Method and kit for fusing genes through bifluorescence in-situ imaging

Abstract

The invention discloses a bifluorescence in-situ imaging fusion gene method and a kit, and belongs to the technical field of bioengineering, the kit comprises a first primer pair for detecting an e13a2 subtype, an amplification probe T1, an amplification probe T2, a molecular beacon probe MB1 and a molecular beacon probe MB2; the first primer pair is used for detecting the e14a2 subtype, the second primer pair is used for detecting the e14a2 subtype, and the amplification probe T1, the amplification probe T3, the molecular beacon probe MB1 and the molecular beacon probe MB3 are used for detecting the e14a2 subtype; the first primer pair comprises H1-1 and H2, and nucleotide sequences of the H1-1 and the H2 are respectively shown as SEQ ID NO.1-2; the second primer pair comprises H1-2 and H3, and the nucleotide sequences of the H1-2 and H3 are respectively shown as SEQ ID NO.3-4; the nucleotide sequences of the amplification probe T1, the amplification probe T2 and the amplification probe T3 are respectively as shown in SEQ ID NO.5-7; and the nucleotide sequences of the molecular beacon probes MB1, MB2 and MB3 are respectively as shown in SEQ ID NO.8 to SEQ ID NO.10. By means of the mode, in-situ imaging of the BCR / ABL P210 subtype can be achieved, and operation is easy, convenient and rapid; meanwhile, the quantity information of the residual tumor cells can be reflected, and the tumor cells which are as low as 0.01% can be detected.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a method and a kit for dual-fluorescence in-situ imaging of fusion genes. Background Art

[0002] Chronic myeloid leukemia (CML) is a myeloproliferative tumor formed by the fusion of the ABL gene on chromosome 9 of Abelson mice and the major breakpoint cluster region (BCR) gene on chromosome 22. The risk of death after diagnosis is 50%. There are three main types of BCR gene break locations: m-BCR, M-BCR and μ-BCR. The m-BCR region can be transcribed into e1a2 type mRNA; the M-BCR region can be transcribed into b2a2 or b3a2 type mRNA; the μ-BCR region can be transcribed into e19a2 type mRNA, which can transcribe the fusion proteins of P190, P210, and P230 respectively. More than 95% of CML patients express P210 protein, and tyrosine kinase inhibitors (TKI) are currently the main method for treating BCR / ABL P210. However, some patients have poor outcomes due to different P210 isoforms (such as e13a2, e14a2, and co-expressed forms derived from alternative splicing). For example, patients with the e13a2 subtype have lower transformation-free survival and event-free survival. A recent study found that in the treatment of e13a2, the second-generation TKI nilotinib replaced the first-generation TKI imatinib, and the treatment effect was better. Therefore, the identification of BCR / ABL P210 subtypes is crucial for the selection of first-line drugs and reducing mortality.

[0003] Existing technical solutions, such as qRT-PCR technology, can achieve highly sensitive quantitative detection of transcripts, with a minimum detection value of 10 copies / μL. However, the BCR / ABL IS value obtained through homogeneous transcript quantitative analysis cannot reflect the actual residual information of the number of cancer cells.

[0004] Existing technical solutions such as fluorescent in situ hybridization (FISH) can monitor BCR / ABL fusion gene cells and provide more direct information (such as BCR, ABL and BCR / ABL fusion genes); it can detect some tiny hidden BCR-ABL translocations and complex karyotypes. However, it can only detect large nucleic acid fragments, cannot yet achieve fusion gene subtype identification, and the detection is time-consuming.

[0005] Therefore, the present invention designs a method and a kit for rapid and accurate dual fluorescence in situ imaging of fusion genes directly on cells to solve the above problems. Summary of the invention

[0006] In view of the above-mentioned shortcomings of the prior art, the present invention provides a method and a kit for dual fluorescence in situ imaging of fusion genes.

[0007] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0008] A dual fluorescence in situ imaging fusion gene kit, comprising a first primer pair, amplification probe T1, amplification probe T2, molecular beacon probe MB1 and molecular beacon probe MB2 for detecting e13a2 subtype; a second primer pair, amplification probe T1, amplification probe T3, molecular beacon probe MB1 and molecular beacon probe MB3 for detecting e14a2 subtype;

[0009] The first primer pair includes H1-1 and H2, and the nucleotide sequences are shown in SEQ ID NO.1-2 respectively;

[0010] The second primer pair includes H1-2 and H3, and the nucleotide sequences are shown in SEQ ID NO.3-4 respectively;

[0011] The nucleotide sequences of amplification probes T1, T2 and T3 are shown in SEQ ID NOs. 5-7, respectively;

[0012] The nucleotide sequences of the molecular beacon probes MB1, MB2 and MB3 are shown in SEQ ID NOs. 8-10, respectively.

[0013] Furthermore, the excitation wavelength of FAM-labeled MB1 is 492 nm, and the fluorescence spectrum ranges from 500 to 600 nm.

[0014] Furthermore, the excitation wavelength of Cy3-labeled MB2 is 548 nm, and the fluorescence spectrum range is 558-650 nm.

[0015] Furthermore, the excitation wavelength of Cy5-labeled MB3 is 643 nm, and the fluorescence spectrum range is 650-750 nm.

[0016] A method for dual fluorescence in situ imaging of fusion genes comprises the steps of:

[0017] Step (1), reacting e13a2 mRNA with H1-1 and H2 of the first primer pair, and reacting e14a2 mRNA with H1-2 and H3 of the second primer pair, to obtain a first tube product and a second tube product, respectively;

[0018] Step (2), adding amplification probes T1 and T2 and amplification probes T1 and T3 to the first tube product and the second tube product, respectively, and obtaining a first PER amplification product and a second PER amplification product after reaction;

[0019] Step (3), adding molecular beacon probes MB1, MB2 and molecular beacon probes MB1, MB3 to the first PER amplification product and the second PER amplification product respectively, and detecting fluorescence after the reaction is completed.

[0020] Furthermore, in step (1), e13a2 mRNA is reacted with H1-1 and H2 of the first primer pair at 50°C for 30 min, and e14a2 mRNA is reacted with H1-2 and H3 of the second primer pair at 50°C for 30 min.

[0021] Furthermore, in step (2), the reaction temperature is 37° C. and the reaction time is 2 h.

[0022] Furthermore, in step (3), the reaction temperature is 37° C. and the reaction time is 30 min.

[0023] Furthermore, the specific steps are:

[0024] First, H1-1 and H2 of the first primer pair and H1-2 and H3 of the second primer pair were added to tube A containing e13a2 and tube B containing e14a2 respectively. The reaction conditions were: Reaction buffer and MgSO4, 50℃ for 30min;

[0025] After the reaction is completed, the amplification probes T1, T2, dA / T / CTP, hairpin removal G, and Bst DNA polymerase are added. Reaction buffer and PER reaction solution of MgSO4 were added into tube A respectively;

[0026] The amplification probes T1, T3, dA / T / CTP, hairpin removal G, and Bst DNA polymerase were added. Reaction buffer and PER reaction solution of MgSO4 were added into tube B respectively;

[0027] The PER reaction solutions were all reacted at 37°C for 2 h;

[0028] Finally, molecular beacon probes MB1 and MB2, and molecular beacon probes MB1 and MB3 were added to tube A and tube B, respectively, and reacted at 37°C for 30 minutes.

[0029] After the reaction is completed, the fluorescence of tube A and tube B is detected respectively.

[0030] Compared with the prior art, the present invention has the following beneficial effects: 1) the present invention can image BCR / ABLP210 subtypes in situ within 3.5 hours, which is simple and fast to operate compared with sequencing;

[0031] 2) The dual fluorescence detection strategy of BCR / ABL P210 subtypes of the present invention can reduce false positives caused by non-specific adsorption. For samples with fewer tumor cells, the influence of false positive cell rate on subsequent medication and monitoring can be reduced.

[0032] 3) The present invention can also reflect the amount of residual tumor cells and can detect tumor cells as low as 0.01%. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the prior art descriptions are briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention, and for ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0034] Figure 1 The experimental results are provided to verify the feasibility of in-situ dual PER;

[0035] Figure 2 The experimental results of the in situ dual PER in vitro reaction system are shown;

[0036] Figure 3 Schematic diagram of sequence design of signal probe MB before and after change;

[0037] Figure 4 The optimized conditions and sensitivity test results of in situ double PER;

[0038] Figure 5 In situ dual PER for cell imaging;

[0039] Figure 6 The results of the in situ double PER performance verification in cells;

[0040] Figure 7 Schematic diagram of primer exchange reaction (Proximity-induced Dual-Primer Exchange Reaction, PER).

[0041] Figure 8 It is the reaction principle diagram of the present invention. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0043] Embodiment 1: A kit for dual fluorescence in situ imaging of fusion genes, comprising a first primer pair, amplification probe T1, amplification probe T2, molecular beacon probe MB1 and molecular beacon probe MB2 for detecting e13a2 subtype; a second primer pair, amplification probe T1, amplification probe T3, molecular beacon probe MB1 and molecular beacon probe MB3 for detecting e14a2 subtype;

[0044] The first primer pair: specifically recognizes e13a2 mRNA, including:

[0045] H1-1:ATATATCAACCCGCAATGGTTAGTATGAAGCCCTTCAGCATACTAACCATT(SE Q ID No:1)

[0046] H2:ATATATCAACCCGCAATGGTTAGTATGAAGCCCTTCAGCATACTAACCATT(SEQ ID No:2)

[0047] The second primer pair: specifically recognizes e14a2 mRNA, including:

[0048] H1-2:TATATAACTCTCGAATGGTTAGTATGAAGCCCTTCAGCATACTAACCATT(SEQ ID No:3)

[0049] H3:TGGATTTAAGCAGAGTTCAAATACTAACCATTGGAGAGTTATATATAATTCATTTA TAACTCTC (SEQ ID No: 4)

[0050] The gene sequences of amplification probes T1, T2 and T3 are:

[0051] T1:ACTAACCATTGGGCCTTTTGGCCCAATGGTTAGTAATGGTTAG / iInvdT / (inverted T base, function: prevent non-specific extension at the 3' end) (SEQ ID No: 5)

[0052] T2:ATATCAACCCGGGCCTTTTGGCCCGGGTTGATATGGGTTGATA / iInvdT / (SEQ ID No:6)

[0053] T3:TATAACTCTCGGGCCTTTTGGCCCGAGAGTTATAGAGAGTTATA / iInvdT / (SEQ ID No:7)

[0054] The gene sequences of molecular beacon probes MB1, MB2 and MB3 are:

[0055] MB1:6'-FAM-AACCATTACTTTTTTTTTAGTAATGGTTAGTAATGGTT-BHQ1(SEQ ID No:8)

[0056] MB2:Cy3-TCAACCCATATTTTTTTTTATGGGTTGATATGGGTTGA-BHQ2(SEQ ID No:9)

[0057] MB3: Cy5-TAACTCTCTTTTTTTTTTAGAGAGTTATAGAGAGTTA-BHQ2 (SEQ ID No: 10).

[0058] Embodiment 2: A method for dual fluorescence in situ imaging of fusion genes, comprising the steps of:

[0059] Step (1), reacting e13a2 mRNA with H1-1 and H2 of the first primer pair at 50° C. for 30 min, and reacting e14a2 mRNA with H1-2 and H3 of the second primer pair at 50° C. for 30 min, to obtain a first tube product and a second tube product, respectively;

[0060] Step (2), adding amplification probes T1 and T2 and amplification probes T1 and T3 to the first tube product and the second tube product, respectively, reacting at 37° C. for 2 h to obtain the first PER amplification product and the second PER amplification product, respectively;

[0061] Step (3), adding molecular beacon probes MB1, MB2 and molecular beacon probes MB1, MB3 to the first PER amplification product and the second PER amplification product respectively, reacting at 37° C. for 30 min, and then detecting the corresponding fluorescence.

[0062] Please refer to the attached drawings of the instruction manual. Figure 7The process of the primer exchange reaction (Proximity-induced Dual-Primer Exchange Reaction, PER) is as follows: after the a and b sequences in the first primer pair are paired with the complementary paired amplification probes T1 and T2, under the catalysis of Bst DNA polymerase, the template synthesizes the primer sequences a and b at the 3' end of the primer and undergoes strand displacement activity. The obtained product can further use the primer part to pair with the hairpin template to generate a tandem sequence with a repeated primer part.

[0063] Please refer to the attached drawings of the instruction manual. Figure 8 The principle of PER reaction is as follows: in the case of e13a2, H1-1 and H2 are adjacent to e13a2, and react specifically within 30 minutes at 50°C to form a Y-shaped structure, thereby exposing their primer sequences. These three connectors are named proximity juction structures (PJS). Subsequently, the reaction components of PER, including Bst DNA polymerase, templates (T1 and T2), and hairpin removal G, are added to PJS, and the primers are extended at 37°C for 2 hours to form two tandem repeat sequences. The structure formed is called dual-track proximity juction structure (DT-PJS). Finally, the two tandem repeat sequences bind to molecular beacons (MB1 and MB2) with FAM and Cy3 fluorescent groups at 37°C, respectively, to restore green and red light. The detection of FAM and Cy3 dual fluorescence can prove the simultaneous presence of ABL and genes representing the e13a2 subtype, that is, the detection of the e13a2 subtype. Similarly, the dual fluorescence of FAM and Cy5 also proved the detection of e14a2 isoform.

[0064] Example 3: A research method for detecting BCR / ABLP210 subtypes, the specific steps include:

[0065] 1. Preparation of hairpin DNA: All DNA chains were dissolved in TE buffer. Hairpin DNA (H1-1, H1-2, H2, H3, T1, T2 and T3) and hairpin removal G (essentially a DNA hairpin, which can bind to the G base to achieve the purpose of removing G) were mixed in 1x TM buffer (10×10 -3 M Tris-HCl, 1 × 10 -3 M EDTA, 12.5 × 10 -3 Annealing was performed in 4% MgCl2 (M MgCl2, pH=8.0): 95°C for 5 min and then slowly cooled to room temperature. After annealing, all solutions were stored at -20°C for use.

[0066] The gene sequence of hairpin removal G is:

[0067] CCCCGAAAGTGGCCTCGGGCCTTTGGCCCGAGGCCACTTTCG (SEQ ID No: 13).

[0068] 2. In situ PER: First, H1-1 (200 nM) and H2 (200 nM), H1-2 (200 nM) and H3 (200 nM) were added to solutions containing different concentrations of e13a2 (tube A) and e14a2 (tube B), respectively. The reaction conditions were: Reaction buffer and 10mM MgSO4, react at 50℃ for 30min. After the reaction is completed, add T1 (40nM), T2 (40nM), dA / T / CTP (1.2mM, deoxyribonucleoside triphosphate), hairpin removal G (200nM), Bst DNA polymerase (40U / ml), Reaction buffer and 10 μL PER reaction solution containing 10 mM MgSO4 were added to tube A. T1 (40 nM), T3 (40 nM), dA / T / CTP (1.2 mM, deoxyribonucleoside triphosphate), hairpin removal G (200 nM), BstDNA polymerase (40 U / ml) were added. Reaction buffer and 10μL PER reaction solution with 10mM MgSO4 were added to tube B respectively. After mixing evenly, the reaction solution was reacted at 37℃ for 2h. Finally, MB1 (100nM) and MB2 (100nM), MB1 (100nM) and MB3 (100nM) were added to tube A and tube B respectively, and reacted at 37℃ for 30min. Among them, the excitation wavelength of MB1 labeled with FAM is 492nm, and the fluorescence spectrum range is 500-600nm; the excitation wavelength of MB2 labeled with Cy3 is 548nm, and the fluorescence spectrum range is 558-650nm; the excitation wavelength of MB3 labeled with Cy5 is 643nm, and the fluorescence spectrum range is 650-750nm. Finally, the fluorescence intensity of FAM and Cy3 in tube A was measured simultaneously with a fluorescence spectrophotometer, and the fluorescence intensity of FAM and Cy5 in tube B was measured.

[0069] 3. Native polyacrylamide gel electrophoresis (PAGE): In order to verify the feasibility of this scheme, the present invention conducted 12% PAGE in 1×TBE buffer (89mM Tris-boric acid, 2mMEDTA, pH8.3) and ran at a constant voltage of 110V for 1 hour to study the products and components of PER. After staining with Gel Red for 20 minutes at room temperature, the gel was imaged using a gel imaging system and an Uvidoc HD6 Touch Plus imaging system.

[0070] like Figure 1 As shown in B, e13a2 (lane 1) can hybridize with H1-1 (lane 2) and H2 (lane 3) to form PJS (lane 7, Figure 1 A), in preparation for subsequent PER, while H1-1 and H2 failed to hybridize without e13a2, because the present invention can observe two independent bands in lane 4. Subsequently, T1 (lane 8), T2 (lane 9), and a mixture of T1 and T2 (lane 11) were added to perform in situ PER. The ladder-shaped bands shown in lanes 8 and 9 ( Figure 1 B and Figure 1 C) The difference is small, indicating that in situ PER is feasible. However, the darker and longer ladder-shaped band observed in lane 11 ( Figure 1 D), indicating that more PER products were formed, thus supporting the feasibility of in situ dual PER. Figure 1 C also shows that the fluorescence intensity of the single PER involving T1 or T2 is not significantly different from that of the double PER, indicating that the double PER can be regarded as a superposition of two single PERs. In addition, it also emphasizes the importance of maintaining the integrity of the PER system, as evidenced by the absence of fluorescence in groups 4 to 7.

[0071] IV. Cell culture: Leukemia cell lines KCL22 and K562 expressing e13a2 and e14a2 mRNA, respectively, were cultured in DMEM and IMDM culture media supplemented with 10% FBS (fetal bovine serum) and 1% penicillin and streptomycin at 37°C and 5% CO2.

[0072] 5. Cell imaging of cultured cells: a cell culture with a density of 2.0×10 6KCL22 and K562 cells were fixed with a fixative (methanol:acetic acid = 3.1) at room temperature for 20 min. After fixation, the cells were permeabilized with 1×PBS containing 0.05% Triton-X 100 at 37°C for 5 min. Then, the cells were washed with 1×PBS at 37°C for 5 min. Then, H1-1 (1 μM), H2 (1 μM), H1-2 (1 μM), H3 (1 μM), Reaction buffer and 10mM MgSO4 were added to 10μL of the mixture and reacted at 50℃ for 1h. After the reaction, the cells were washed with 1×PBS for 5min. Then, 10μL of PER mixture, including T1 (1μM), T2 (1μM), T3 (1μM), dA / T / CTP (3mM), CG (200nM), Bst (800U / ml), Reaction buffer and 10 mM MgSO4 were incubated with cells at 37°C for 2 h. Finally, MB1 (300 nM), MB2 (300 nM) and MB3 (750 nM) were reacted with cells at 37°C for 30 min. After probe incubation, cells were stained with DAPI and then subjected to fluorescence imaging.

[0073] 6. Perform cell imaging on clinical samples: Use blood cell lysis buffer to lyse the blood of BCR / ABLp210 positive patients and BCR / ABLp210 negative patients.

[0074] Figure 1 The experimental results for the feasibility verification of in-situ double PER are as follows: Figure 2 This is the experimental result of the in situ dual PER in vitro reaction system. Figure 3 Schematic diagram of the sequence design of the signal probe MB before and after the change. In order to evaluate the in vitro detection ability of the in situ double PER, the present invention firstly carried out a series of tests using different concentrations of e13a2 and 500nM template. Figure 1 As shown in D, when the concentration of e13a2 is 100nM, the signal-to-noise ratio (S / N) of FAM and Cy3 increases significantly, while from 0.01nM to 10nM, the signal-to-noise ratio of FAM decreases relative to 0nM. In order to solve the problem of low signal output at low concentrations of e13a2, the present invention used different ratios of e13a2:H1-1:H2 (1:1:1, 1:2:2, 1:5:5, 1:10:10) under the same conditions to conduct experiments. However, the present invention found that with the increase of H1-1 and H2 concentrations, the specific fluorescence decreased and the nonspecific background fluorescence increased ( Figure 2AD). Excess free H1-1 and H2 may compete with the exposed primers for binding to T1, T2, and Bst, thereby reducing the number of PER products that can bind to MB, which in turn leads to the observed decrease in specific fluorescence. When the concentration of linear primers is half of the template concentration, the efficiency of PER reaches saturation. The results show that when the target concentration is maintained at 100nM, there is no obvious difference in the ladder bands between 50nM and 100nM templates (lanes 7 and 8, lanes 13 and 14) ( Figure 2 E). Therefore, when other reaction conditions remain unchanged, the present invention reduces the template to 50 nM, and observes that the minimum detection limit of e13a2 is reduced from 100 nM to 10 nM ( Figure 1 E). These findings suggest that a reduction in template concentration may improve the sensitivity of in situ dual PER. Subsequently, the present invention observed the difference between signal fluorescence and background fluorescence (ΔFI (F-F0) ) decreased from 50nM to 500nM template ( Figure 2 F) This result suggests that excess template may hinder the binding of MBs and PER products.

[0075] Since the concentration of the template cannot be further reduced, the present invention adjusts the structure of the molecular beacon probe MBs to promote its binding with the PER product. This adjustment helps to reduce the effect of excess template on the binding interaction between MBs and PER products ( Figure 3 ). Specifically, the unadjusted MBs are MB1a and MB2a, which are DNAs that form a complete hairpin structure; the adjusted MBs are MB1 and MB2, which have a foothold of several bases at their 3' end, and are incomplete hairpin DNA hairpin structures, which are more able to bind to PER products.

[0076] The gene sequences of the unadjusted molecular beacon probes MB1a and MB2a are:

[0077] MB1a:6'-FAM-AACCATTATTTTTTTTGGTTAGTAATGGTT-BHQ1(SEQ ID No:11)

[0078] MB2a: Cy3-AACCCATATTTTTTTGGGTTGATATGGGTT-BHQ2 (SEQ ID No: 12).

[0079] Therefore, if Figure 1As shown in F, the signal-to-noise ratio of the MB1 and MB2 groups is generally higher than that of the MB1a and MB2a groups. In addition, compared with the state before the MB was modified, the minimum detection limit was reduced from 10nM to 1nM. In summary, it can be seen that reducing the template concentration and increasing the binding ability of MB to the PER product may help to improve the signal-to-noise ratio output efficiency of in situ PD-PER. After exploring the relationship between template concentration and MB structure and the S / N output efficiency of in situ dual PER, the present invention verified the specificity and anti-interference ability of the reaction system. H1-1 and H2 were used to detect e13a2, e14a2, BCRe13 and ABL, and the fluorescence of the probe group targeting e13a2 was the most obvious ( Figure 1 G). Using H1-2 and H3 probes to identify e14a2, e13a2, BCRe14 and ABL, the e14a2 group showed the most obvious fluorescence ( Figure 1 F). Finally, two sets of mixed primer probes were used to detect blank, e13a2, e14a2 and mixed targets. The results showed that each set of probes could detect the corresponding target, and the two sets of primer probes did not interfere with each other ( Figure 1 I). Together, these results demonstrate that the system has good specificity in accurately distinguishing e13a2 from e14a2.

[0080] Figure 4 The optimized conditions and sensitivity test results of in situ double PER; Figure 4 As shown in A, when H1-1:H2=1:1, the S / N of FAM and Cy3 reached the maximum value, and then as the concentration of Bst DNA polymerase increased from 10U / mL to 50U / mL, the S / N gradually increased. However, as the concentration of Bst DNA polymerase further increased, the signal-to-noise ratio gradually decreased. Therefore, the concentration of Bst DNA polymerase was set to 20U / mL ( Figure 4 B). In addition, the incubation time of the in situ dual PER was optimized to save testing time ( Figure 4 C). From 60 min to 140 min, the fluorescence intensity and S / N gradually increased and reached the maximum at 120 min. Therefore, 120 min was taken as the optimal reaction time. In addition, the PER product was incubated with different concentrations of MBs for 30 min ( Figure 4 D). It was observed that the fluorescence intensity reached a maximum at 100nM. However, the S / N trends of FAM and Cy3 were not consistent. Therefore, while ensuring that the FI remained at a high level, a group of MBs with a higher S / N was selected. Under the optimal experimental conditions, the sensitivity of the developed strategy was studied by changing the concentrations of e13a2 and e14a2 (0nM, 0.1nM, 1nM, 5nM, 10nM, 20nM, 40nM, 60nM, 80nM, 100nM). The present invention found that the fluorescence intensity is related to the concentration, such as Figure 4 E and Figure 4 As shown in F. Figure 4 G and Figure 4 As shown in Figure 3, there is a good linear relationship between the fluorescence signal and the concentration of e13a2 or e14a2 in the range of 0 nM to 100 nM. The fitting linear equation of FAM (green line) of e13a2 is Y = 327C e13a2 +363.1(R 2 =0.993), and the fitting linear equation of Cy3 (red line) is Y=93.83C e13a2 +421.5(R 2 =0.984). The fitted linear equation of FAM of e14a2 is Y=267.5C e14a2 +576(R 2 =0.986), the fitting linear equation of Cy5 (purple line) is Y=123.5C e13a2 +689.9(R 2 =0.994). The limit of detection (LOD) of e13a2 and e14a2 was determined to be 0.1 nM.

[0081] Figure 5 In situ dual PER is used for cell imaging. In order to determine whether the reaction system can effectively distinguish negative and positive cells, as well as different types of positive cells, the present invention conducted a series of mixed cell suspension tests, mixing KCL22, K562 and white blood cells (WBC) in a two-to-two ratio to form the following cell suspensions: WBC+KCL22, WBC+K562 and KCL22+K562. Figure 5 As shown in Figure 2B, the research results of the present invention show that negative cells and positive cells can be effectively distinguished, and KCL22 can also be distinguished from K562. This shows that the method of the present invention can achieve good specificity at the cellular level. Since the principle of the imaging system of the present invention is to detect two fluorescent signals on a target, the present invention performs fluorescence co-localization analysis on KCL22 and K562 respectively ( Figure 5 D and Figure 5 E). The colocalization curves show that FAM and Cy3 as well as FAM and Cy5 exhibit a high correlation at the corresponding distances, indicating that the dual-color fluorescent signals of the present invention exist on the same target. This further confirms the feasibility of in situ dual PER.

[0082] Figure 6 The results of the in situ double PER performance verification in cells. In order to illustrate the advantages of double PER over single PER in in situ imaging, the present invention conducted single PER and double PER tests on 5% KCL22 and 5% K562 in WBC, respectively ( Figure 6 A and Figure 6C). Then, the present invention performed a double PER experiment in the pure WBC group and the pure KCL22 group, counting 100 WBC and 100 KCL22 cells respectively, calculating the average FAM and Cy3 fluorescence of each cell, and drawing a two-dimensional scatter plot of WBC and KCL22 ( Figure 6 B). When FAM>17.0 and Cy3>17.0, the positive cells in the WBC group were 0%, while the positive cells in the KCL22 group were 94%. Therefore, the present invention sets FAM=17.0 and Cy3=17.0 for each cell as the fluorescence threshold. If the cell's FAM>17.0 and Cy3>17.0, the cell is double positive; if the cell's FAM>17.0 and Cy3<17.0, the cell is FAM positive; if the cell's FAM<17.0 and Cy3>17.0, the cell is Cy3 positive; if the cell's FAM<17.0 and Cy3<17.0, the cell is Cy3 positive; if the cell's FAM<17.0 and Cy3<17.0, the cell is negative. Subsequently, the present invention counted 500 cells of the single PER-FAM group (a), 500 cells of the single PER-Cy3 group (b), and 500 cells of the double PER group (c), and drew corresponding scatter plots ( Figure 6 B). According to the fluorescence threshold, the present invention can know that the positive cell ratio (RoP) of group a is 11.4%, group b is 13.8%, and group c is 6.20%. Similarly, the present invention uses the same method to determine the fluorescence threshold of K562 cells. When FAM>17.0 and Cy5>15.0, the positive cells of the WBC group are 0%, and the positive cells of the K562 group are 94% ( Figure 6 D). Therefore, the present invention observed that the RoP of d was 8.60%, e was 13.2%, and f was 6.00%. Under the same cell ratio, comparing the monochrome signal of single PER and the dual-color signal of dual PER, the present invention speculates that: in cell imaging, only the cell detection positivity rate of dual PER is close to 5%. From the perspective of the assembly and reaction principle of the probe, the monochrome signal in the dual PER mode is more likely to be triggered by the corresponding target. However, the reaction efficiency of one PER product may not be high enough, so only a monochrome signal is reported; and non-specific binding may also result in only a monochrome signal being reported. The difference between the monochrome signals may also be caused by the different binding efficiencies between MB and PER products. Since the RoP of cells showing dual-color fluorescence in the dual PER mode is closer to the actual ratio, the present invention speculates that this monochrome signal is mainly caused by non-specific binding, and the dual-color fluorescence of dual PER is more accurate. Finally, in order to evaluate the cell imaging detection capability of dual PER in situ, the present invention performed cell imaging on positive cells in different proportions (50%, 5%, 1%, 0.1%, 0.01%) in WBC. As Figure 6As shown in E, as low as 0.01% of positive cells can be detected. For each positive cell ratio, the number of positive cells per 200 cells was calculated, and a linear relationship was established between the logarithmic value of the ratio from 0.01% to 50% and the corresponding count value ( Figure 6 F) The fitted linear equation of KCL22 is Y = 0.583 ± 0.0402log ratio of positive cells +0.916±0.0462(R 2 =0.950), the fitted linear equation of K562 is Y=0.572±0.0474log ratioofpositivecells +0.958±0.0582(R 2 =0.920). Compared with other previously reported methods for detecting BCR-ABL P210 subtypes, the strategy proposed in this paper has two advantages. One is that the in situ dual-color signal capability of dual PER makes this developed strategy more specific and the detection results more accurate. Another advantage is that it can detect tumor cells as low as 0.01%, which can improve the detection ability.

[0083] The present invention has the following technical effects:

[0084] (1) The present invention can image the BCR / ABL P210 subtype in situ within 3.5 hours, which is simple and fast to operate compared to sequencing;

[0085] (2) The dual fluorescence detection strategy of the BCR / ABL P210 subtype of the present invention can reduce false positives caused by non-specific adsorption. For samples with fewer tumor cells, the impact of the false positive cell rate on subsequent medication and monitoring can be reduced.

[0086] (3) The present invention can also reflect the amount of residual tumor cells and can detect tumor cells as low as 0.01%.

[0087] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements will not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A dual fluorescence in situ imaging fusion gene kit, characterized in that: It includes a first primer pair, amplification probe T1, amplification probe T2, molecular beacon probe MB1 and molecular beacon probe MB2 for detecting e13a2 subtype; a second primer pair, amplification probe T1, amplification probe T3, molecular beacon probe MB1 and molecular beacon probe MB3 for detecting e14a2 subtype; The first primer pair includes H1-1 and H2, and the nucleotide sequences are shown in SEQ ID NO.1-2 respectively; The second primer pair includes H1-2 and H3, and the nucleotide sequences are shown in SEQ ID NO.3-4 respectively; The nucleotide sequences of amplification probes T1, T2 and T3 are shown in SEQ ID NOs. 5-7, respectively; The nucleotide sequences of the molecular beacon probes MB1, MB2 and MB3 are shown in SEQ ID NOs. 8-10, respectively.

2. A dual fluorescence in situ imaging fusion gene kit according to claim 1, characterized in that: The excitation wavelength of FAM-labeled MB1 is 492 nm, and the fluorescence spectrum ranges from 500 to 600 nm.

3. A dual fluorescence in situ imaging fusion gene kit according to claim 2, characterized in that: The excitation wavelength of Cy3-labeled MB2 is 548 nm, and the fluorescence spectrum ranges from 558 to 650 nm.

4. A dual fluorescence in situ imaging fusion gene kit according to claim 3, characterized in that: The excitation wavelength of Cy5-labeled MB3 is 643 nm, and the fluorescence spectrum ranges from 650 to 750 nm.

5. A method for dual fluorescence in situ imaging of fusion genes according to claim 4, characterized in that: Includes steps: Step (1), reacting e13a2 mRNA with H1-1 and H2 of the first primer pair, and reacting e14a2 mRNA with H1-2 and H3 of the second primer pair, to obtain a first tube product and a second tube product, respectively; Step (2), adding amplification probes T1 and T2 and amplification probes T1 and T3 to the first tube product and the second tube product, respectively, and obtaining a first PER amplification product and a second PER amplification product after reaction; Step (3), adding molecular beacon probes MB1, MB2 and molecular beacon probes MB1, MB3 to the first PER amplification product and the second PER amplification product respectively, and detecting fluorescence after the reaction is completed.

6. The method for dual fluorescence in situ imaging of fusion genes according to claim 5, characterized in that: In step (1), e13a2 mRNA is reacted with H1-1 and H2 of the first primer pair at 50°C for 30 min, and e14a2 mRNA is reacted with H1-2 and H3 of the second primer pair at 50°C for 30 min.

7. The method for dual fluorescence in situ imaging of fusion genes according to claim 6, characterized in that: In step (2), the reaction temperature is 37° C. and the reaction time is 2 h.

8. The method for dual fluorescence in situ imaging of fusion genes according to claim 7, characterized in that: In step (3), the reaction temperature is 37° C. and the reaction time is 30 min.

9. The method for dual fluorescence in situ imaging of fusion genes according to claim 8, characterized in that: The specific steps are: First, H1-1 and H2 of the first primer pair and H1-2 and H3 of the second primer pair were added to tube A containing e13a2 and tube B containing e14a2, respectively, under the reaction conditions of 1× Reaction buffer and MgSO4, 50℃ for 30min; After the reaction is completed, add amplification probes T1, T2, dA / T / CTP, hairpin removal G, BstDNA polymerase, 1× Reaction buffer and PER reaction solution of MgSO4 were added into tube A respectively; The amplification probes T1, T3, dA / T / CTP, hairpin removal G, BstDNA polymerase, 1× Reaction buffer and PER reaction solution of MgSO4 were added into tube B respectively; The PER reaction solutions were all reacted at 37°C for 2 h; Finally, molecular beacon probes MB1 and MB2, and molecular beacon probes MB1 and MB3 were added to tube A and tube B, respectively, and reacted at 37°C for 30 min; After the reaction is completed, the fluorescence of tube A and tube B is detected respectively.

Images