 3As shown in E, after the divIVA gene was expressed in MG1655 (DE3), the expression of DivIVA gradually accumulated and increased with the extension of the induction time, and the changes in cell morphology became more and more significant. The cells became longer, and the phenomenon of one end being stretched became more and more obvious, and the cell volume and surface area increased significantly. At 12h, it can be found that one end of the cell began to be stretched, with a length of about 5 to 10μm, and a small number of cells exceeded 10μm in length; at 24h, the cells were stretched more obviously, accompanied by the elongation of the cells, resembling "tadpoles", and the cell length could reach or even exceed 15μm. When the fermentation time was 48h, it could be observed within the field of view that the cells could be stretched very large at one end or in the middle, resembling "tadpoles", and the cell morphology could also be observed to be filamentous, with a length exceeding 15μm. When the fermentation time exceeded 48h, the cells became longer, reaching 25μm, 30μm, 40μm or more. As shown Figure 3 As shown in F, after the divIVA gene was expressed in BL21(DE3), the cell volume and surface area gradually increased with the increase of IPTG concentration.

[0143] Example 4 Genome multi-copy integration divIVA and stability test

[0144] 1. Construction of plasmid for integration of target fragment

[0145] (1) Construction of pDonor-divIVA-lacI plasmid

[0146] The donor fragment to be integrated is assembled between the LE and RE sequences of the pDonor plasmid. Specifically, using the pETDuet-divIVA-EGFP obtained in Example 3 as a template, the plasmid template is PCR-generated using primers P-lacI-RE-up / P-lacI-RE-down to obtain the divIVA+lacI fragment, and then the plasmid template is PCR-generated using primers P-T7-LE-up / P-T7-LE-down to obtain the T7 terminator fragment, and the pDonor plasmid is PCR-generated using primers p-LE-RE-up / p-LE-RE-down to obtain the vector fragment.

[0147] The fragments obtained above were subjected to nucleic acid gel verification. After the band size was correct, the gel was recovered. Finally, the gel-recovered products were connected and transformed. After obtaining the transformants, they were sequenced and verified. Finally, the pDonor-divIVA-lacI plasmid was obtained. The plasmid map of the plasmid is shown in Figure 4 The primers for constructing the pDonor-divIVA-lacI plasmid are shown in Table 9.

[0148] Table 9 Primer list for pDonor-divIVA-lacI plasmid construction

[0149]

[0150] (2) Extraction of pQCasTns-8array plasmid

[0151] Take 10 μL of glycerol containing pQCasTns-8array strain and inoculate it into 5mL LB liquid medium and add kanamycin resistance and culture it at 37℃ for 12h; after the culture is completed, divide the bacterial liquid into 2mL centrifuge tubes and centrifuge at 8000rpm for 2min to collect the bacteria. Next, follow the detailed steps in the instructions of the plasmid DNA mini kit provided by Takara to perform plasmid extraction to obtain the pQCasTns-8array plasmid.

[0152] 2. The pDonor-divIVA-lacI plasmid and pQCasTns-8array plasmid constructed in step 1 were electroporated into the competent cells of the prepared target strains (BL21(DE3), MG1655(DE3), BL21(DE3)△minC, MG1655(DE3)△minC, BL21(DE3)△mreB, MG1655(DE3)△mreB), spread on plates containing kanamycin sulfate resistance and chloramphenicol resistance, and cultured in a 37°C incubator for 16 hours until colonies grow.

[0153] 3. Scrape off hundreds of colonies from the cultured plates and resuspend them in fresh LB liquid medium. Then induce them on LB solid medium containing kanamycin sulfate resistance, chloramphenicol resistance and 100 ng / mL dehydrotetracycline. Place them in a 37°C incubator and wait for colonies to grow.

[0154] 4. Scrape the colonies grown on the plate and resuspend them in LB liquid culture medium, then induce them in LB solid culture medium containing kanamycin sulfate resistance, chloramphenicol resistance and 1000 ng / mL dehydrotetracycline, and culture at 37°C until a single colony grows.

[0155] 5. Pick a single colony for colony PCR verification of its copy number determination. The verification primer name and sequence are shown in Table 10.

[0156] Table 10 Genome multi-copy integration divIVA verification primers

[0157]

[0158]

[0159] 6. Elimination of pDonor plasmid and pQCasTns plasmid

[0160] (1) Prepare the strains to be plasmid-lost into competent cells respectively, then electroporate 300 ng of pFree plasmid into competent cells, resuscitate in LB liquid medium at 37°C for 2 h, spread on solid medium containing bleomycin resistance, and culture in a 30°C incubator;

[0161] (2) After transformants grow on the plate, they are inoculated into LB liquid medium (with 2 g / L rhamnose, 200 ng / mL anhydrotetracycline, and 50 μg / mL bleomycin) for induction and cultured overnight at 30°C;

[0162] (3) Streak the cultured bacterial liquid on antibiotic-free LB solid medium and culture it at 37°C overnight;

[0163] (4) Single clones were selected and streaked on solid culture media containing kanamycin sulfate resistance, chloramphenicol resistance, bleomycin resistance, and no resistance at all. The single clones that did not grow on the solid culture media containing the three resistances but grew on the solid culture media without resistance were the strains that had successfully lost the plasmid.

[0164] After colony PCR verification and copy number determination, the results were as follows Figure 5 As shown: Starting from BL21(DE3), genome-integrated strains with 3, 4, 6 and 7 copies of divIVA were obtained, and starting from MG1655(DE3), genome-integrated strains with 2, 4, 5, 6 and 7 copies of divIVA were obtained; starting from BL21(DE3)△minC, genome-integrated strains with 3, 4, 6, 7 and 8 copies of divIVA were obtained, and starting from MG1655(DE3)△minC, genome-integrated strains with 2, 5, 7 and 8 copies of divIVA were obtained; starting from BL21(DE3)△mreB, genome-integrated strains with 1 to 7 copies of divIVA were obtained; starting from MG1655(DE3)△mreB, genome-integrated strains with 3 to 6 copies of divIVA were obtained.

[0165] Taking the genome integration strain of BL21(DE3)△mreB with 7 copies of divIVA and the genome integration strain of MG1655(DE3)△mreB with 6 copies of divIVA as examples, single clone strains were picked on the plate for activation culture, and then transferred to a 50mL centrifuge tube containing 5mL LB liquid culture medium and placed on a 37℃ shaker for subculture, and cultured for a total of 120h (10 generations). After that, PCR was performed on the bacterial liquid of each generation to see if its copy number changed, so as to verify its stability in the genome. The results showed that the copy number of the integrated gene in the genome of the two strains did not change, which shows that the integration of divIVA in the genome has high stability.

[0166] Example 5 Integration of divIVA strain growth ability determination and morphological observation

[0167] (1) Verify the effect of different copies of divIVA genome integration strains on cell growth ability

[0168] In order to verify the effect of different copies of divIVA genome integration strains on cell growth ability, shake flask fermentation experiments were performed on the obtained strains to observe their cell growth ability and cell morphology changes. Specifically, the strains were cultured in LB liquid medium at 37°C. When OD 600 When the pH value reached 0.6-0.8, 0.2 mM IPTG was added for induction, and the fermentation temperature was adjusted to 20°C. The fermentation time was 24 h, and the rotation speed was 200 rpm. After the fermentation, the cell OD 600 The results showed that there were differences in the growth of different single colonies. In addition, after 24 hours of fermentation, the OD value of the cell was 600 The strains with better growth were further selected from the single colonies of each strain for characterization.

[0169] The strains with good growth conditions were examined under a microscope to observe the morphological changes ( Figure 6 ), the results showed that when divIVA was integrated into the genome of the BL21(DE3)△mreB strain, the cells were spherical when the copy number was 1, 3, 6, and 7; when the copy number was 2, 4, and 5, the cells were relatively large spherical; when the divIVA gene was integrated into the MG1655(DE3)△mreB chassis, large spherical cells with a diameter of about 5 to 6μm were observed, and a few cells even had a diameter of more than 10μm. After integrating divIVA into the genomes of these four chassis, BL21(DE3), MG1655(DE3), BL21(DE3)△minC, and MG1655(DE3)△minC, the cells showed the same effect as expressing divIVA on the plasmid, with one end of the cell or the middle of the cell being enlarged, and the cell becoming longer, reaching 3μm, 4μm, 5μm, 6μm, 7μm, 8μm, and even more than 10μm in length. During the sampling process, it was found that the modified strain was easier to settle and easier to separate the bacteria from the fermentation broth.

[0170] (2) Verify the effect of culture medium containing different osmotic pressure regulating components on the growth ability of strain cells

[0171] Because knocking out the mreB gene makes the cell wall more fragile, different components were added to the culture medium to adjust the cell osmotic pressure and further characterize the cell growth. The specific process is as follows: LB medium and reduced-phosphate TB medium were used as fermentation medium, and different concentrations of Mg were added to LB medium and reduced-phosphate TB medium. 2+ , Ca 2+ , NaCl, sorbitol, etc. to regulate the osmotic pressure of cells. 2+ The concentration is 0.1~20mM, Ca 2+ The concentration was 0.1-2.0 mM, the NaCl concentration was 0.1%-2%, and the sorbitol concentration was 0.1-200 mM. The results showed that the addition of NaCl and sorbitol had a certain promoting effect on the growth of the BL21 (DE3) series of strains. Among them, the addition of 150 mM sorbitol can make the cell morphology more uniform, and also promote cell growth to a certain extent. Taking the BL21 (DE3) △ mreB integrated with 7 copies of divIVA as an example, the concentration gradient and OD 600 Growth rate as Figure 7 As shown in the figure, it can be seen that the growth ability of the strain decreased slightly after mreB was inactivated in BL21(DE3), and the growth ability of the strain decreased significantly after mreB was inactivated and then divIVA was expressed. After the medium was optimized, 1% NaCl was added to the reduced phosphorus TB medium, and the strain OD 600 The value increased by 157% compared with that in the culture medium with reduced phosphorus TB; adding 150mM sorbitol to the LB medium also played a good role, and the OD 600 The value increased by 91% compared with that in LB medium. For the MG1655 series strains, their growth ability was always weak and did not show a significant change. The electron microscopy image of the strain morphology after adding sorbitol to the medium is shown in Figure 8 As shown, it can be seen that the cell morphology becomes larger and more uniform compared to the wild-type strain.

[0172] Example 6 Determination of dry weight of recombinant strain cells

[0173] The BL21(DE3) and MG1655(DE3) strains were fermented in shake flasks. After the fermentation, the cell OD 600 The specific process is as follows: the culture medium is set as LB liquid culture medium, the fermentation temperature is set at 20°C, when the strain grows to about 0.6-0.8, add IPTG with an induction concentration of 0.2mM, the total fermentation time is 24h, and the rotation speed is 200rpm. After the fermentation is completed, the cell OD 600The dry cell weight (DCW) was measured. Specifically, 10 mL of the fermented bacterial solution was poured into a 50 mL centrifuge tube with a measured weight, centrifuged at 8000 rpm for 10 min, the supernatant was discarded, washed with pure water 3 times, and then placed in a freeze dryer for vacuum freeze drying and weighed again.

[0174] The experimental results are as follows Fig. 9 As shown, the OD of the strains 600 The value was positively correlated with the cell dry weight as a whole. After the divIVA gene was integrated into the genome of the BL21(DE3) series recombinant strains, the cell growth ability was weakened. By comparing the cell dry weight and OD 600 The ratio of the recombinant strains to the wild strains was not much different. In the MG1655 (DE3) series of recombinant strains, the cell dry weight and OD 600 The ratio was improved by 34% compared with that of MG1655 (DE3) strain.

[0175] Example 7 Determination of total RNA content in recombinant strain cells

[0176] The total RNA was extracted using the FastPure Complex Cell / Tissue Total RNA Isolation Kit from Novagen. The specific steps are as follows:

[0177] (1) Suspended cells: Take 500 μL of sample and centrifuge it at 2300 rpm for 5 min at 4°C to collect the cell pellet, then add 500 μL of Buffer SRL to lyse the cell pellet and vortex until there are no obvious cell clusters. Then add 100 μL of RNase-free ddH2O to the above lysate and vortex thoroughly to mix;

[0178] (2) RNA extraction: Extract according to the kit steps;

[0179] (3) Concentration determination: The concentration of the extracted RNA was measured using an ultra-micro spectrophotometer. The results were as follows: Fig.10 As shown;

[0180] (4) Nucleic acid gel verification: Nucleic acid gel verification was performed on the extracted total RNA.

[0181] The results are as follows Fig.10 As shown, in the BL21(DE3) series of strains, the strain unit OD 600The RNA content of all strains increased. After the integration and expression of the divIVA gene from BL21(DE3), it increased by 259%; after the inactivation of minC from BL21(DE3), it increased by 40%, and after further integration of the divIVA gene, it increased by 171%; after the inactivation of the mreB gene from BL21(DE3), it increased by 112%, and after further integration of the divIVA gene on this basis, it increased by more than 68%. The total RNA content of the bacteria in the fermentation broth of some strains was also increased. After the integration and expression of the divIVA gene from BL21(DE3), it increased by 22%; after the inactivation of the mreB gene from BL21(DE3), it increased by 22% after further integration of divIVA. The culture medium was optimized, and the total RNA content increased by 28% after adding 1% NaCl. In the MG1655(DE3) series of strains, some strains had a unit OD 600 The RNA content of MG1655(DE3) increased by 112% after integrating and expressing the divIVA gene; the inactivation of minC and further integration of the divIVA gene increased by 112%; the inactivation of mreB gene and 132% after MG1655(DE3) increased by more than 10 times after further integration of the divIVA gene. The total RNA content of the bacteria in the fermentation broth also increased by 83% after integrating and expressing the divIVA gene in MG1655(DE3); the inactivation of minC gene and 25% after MG1655(DE3) increased by 61% after further integration of the divIVA gene; the inactivation of mreB gene and 105% after MG1655(DE3) increased by 105%. In the chassis of MG1655(DE3) with inactivated mreB, the total RNA content per unit volume increased from 38μg / mL of the wild strain to 80μg / mL.

[0182] Example 8 Determination of total protein content in recombinant strain cells

[0183] The shake flask fermentation experiment was carried out with the BL21 (DE3) series strains. The shake flask fermentation conditions were as follows: when the strain grew to about 0.6-0.8, 0.2mM IPTG was added for induction, the rotation speed was 200rpm, the fermentation temperature was 20℃, and the total fermentation time was 24h. After the fermentation was completed, 40mL of the fermentation liquid was taken into a 50mL centrifuge tube and centrifuged at 13000g for 10min. After the centrifugation, the supernatant was removed, and pure water was added to mix by blowing and suction, and all the strains were diluted to OD 600 The diluted bacterial solution was then disrupted and the protein concentration was determined using Coomassie Brilliant Blue.

[0184] (1) Prepare a standard protein solution: weigh 10 mg of bovine serum albumin, dissolve it in pure water and dilute to 100 mL to prepare a 0.1 mg / mL bovine serum albumin stock solution;

[0185] (2) Preparation of Coomassie Brilliant Blue G-250 protein reagent: 100 mg of Coomassie Brilliant Blue G-250 was dissolved in 50 mL of 95% ethanol, 100 mL of 85% (m / v) phosphoric acid was added, and the volume was adjusted to 1000 mL with pure water;

[0186] (3) Determine the standard curve;

[0187] (4) Test the protein concentration in the disrupted liquid.

[0188] The results are as follows Fig.11 As shown, the transformed strain unit OD 600 In the BL21(DE3) series of strains, the minC gene was inactivated per OD 600 The total protein concentration of the bacteria increased by 9%; the inactivated mreB gene per OD 600 The total protein concentration of the bacteria increased by 29%. After integrating the divIVA gene into the BL21 (DE3) strain, the unit OD 600 The total protein concentration of the bacteria increased by 39%; starting from the BL21 (DE3) strain, minC was inactivated and then the divIVA gene unit was further integrated. 600 The total protein concentration of the bacteria increased by 39%; after inactivating mreB and further integrating the divIVA gene in the BL21 (DE3) strain, the unit OD 600 The total protein concentration of the bacteria increased by 39%. After optimizing the culture medium, the LB medium was used and sorbitol was added to further optimize the culture medium. The OD of the strain with inactivated mreB and integrated divIVA was 600 The total protein concentration of the bacteria increased by 53% and 63% respectively, with better results. In the MG1655 (DE3) series of strains, the minC gene was inactivated per OD 600 The total protein concentration of the bacteria increased by 31%; the inactivated mreB gene per OD 600 The total protein concentration of the bacteria increased by 76%. After integrating the divIVA gene into the MG1655 (DE3) strain, the unit OD 600 The total protein concentration of the bacteria increased by 53%; after inactivating minC and further integrating the divIVA gene in the MG1655 (DE3) strain, the unit OD 600 The total protein concentration of the bacteria increased by 63%; after inactivating mreB and further integrating the divIVA gene in the MG1655 (DE3) strain, the unit OD 600The total protein concentration of the bacteria increased by 65%. The culture medium was optimized by adding 1% NaCl to the TB medium or switching to LB medium. The unit OD of the strain with inactivated mreB and integrated divIVA was 600 The total bacterial protein concentration increased by 157% and 160% respectively.

[0189] The above results show that the unit OD 600 The increase in total bacterial protein concentration indicates that the cells are more conducive to the expression and production of target proteins.

[0190] Example 9 Application of recombinant strain expressing green fluorescent protein

[0191] Enhanced Green Fluorescent Protein (EGFP) was used as a basic protein. EGFP was expressed in BL21 (DE3) and MG1655 (DE3) strains with pET28a plasmids, and then shake flask fermentation was performed. When the strain grew to 0.6-0.8, 0.2 mM IPTG was added for induction and cultured at 20°C for 24 h. The fermentation broth OD was measured. 600 After the value is obtained, take the same volume and add it to the ELISA plate. Read the value with an ELISA reader at an excitation wavelength of 485 nm and an emission wavelength of 526 nm. Finally, convert it to the unit OD. 600 .

[0192] The results are as follows Fig.12 As shown, the unit OD of the transformed strain per unit volume 600 The fluorescence intensity of the wild strains increased. In the BL21 (DE3) series of strains, the fluorescence intensity increased by 11% after the inactivation of minC in the wild strain BL21 (DE3); the fluorescence intensity increased by 46% after the integration of the divlVA gene. The fluorescence intensity increased by 97% after the inactivation of minC and 45% after the inactivation of mreB. After the addition of 1% NaCl to the culture medium for optimization, the fluorescence intensity increased by 101%. In the MG1655 (DE3) series of strains, the fluorescence intensity increased by 11% after the inactivation of minC in the wild strain MG1655 (DE3); the fluorescence intensity increased by 188% after the integration of the divlVA gene; the fluorescence intensity increased by 222% after the inactivation of minC and the enzyme activity increased by 61% after the inactivation of mreB.

[0193] Example 10 Application of recombinant strain expressing glucose dehydrogenase

[0194] Definition of enzyme activity: One unit of enzyme activity is defined as 1 mmol of NADH produced per minute per milliliter of crude enzyme solution.

[0195] The recombinant strains expressing glucose dehydrogenase of BL21 (DE3) and MG1655 (DE3) were fermented, and the fermentation liquid was taken to measure OD after the fermentation was completed. 600 Then the fermentation broth was centrifuged to collect the cells and suspended in 10 mL PBS to control the OD 600 After the mixture is consistent, ultrasonic crushing is performed, and the crude enzyme solution is obtained after crushing. The reaction is carried out according to the reaction system in Table 11, and after the reaction is completed, the enzyme activity of glucose dehydrogenase is detected at 340 nm using an ultraviolet-visible spectrophotometer.

[0196] Table 11 Glucose dehydrogenase enzyme activity assay system

[0197] name volume Glucose dehydrogenase crude enzyme solution 10~100μL Glucose (1M) 400μL <![CDATA[NADP + (10mM)]]> 200μL Tris-HCl (100 mM PH = 7.4) To 3mL

[0198] The results of the test are as follows Fig.13 As shown, when glucose dehydrogenase is expressed, the transformed strain has a unit OD per unit volume. 600 The enzyme activity of the wild strains increased. In the BL21 (DE3) series of strains, the enzyme activity increased by 61% after minC was inactivated, and the enzyme activity increased by 104% after mreB was inactivated; the enzyme activity increased by 60% after the divlVA gene was integrated. The enzyme activity increased by 141% after the inactivation of minC, and the enzyme activity increased by 45% after the inactivation of mreB. After the addition of 1% NaCl to the culture medium for optimization, the enzyme activity increased by 58%. In the MG1655 (DE3) series of strains, the enzyme activity increased by 11% after minC was inactivated, and the enzyme activity increased by 31% after the inactivation of mreB. After the inactivation of minC and the integration of divlVA, the enzyme activity increased by 41%, and the enzyme activity increased by 45% after the inactivation of mreB. After the addition of 1% NaCl to the culture medium for optimization, the enzyme activity increased by 50%.

[0199] Example 11 Application of recombinant strain expressing xylose reductase

[0200] Definition of enzyme activity: One unit of enzyme activity is defined as 1 mmol of NADH produced per minute per milliliter of crude enzyme solution.

[0201] The recombinant strains expressing xylose reductase of BL21 (DE3) and MG1655 (DE3) strains were fermented. After the fermentation was completed, the fermentation liquid was taken to measure the OD 600 Then the fermentation broth was centrifuged to collect the cells and suspended in 10 mL PBS to control the OD600 After the consistency, ultrasonic crushing was performed, and the crude enzyme solution was obtained after crushing. The reaction was carried out according to the reaction system in Table 12, and after the reaction was completed, the enzyme activity of xylose reductase was detected at 340 nm using a UV-visible spectrophotometer.

[0202] Table 12 Xylose reductase enzyme activity assay system

[0203] name volume Xylose reductase 10~100μL Xylose(1M) 600μL NADPH (10mM) 100μL Tris-HCl (100 mM PH = 7.4) To 3mL

[0204] The results of the test are as follows Fig.14 As shown, when expressing xylose reductase, the enzyme activity levels of the two series of modified strains are basically the same as those of the wild strain. In the BL21 (DE3) series and MG1655 (DE3) series of strains, the enzyme activities after inactivating minC and further integrating the divlVA gene based on the wild strain were 31% and 53% respectively.

[0205] Example 12 Application of recombinant strain expressing cytidine deaminase

[0206] Enzyme activity definition: The amount of enzyme that converts 1 μmol of cytidine in 1 minute is defined as one unit of enzyme activity.

[0207] The BL21 (DE3) series strains and the MG1655 (DE3) series strains were transferred into the recombinant strains obtained by expressing the cytidine deaminase plasmid for fermentation. After the fermentation is completed, the fermentation broth is taken to measure the OD600 value, and then the fermentation broth is centrifuged to collect the bacteria, suspended with PBS, and ultrasonically broken at OD600 of 4. After the crushing, it is a crude enzyme solution. React according to the reaction system in Table 13. After the system is prepared, it is immediately placed in 37°C and shaker at 200rpm for reaction. After 5 minutes of reaction, 50μL is sampled and mixed with 50μL of methanol to terminate the reaction. After 5 minutes, centrifuge at 14000rpm for 20 minutes, and the supernatant is aspirated to detect the cytidine and uridine content using high performance liquid chromatography.

[0208] Table 13 Cytidine deaminase enzyme activity assay system

[0209] name volume Cytidine stock solution (0.1M) 100μL water 850μL Crude enzyme solution 50μL

[0210] The results of the test are as follows Fig.15 When cytidine deaminase is expressed, the transformed strain has a unit OD per unit volume. 600The enzyme activity of the wild strains increased compared with that of the wild strains. In the BL21 (DE3) series of strains, the enzyme activity increased by 91% after inactivating minC with the wild strain BL21 (DE3), and the inactivation of mreB significantly increased the enzyme activity by 297%; the enzyme activity increased by 60% after the integration of the divlVA gene. After the inactivation of minC and the integration of divlVA, the enzyme activity increased by 149%, and after the inactivation of mreB and the integration of divlVA, the enzyme activity increased by 130%. In the MG1655 (DE3) series of strains, the enzyme activity increased by 72% after the inactivation of minC with the wild strain MG1655 (DE3), and the enzyme activity increased by 70% after the inactivation of mreB; the enzyme activity increased by 63% after the integration of the divlVA gene. After the inactivation of minC and the integration of divlVA, the enzyme activity increased by 97%, and after the inactivation of mreB and the integration of divlVA, the enzyme activity increased by 34%.

[0211] The present invention provides a method for increasing cell size, a recombinant Escherichia coli and a method for its application. There are many methods and approaches to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A method for increasing cell size, characterized in that: The cell size of the chassis strain was increased by heterologously expressing the cell division protein DivIVA; The chassis strain is an Escherichia coli with enhanced topology-specific factor minE gene or weakened expression of any one or several protein genes among actin-like protein mreB, division factors minC, minD, penicillin-binding protein dacA, and Z ring protein gene ftsZ.

2. A recombinant Escherichia coli with increased cell size, characterized in that: The chassis strain was constructed by heterologously expressing the cell division protein DivIVA; The chassis strain is an Escherichia coli with enhanced topology-specific factor minE gene or weakened expression of any one or several protein genes among actin-like protein mreB, division factors minC, minD, penicillin-binding protein dacA, and Z ring protein gene ftsZ.

3. The method according to claim 1 or the recombinant Escherichia coli according to claim 2, characterized in that The cell division protein DivIVA has an amino acid sequence length as shown in SEQ ID NO.1, or a sequence with a sequence similarity of greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80% or greater than 90% to SEQ ID NO.

1.

4. The method according to claim 1 or the recombinant Escherichia coli according to claim 2, characterized in that The heterologous expression of the cell division protein DivIVA is any one of the following two expression modes: Expression method 1: The cell division protein gene divIVA is transferred into Escherichia coli by overexpression of plasmid; Expression method 2: Multi-copy genome integration expression of the cell division protein gene divIVA in the Escherichia coli genome.

5. The method or recombinant Escherichia coli according to claim 4, characterized in that The first expression method is to construct the cell division protein gene divIVA into an overexpression plasmid after fusing EGFP through Linker, and then transform it into Escherichia coli for expression; the second expression method is to construct an integration fragment integrating the cell division protein gene divIVA and the lacI gene fragment into the first integration expression plasmid to obtain a recombinant plasmid, and then transform the recombinant plasmid and the second integration expression plasmid into Escherichia coli together.

6. The method or recombinant Escherichia coli according to claim 4, characterized in that The multi-copy genome is integrated and expressed, and the copy number thereof is 1 to 20 copies.

7. The method according to claim 1 or the recombinant Escherichia coli according to claim 2, characterized in that The cell size is increased to a length greater than 3 μm, greater than 4 μm, greater than 5 μm, greater than 6 μm, greater than 7 μm, greater than 8 μm, greater than 9 μm, greater than 10 μm, greater than 11 μm, greater than 12 μm, greater than 13 μm, greater than 14 μm, greater than 15 μm, greater than 16 μm, greater than 17 μm, greater than 18 μm, greater than 19 μm, or greater than 20 μm, and the enlarged cell morphology is filamentous, snake-like, dumbbell-shaped, elliptical, spherical, or tadpole-shaped.

8. Use of the recombinant Escherichia coli according to claim 2 in the fermentation production of biomacromolecules, in, The biological macromolecules include any one of nucleic acids, proteins, and intracellular polysaccharides.

9. The use according to claim 8, characterized in that: The nucleic acid includes any one or a combination of DNA, RNA or plasmid; the protein includes any one or a combination of green fluorescent protein, glucose dehydrogenase, xylose reductase, and cytidine deaminase; the intracellular polysaccharide includes any one or a combination of hyaluronic acid, starch, dextran, cellulose, oligosaccharides, and polysaccharides.

10. The use according to claim 8, characterized in that: The fermentation medium is LB medium or TB medium; preferably, the TB medium is reduced-phosphate TB medium; Wherein, the LB medium or reduced phosphorus TB medium includes 0.1-20 mM Mg 2+ , 0.1~2.0mM Ca 2+ , any one component or a combination of several components selected from the group consisting of 0.1% to 2% NaCl and 0.1 to 200 mM sorbitol.

11. The use according to claim 10, characterized in that: The LB culture medium has a formula of 5-15 g / L peptone, 1-5 g / L yeast powder, and 5-10 g / L sodium chloride; the TB culture medium has a formula of 5-15 g / L peptone, 5-30 g / L yeast powder, 5-15 g / L disodium hydrogen phosphate dodecahydrate, 1-5 g / L potassium dihydrogen phosphate, and 1-10 mL / L glycerol; the reduced-phosphorus TB culture medium has a formula of 5-15 g / L peptone, 5-30 g / L yeast powder, 5-10 g / L disodium hydrogen phosphate dodecahydrate, 1-3 g / L potassium dihydrogen phosphate, and 1-10 mL / L glycerol.

12. The use according to claim 10, characterized in that: The LB medium or reduced-phosphate TB medium includes any one component or a combination of several components of 1% to 2% NaCl and 60 to 160 mM sorbitol.

13. The use according to claim 8, characterized in that: The fermentation conditions are as follows: temperature 18-37°C, rotation speed 150-250 rpm, and when the OD 600 =0.6-0.8, add 0.01-2.0 mM isopropyl-β-D-thiogalactoside, and the total fermentation time is 8-72 h.

Images