Pig feed for increasing intramuscular fat of pork and preparation method thereof

Abstract

The invention discloses a pig feed for increasing intramuscular fat of pork and a preparation method thereof, and belongs to the technical field of pig feeds. The pig feed comprises the following components in parts by weight: 100-120 parts of a basal feed, 3-4 parts of a compound enzyme agent, 5-7 parts of a probiotic compound bacterial agent, 1-3 parts of a vitamin additive, 20-30 parts of rice bran, 10-15 parts of a fat supplement and 3-6 parts of a functional additive. By adding various functional regulators beneficial to increase of fat in pork muscles, deposition of fat in the pork muscles is improved through various ways, and the corn, the soybean cakes and the wheat germs can provide high energy, so that fat deposition can be increased in the growth process of the pork; fat supplements rich in omega-3 fatty acid, such as flaxseed oil or fish oil, are added into the feed, so that the flavor of meat and the proportion of healthy fat can be improved, and the deposition and quality of intramuscular fat are influenced.

Description

Technical Field

[0001] The invention belongs to the technical field of pig feed, and specifically refers to a pig feed for increasing pork intramuscular fat and a preparation method thereof. Background Art

[0002] Pig feed that increases pork intramuscular fat (i.e., marbled fat) is a feed technology for improving pork quality. In recent years, it has received increasing attention in the pig farming industry. As consumers' requirements for meat quality increase, pork flavor, taste, and tenderness have become key indicators. Pork with high intramuscular fat content is favored by the market because of its better flavor and higher economic value. The formation of intramuscular fat is closely related to pig genetics, feeding management, nutrition, and environmental factors. The main factors affecting intramuscular fat deposition include: Genetic factors: Some breeds of pigs are born with a higher potential for intramuscular fat deposition. For example, Duroc pigs and Berkshire pigs are generally considered to have better meat quality. Feed ingredients: The composition and source of fatty acids in feed directly affect the deposition of intramuscular fat. For example, increasing the content of unsaturated fatty acids (such as linoleic acid and oleic acid) in feed can help increase the deposition of intramuscular fat. Energy intake: Excess energy promotes fat deposition. Reasonable energy levels can help increase intramuscular fat without causing excessive obesity; in order to increase intramuscular fat in pork, farmers can use a variety of feed additives, such as: vegetable oils and animal fats: increase the proportion of fat in feed and provide more energy; amino acids: such as lysine and arginine, which help improve the balance of amino acids and promote fat synthesis; probiotics and enzyme preparations: improve intestinal health, enhance the absorption of nutrients, and improve feed conversion rate. During the feed processing process, the control of parameters such as temperature, humidity and time directly affects the nutritional content and digestibility of the feed. The instability of beneficial ingredients may lead to the effect after feeding not meeting expectations. Summary of the invention

[0003] In view of the above situation, in order to overcome the defects of the prior art, the present invention provides a pig feed for increasing pork intramuscular fat and a preparation method thereof. The present invention increases the deposition of pork intramuscular fat through multiple pathways by adding a variety of functional regulators that are beneficial to increasing pork intramuscular fat. Corn, soybean cake and wheat germ can provide high energy, so that fat deposition can be increased during the growth process. Adding fat supplements rich in ω-3 fatty acids such as flaxseed oil or fish oil to the feed can improve the flavor of the meat and the proportion of healthy fat, and affect the deposition and quality of intramuscular fat.

[0004] In order to achieve the above object, the technical scheme adopted by the present invention is as follows: the present invention proposes a pig feed for increasing pork intramuscular fat, the pig feed comprising the following components in parts by weight: 100-120 parts of basic feed, 3-4 parts of compound enzyme agent, 5-7 parts of probiotic compound bacterial agent, 1-3 parts of vitamin additive, 20-30 parts of rice bran, 10-15 parts of fat supplement, and 3-6 parts of functional additive;

[0005] Preferably, the basic feed comprises the following components in parts by weight: 5-7 parts of corn, 2-4 parts of soybean cake, and 1-3 parts of wheat germ;

[0006] Preferably, the complex enzyme agent comprises the following components in parts by weight: 1-2 parts of cellulase, 2-3 parts of amylase, and 0.5-1 parts of xylanase;

[0007] Preferably, the probiotic composite bacterial agent comprises the following components in parts by weight: 1-2 parts of lactic acid bacteria agent, 1-2 parts of yeast agent, and 1-2 parts of Bifidobacterium longum agent;

[0008] Preferably, the vitamin additive comprises the following components in parts by weight: 8-10 parts of vitamin A, 0.5-1 parts of vitamin E, 1-3 parts of vitamin D, 0.2-0.4 parts of vitamin B3, 0.1-0.2 parts of vitamin B5, and 5-7 parts of calcium hydrogen phosphate;

[0009] Preferably, the fat supplement comprises the following components in parts by weight: 2-3 parts of olive oil, 2-3 parts of rapeseed oil, 1-2 parts of soybean oil, 0.2-0.3 parts of fish oil, and 0.1 -0.2 parts of linseed oil;

[0010] Preferably, the raw materials for preparing the functional additive include the following components in parts by weight: 10-12 parts of polypeptide polymer, 1-1.5 parts of curcumin, and 0.5-1 part of piperine;

[0011] Preferably, the method for preparing the functional additive comprises the following steps:

[0012] K1. Place Boc-Lys(Z)-OH and L-glutamic acid diethyl ester hydrochloride in chloroform, mix and dissolve, add 1-hydroxybenzotriazole, mix well, place at 0°C, add triethylamine, mix, add EDC, place at 23-28°C, stir at 150-180 rpm for 20-28 hours, wash with 5%w NaHCO3 aqueous solution and saturated sodium chloride solution, separate the organic layer, dry with magnesium sulfate, concentrate to remove the organic solvent, and vacuum dry to obtain Boc-Lys-Gly-oET;

[0013] K2, dissolving the Boc-Lys-Gly-oET prepared in step K1 in dichloromethane, adding trifluoroacetic acid, stirring at room temperature and 150-180 rpm for 6-8 hours, removing the organic solvent by vacuum distillation, adding to the dioxane solution, mixing evenly, adding ether for precipitation, filtering, collecting the precipitate, washing with ether, and vacuum drying to obtain Lys-Gly hydrochloride;

[0014] K3, dissolving the Lys-Gly hydrochloride prepared in step K2 in 1M phosphate buffer solution, placing at 40°C, adding trypsin, stirring at 800-900 rpm for reaction for 2-3h, centrifuging at 8000-10000 rpm for 15-25min, collecting the precipitate, washing with deionized water, freeze-drying to obtain intermediate product 1, dissolving it in HBr solution, stirring at room temperature for reaction for 2-3h, adding ether for precipitation, filtering, collecting the precipitate, washing with ether, vacuum drying, dissolving it in NaOH aqueous solution, stirring at room temperature for reaction for 12-18h, dialyzing with deionized water to neutrality, freeze-drying to obtain a polypeptide polymer;

[0015] K4, placing the polypeptide polymer prepared in step K3 in dimethyl sulfoxide, mixing until completely dissolved, adding the dimethyl sulfoxide solution of curcumin and piperine, stirring at a speed of 200 rpm, mixing evenly, placing under a power of 300 W for ultrasonic treatment, dialyzing with deionized water overnight, and freeze-drying to obtain a functional additive;

[0016] Preferably, in step K1, the mass ratio between the Boc-Lys(Z)-OH and L-glutamic acid diethyl ester hydrochloride is 1.4-1.6:1;

[0017] Preferably, in step K1, the mass concentration of Boc-Lys(Z)-OH in chloroform is 0.1-0.2 g / mL;

[0018] Preferably, in step K1, the mass concentration of 1-hydroxybenzotriazole in chloroform is 0.08-0.09 g / mL; the added volume of triethylamine is 8%-10% of the volume of chloroform; the mass concentration of EDC in chloroform is 0.1-0.12 g / mL;

[0019] Preferably, in step K2, the mass concentration of Boc-Lys-Gly-oET in dichloromethane is 0.2-0.25 g / mL;

[0020] Preferably, in step K2, the volume ratio between trifluoroacetic acid and dichloromethane is 1-1.2:1.5;

[0021] Preferably, in step K2, the dioxane solution is a solution of dioxane dissolved in a 1M hydrochloric acid solution, and the mass concentration of the dioxane in the hydrochloric acid solution is 0.1-0.2 g / mL;

[0022] Preferably, in step K3, the mass concentration of the Lys-Gly hydrochloride in the phosphate buffer solution is 15-25 mg / mL, and the pH value of the phosphate buffer solution is 8-8.5;

[0023] Preferably, in step K3, the mass concentration of trypsin in the phosphate buffer solution is 8-10 mg / mL;

[0024] Preferably, in step K3, the mass concentration of NaOH in the NaOH aqueous solution is 0.08-0.1 g / mL;

[0025] Preferably, in step K4, the mass concentration of the polypeptide polymer in dimethyl sulfoxide is 5-10 mg / mL;

[0026] Preferably, in step K4, the curcumin solution is a solution in which curcumin is dissolved in dimethyl sulfoxide, wherein the mass concentration of curcumin is 10-20 mg / mL; the piperine solution is a solution in which curcumin is dissolved in dimethyl sulfoxide, wherein the mass concentration of piperine is 30-40 mg / mL.

[0027] The present invention also provides a method for preparing a pig feed for increasing pork intramuscular fat, which specifically comprises the following steps:

[0028] S1. Place corn, soybean cake, wheat germ and rice bran in a feed grinder, grind to 0.5-2 mm, add a composite enzyme agent into a fermentation tank, add water for enzymolysis according to a feed-liquid ratio of 1:4, and obtain enzymolysis feed;

[0029] S2, stirring and mixing the enzymatic feed prepared in step S2 with the probiotic composite bacterial agent, standing for 6-8 hours, adding vitamin additives, fat supplements and functional additives and stirring and mixing to obtain pretreated feed;

[0030] S3, placing the pre-treated feed prepared in step S2 in a pelletizer for pelleting, placing it at 40-50° C. for drying, and obtaining pig feed with increased pork intramuscular fat.

[0031] The beneficial effects achieved by the present invention are as follows:

[0032] The invention provides a pig feed for increasing pork intramuscular fat and a preparation method thereof. The invention adds a plurality of functional regulators that are beneficial to increasing pork intramuscular fat, and increases the deposition of pork intramuscular fat through a plurality of ways. Corn, soybean cake and wheat germ can provide high energy, so that fat deposition can be increased during the growth process. Adding fat supplements rich in ω-3 fatty acids such as flaxseed oil or fish oil to the feed can improve the flavor of the meat and the proportion of healthy fat, and affect the deposition and quality of intramuscular fat. Vitamins play a regulatory role in fat metabolism, and proper supplementation can promote the deposition of intramuscular fat. The invention adds Functional additives are added to supplement amino acids, curcumin and piperine into the feed. Curcumin is believed to be able to regulate genes and signal pathways related to fat metabolism. Curcumin can activate peroxisome proliferator-activated receptors (PPARγ), which can promote the differentiation of adipocytes and the deposition of fat. The activation of PPARγ helps to increase the deposition of intramuscular fat. In addition, curcumin can also balance energy metabolism and promote fat synthesis by regulating the AMPK pathway; piperine can reduce the metabolic rate of curcumin by inhibiting metabolic enzymes in the intestine and liver, such as glucuronyl transferase (UGT); this inhibitory effect The retention time of curcumin in the body is prolonged, the plasma concentration is increased, and the biological activity of curcumin is further enhanced. Piperine can prolong the activation time of PPARγ by prolonging the half-life of curcumin in the body, and further enhance the expression of genes related to fat generation. Since the absorption rate of curcumin itself is relatively low, mainly due to its low water solubility, rapid metabolism and excretion, the present invention uses glutamic acid and lysine to synthesize polyamino acid monomers, and further polymerizes to form alternating polyamino acids of glutamic acid and lysine, which provide amino and carboxyl active sites on the polymer band, and carry out loading with curcumin and piperine through hydrogen bonds. , improve the solubility of curcumin in the body, the polyamino acid is gradually degraded through the enzymatic reaction in the body, which can not only achieve the sustained release of curcumin, but also gradually decompose the polyamino acid to obtain small molecular glutamic acid and lysine. Lysine is the limiting amino acid for protein synthesis in pigs. Appropriate lysine supply can promote protein synthesis in muscle tissue, thereby affecting energy distribution. Excessive lysine may promote protein synthesis and reduce energy for fat deposition, which will reduce the content of intramuscular fat. The functional regulator provided by the present invention can gradually decompose lysine to achieve the goal of sustained release and avoid the negative impact of excessive lysine. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a graph showing the sustained release performance of curcumin, a functional additive in pig feed prepared in Example 1 of the present invention and Comparative Example 1;

[0034] Figure 2 This is a graph showing the thickness of pig back fat after feeding the feed prepared by Examples 1-3 of the present invention and Comparative Examples 1-3;

[0035] Figure 3 This is a result diagram of the IMF content of the longissimus dorsi muscle of pigs after feeding the feeds prepared in Examples 1-3 of the present invention and Comparative Examples 1-3;

[0036] Figure 4 This is a graph showing the activation results of peroxisome proliferator-activated receptor γ by the pig feed prepared in Examples 1-3 of the present invention and Comparative Examples 1-3.

[0037] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention. DETAILED DESCRIPTION

[0038] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments; based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0039] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only and are not intended to limit the content of this application.

[0040] The experimental methods in the following examples are conventional methods unless otherwise specified; the experimental materials and test strains used in the following examples are purchased from commercial channels unless otherwise specified.

[0041] The sources of materials involved in the present invention are as follows:

[0042] Cellulase, brand: Innochem, product number: A62048, enzyme activity: 50U / g;

[0043] Amylase, brand is Yingxin Laboratory, product number is YXM98007, enzyme activity is 3500u / g;

[0044] Xylanase, brand is Yingxin Laboratory, product number is TX20082, enzyme activity is 6000U / mg;

[0045] Lactobacillus plantarum, from China Industrial Microbiological Culture Collection Center, collection number CICC 22703, live bacteria concentration of 2.5×10 9 CFU / g;

[0046] Yeast inoculant (Candida utilis), from China Industrial Microbiological Culture Collection Center, collection number CICC 31170, live bacteria concentration of 3.7×10 9 CFU / g;

[0047] Bifidobacterium longum, from China Industrial Microbiological Culture Collection Center, collection number CICC 24632, live bacteria concentration of 1.5×10 9 CFU / g;

[0048] Example 1

[0049] The present embodiment provides a pig feed for increasing pork intramuscular fat, which specifically includes the following components in parts by weight: 100 parts of basic feed, 3 parts of compound enzyme agent, 7 parts of compound probiotic bacteria agent, 2 parts of vitamin additive, 20 parts of rice bran, 10 parts of fat supplement, and 4 parts of functional additive;

[0050] The basic feed includes the following components by weight: 5 parts of corn, 4 parts of soybean cake, and 2 parts of wheat germ;

[0051] The complex enzyme agent includes the following components in parts by weight: 1 part of cellulase, 3 parts of amylase, and 0.5 parts of xylanase;

[0052] The probiotic compound bacterial agent includes the following components in parts by weight: 2 parts of lactic acid bacteria agent, 2 parts of yeast agent, and 1 part of Bifidobacterium longum agent;

[0053] The vitamin additive comprises the following components in parts by weight: 10 parts of vitamin A, 1 part of vitamin E, 2 parts of vitamin D, 0.2 parts of vitamin B3, 0.1 parts of vitamin B5, and 5 parts of calcium hydrogen phosphate;

[0054] The fat supplement includes the following components in parts by weight: 2 parts of olive oil, 3 parts of rapeseed oil, 2 parts of soybean oil, 0.2 parts of fish oil, and 0.2 parts of linseed oil;

[0055] The raw materials for preparing the functional additive include the following components in parts by weight: 12 parts of polypeptide polymer, 1 part of curcumin, and 0.5 parts of piperine;

[0056] The preparation method of the functional additive specifically comprises the following steps:

[0057] K1. Place 4.5 g of Boc-Lys(Z)-OH and 3 g of L-glutamic acid diethyl ester hydrochloride in 45 mL of chloroform, mix and dissolve, add 4 g of 1-hydroxybenzotriazole, mix well, place at 0°C, add 3.6 mL of triethylamine, mix, add 5.4 g of EDC, place at 25°C, stir at 180 rpm for 24 h, wash with 5% w / w NaHCO3 aqueous solution and saturated sodium chloride solution, separate the organic layer, dry with magnesium sulfate, concentrate to remove the organic solvent, and dry in vacuo to obtain Boc-Lys-Gly-oET;

[0058] K2, 5.0 g of Boc-Lys-Gly-oET prepared in step K1 was dissolved in 25 mL of dichloromethane, 20 mL of trifluoroacetic acid was added, and the mixture was stirred at room temperature for 6 h at 150 rpm, and the organic solvent was removed by distillation under reduced pressure, 2.4 mL of dioxane was accurately weighed and dissolved in 25 mL of 1 M hydrochloric acid solution, and the whole was transferred to the reaction system, mixed well, and ether was added for precipitation, filtered, the precipitate was collected, washed with ether, and dried in vacuo to obtain Lys-Gly hydrochloride;

[0059] K3. Accurately weigh 2 g of Lys-Gly hydrochloride prepared in step K2 and dissolve it in 80 mL of 1 M phosphate buffer solution. Place at 40° C. Add 0.8 g of trypsin and react at 800 rpm for 3 h. Centrifuge at 8000 rpm for 25 min. Collect the precipitate, wash it with deionized water, and freeze-dry it to obtain intermediate product 1. Dissolve HBr in acetic acid solution at 0.4 g / L. Take 15 mL and add 3 mL of acetic acid to mix well to prepare HBr solution. Dissolve the intermediate product in HBr solution. Stir for 3 h at room temperature. Add ether for precipitation. Filter. Collect the precipitate, wash it with ether, dry it in vacuum, dissolve it in 0.08 g / mL NaOH aqueous solution, stir for 16 h at room temperature, dialyze it with deionized water to neutrality, and freeze-dry it to obtain a polypeptide polymer.

[0060] K4. Accurately weigh 1.2 g of the polypeptide polymer prepared in step K3 and place it in a flask, add it to 240 mL of dimethyl sulfoxide, place it on a magnetic stirrer and stir it at a speed of 200 rpm to make the polypeptide polymer completely dissolved in dimethyl sulfoxide, accurately weigh 0.1 g of curcumin and dissolve it in 5 mL of dimethyl sulfoxide to obtain a curcumin solution, accurately weigh 0.05 g of piperine and dissolve it in 2 mL of dimethyl sulfoxide to obtain a piperine solution, add the curcumin solution and the piperine solution drop by drop into the polypeptide polymer solution, continue stirring for 30 minutes, place it under a power of 300 W for ultrasonic treatment for 20 minutes, stir it, perform ultrasonic treatment again, repeat the ultrasonic treatment 3 times, use a dialysis bag with a molecular cutoff of 3500 Da, dialyze it with deionized water, and freeze-dry it overnight to obtain a functional additive.

[0061] This embodiment also provides a method for preparing a pig feed for increasing pork intramuscular fat, which specifically comprises the following steps:

[0062] S1. Place corn, soybean cake, wheat germ and rice bran in a feed grinder, grind to 2 mm, add a composite enzyme agent into a fermentation tank, add water for enzymolysis according to a feed-liquid ratio of 1:4, and obtain enzymolysis feed;

[0063] S2, stirring and mixing the enzymatic feed prepared in step S2 with the probiotic composite bacterial agent, standing for 8 hours, adding vitamin additives, fat supplements and functional additives, stirring and mixing, to obtain pretreated feed;

[0064] S3, placing the pre-treated feed prepared in step S2 in a pelletizer for pelleting, placing it at 50° C. for drying, and obtaining pig feed with increased pork intramuscular fat.

[0065] Example 2

[0066] The present embodiment provides a pig feed for increasing pork intramuscular fat, which specifically includes the following components in parts by weight: 120 parts of basic feed, 4 parts of compound enzyme agent, 6 parts of compound probiotic bacteria agent, 3 parts of vitamin additive, 30 parts of rice bran, 15 parts of fat supplement, and 3 parts of functional additive;

[0067] The basic feed includes the following components by weight: 6 parts of corn, 2 parts of soybean cake, and 3 parts of wheat germ;

[0068] The complex enzyme agent includes the following components in parts by weight: 2 parts of cellulase, 2 parts of amylase, and 1 part of xylanase;

[0069] The probiotic compound bacterial agent comprises the following components in parts by weight: 1 part of lactic acid bacteria agent, 2 parts of yeast agent, and 2 parts of Bifidobacterium longum agent;

[0070] The vitamin additive comprises the following components in parts by weight: 8 parts of vitamin A, 0.5 parts of vitamin E, 3 parts of vitamin D, 0.3 parts of vitamin B3, 0.2 parts of vitamin B5, and 6 parts of calcium hydrogen phosphate;

[0071] The fat supplement includes the following components in parts by weight: 3 parts of olive oil, 2 parts of rapeseed oil, 1 part of soybean oil, 0.3 parts of fish oil, and 0.1 parts of linseed oil;

[0072] The raw materials for preparing the functional additive include the following components in parts by weight: 11 parts of polypeptide polymer, 1.5 parts of curcumin, and 1 part of piperine;

[0073] The preparation method of the functional additive specifically comprises the following steps:

[0074] K1. Place 5 g of Boc-Lys(Z)-OH and 3.5 g of L-glutamic acid diethyl ester hydrochloride in 50 mL of chloroform, mix and dissolve, add 4 g of 1-hydroxybenzotriazole, mix well, place at 0°C, add 4 mL of triethylamine, mix, add 6 g of EDC, place at 25°C, stir at 150 rpm for 28 h, wash with 5% w / w NaHCO3 aqueous solution and saturated sodium chloride solution, separate the organic layer, dry with magnesium sulfate, concentrate to remove the organic solvent, and vacuum dry to obtain Boc-Lys-Gly-oET;

[0075] K2, 4.0 g of Boc-Lys-Gly-oET prepared in step K1 was dissolved in 16 mL of dichloromethane, 10.7 mL of trifluoroacetic acid was added, and the mixture was stirred at 180 rpm for 8 h at room temperature, and the organic solvent was removed by distillation under reduced pressure, 1.9 mL of dioxane was accurately weighed and dissolved in 10 mL of 1 M hydrochloric acid solution, and the whole was transferred to the reaction system, mixed well, and ether was added for precipitation, filtered, the precipitate was collected, washed with ether, and dried in vacuo to obtain Lys-Gly hydrochloride;

[0076] K3. Accurately weigh 3 g of Lys-Gly hydrochloride prepared in step K2 and dissolve it in 200 mL of 1 M phosphate buffer solution. Place it at 40° C. Add 2.0 g of trypsin, stir and react at 900 rpm for 2 h, centrifuge at 10,000 rpm for 15 min, collect the precipitate, wash it with deionized water, and freeze-dry it to obtain intermediate product 1. Dissolve HBr in acetic acid solution at 0.4 g / L, take 15 mL and add 3 mL of acetic acid to mix well to prepare HBr solution, dissolve the intermediate product in HBr solution, stir and react at room temperature for 2 h, add ether to precipitate, filter, collect the precipitate, wash it with ether, vacuum dry it, dissolve it in 0.1 g / mL NaOH aqueous solution, stir and react at room temperature for 12 h, dialyze with deionized water to neutrality, and freeze-dry it to obtain a polypeptide polymer;

[0077] K4, accurately weigh 1.1 g of the polypeptide polymer prepared in step K3 and place it in a flask, add it to 110 mL of dimethyl sulfoxide, place it on a magnetic stirrer and stir it at a speed of 200 rpm to make the polypeptide polymer completely dissolved in dimethyl sulfoxide, accurately weigh 0.15 g of curcumin and dissolve it in 15 mL of dimethyl sulfoxide to obtain a curcumin solution, accurately weigh 0.1 g of piperine and dissolve it in 3.5 mL of dimethyl sulfoxide to obtain a piperine solution, add the curcumin solution and the piperine solution drop by drop into the polypeptide polymer solution, continue stirring for 30 minutes, place it under 300 W power for ultrasonic treatment for 20 minutes, stir it, perform ultrasonic treatment again, repeat the ultrasonic treatment 3 times, use a dialysis bag with a molecular cutoff of 3500 Da, dialyze it with deionized water, and freeze-dry it overnight to obtain a functional additive.

[0078] This embodiment also provides a method for preparing a pig feed for increasing pork intramuscular fat, which specifically comprises the following steps:

[0079] S1. Place corn, soybean cake, wheat germ and rice bran in a feed grinder, grind to 1 mm, add a composite enzyme agent to a fermentation tank, add water for enzymolysis according to a feed-liquid ratio of 1:4, and obtain enzymolysis feed;

[0080] S2, stirring and mixing the enzymatic feed prepared in step S2 with the probiotic composite bacterial agent, standing for 7 hours, adding vitamin additives, fat supplements and functional additives and stirring and mixing to obtain pretreated feed;

[0081] S3, placing the pre-treated feed prepared in step S2 in a pelletizer for pelleting, placing it at 45° C. for drying, and obtaining pig feed with increased pork intramuscular fat.

[0082] Example 3

[0083] The present embodiment provides a pig feed for increasing pork intramuscular fat, which specifically includes the following components in parts by weight: 110 parts of basic feed, 3 parts of compound enzyme agent, 5 parts of compound probiotic bacteria agent, 1 part of vitamin additive, 15 parts of rice bran, 20 parts of fat supplement, and 6 parts of functional additive;

[0084] The basic feed includes the following components by weight: 7 parts of corn, 3 parts of soybean cake, and 1 part of wheat germ;

[0085] The complex enzyme agent includes the following components in parts by weight: 1.5 parts of cellulase, 2.5 parts of amylase, and 0.8 parts of xylanase;

[0086] The probiotic compound bacterial agent includes the following components in parts by weight: 2 parts of lactic acid bacteria agent, 1 part of yeast agent, and 1 part of Bifidobacterium longum agent;

[0087] The vitamin additive includes the following components in parts by weight: 9 parts of vitamin A, 0.8 parts of vitamin E, 1 part of vitamin D, 0.4 parts of vitamin B3, 0.1 parts of vitamin B5, and 7 parts of calcium hydrogen phosphate;

[0088] The fat supplement includes the following components in parts by weight: 2 parts of olive oil, 2 parts of rapeseed oil, 1 part of soybean oil, 0.3 parts of fish oil, and 0.1 parts of linseed oil;

[0089] The raw materials for preparing the functional additive include the following components in parts by weight: 10 parts of polypeptide polymer, 1 part of curcumin, and 0.5 parts of piperine;

[0090] The preparation method of the functional additive specifically comprises the following steps:

[0091] K1. Place 4.8 g of Boc-Lys(Z)-OH and 3 g of L-glutamic acid diethyl ester hydrochloride in 24 mL of chloroform, mix and dissolve, add 2 g of 1-hydroxybenzotriazole, mix well, place at 0°C, add 2.4 mL of triethylamine, mix, add 2.4 g of EDC, place at 25°C, stir at 180 rpm for 20 h, wash with 5% w / w NaHCO3 aqueous solution and saturated sodium chloride solution, separate the organic layer, dry with magnesium sulfate, concentrate to remove the organic solvent, and dry in vacuo to obtain Boc-Lys-Gly-oET;

[0092] K2, 4.0 g of Boc-Lys-Gly-oET prepared in step K1 was dissolved in 20 mL of dichloromethane, 14.5 mL of trifluoroacetic acid was added, and the mixture was stirred at 180 rpm for 7 h at room temperature, and the organic solvent was removed by distillation under reduced pressure, 2.2 mL of dioxane was accurately weighed and dissolved in 15 mL of 1 M hydrochloric acid solution, and the whole was transferred to the reaction system, mixed well, and ether was added for precipitation, filtered, the precipitate was collected, washed with ether, and dried in vacuo to obtain Lys-Gly hydrochloride;

[0093] K3. Accurately weigh 4 g of Lys-Gly hydrochloride prepared in step K2 and dissolve it in 200 mL of 1 M phosphate buffer solution. Place at 40° C. Add 1.8 g of trypsin, stir and react at 850 rpm for 3 h, centrifuge at 9000 rpm for 20 min, collect the precipitate, wash it with deionized water, and freeze-dry to obtain intermediate product 1. Dissolve HBr in acetic acid solution at 0.4 g / L, take 15 mL and add 3 mL of acetic acid to mix well to prepare HBr solution, dissolve the intermediate product in HBr solution, stir and react at room temperature for 2 h, add ether to precipitate, filter, collect the precipitate, wash it with ether, vacuum dry, dissolve it in 0.1 g / mL NaOH aqueous solution, stir and react at room temperature for 18 h, dialyze with deionized water to neutrality, and freeze-dry to obtain a polypeptide polymer;

[0094] K4, accurately weigh 1.1 g of the polypeptide polymer prepared in step K3 and place it in a flask, add it to 110 mL of dimethyl sulfoxide, place it on a magnetic stirrer and stir it at a speed of 200 rpm to make the polypeptide polymer completely dissolved in dimethyl sulfoxide, accurately weigh 0.15 g of curcumin and dissolve it in 15 mL of dimethyl sulfoxide to obtain a curcumin solution, accurately weigh 0.1 g of piperine and dissolve it in 3.5 mL of dimethyl sulfoxide to obtain a piperine solution, add the curcumin solution and the piperine solution drop by drop into the polypeptide polymer solution, continue stirring for 30 minutes, place it under 300 W power for ultrasonic treatment for 20 minutes, stir it, perform ultrasonic treatment again, repeat the ultrasonic treatment 3 times, use a dialysis bag with a molecular cutoff of 3500 Da, dialyze it with deionized water, and freeze-dry it overnight to obtain a functional additive.

[0095] This embodiment also provides a method for preparing a pig feed for increasing pork intramuscular fat, which specifically comprises the following steps:

[0096] S1. Place corn, soybean cake, wheat germ and rice bran in a feed grinder, grind to 0.6 mm, add a composite enzyme agent to a fermentation tank, add water for enzymolysis according to a feed-liquid ratio of 1:4, and obtain enzymolysis feed;

[0097] S2, stirring and mixing the enzymatic feed prepared in step S2 with the probiotic composite bacterial agent, standing for 6 hours, adding vitamin additives, fat supplements and functional additives and stirring and mixing to obtain pretreated feed;

[0098] S3, placing the pre-treated feed prepared in step S2 in a pelletizer for pelleting, placing it at 40° C. for drying, and obtaining pig feed with increased pork intramuscular fat.

[0099] Comparative Example 1

[0100] This comparative example provides a pig feed and a preparation method thereof, which is different from Example 1 only in that the functional additive does not include a polypeptide polymer, and the remaining components and component contents are the same as those in Example 1.

[0101] Comparative Example 2

[0102] This comparative example provides a pig feed and a preparation method thereof, which is different from Example 1 only in that the functional additive does not include piperine, and the remaining components and component contents are the same as those in Example 1.

[0103] Comparative Example 3

[0104] This comparative example provides a pig feed and a preparation method thereof, which is different from Example 1 only in that the functional additive does not include piperine, and the remaining components and component contents are the same as those in Example 1.

[0105] Experimental Example 1

[0106] In this experimental example, the in vitro release of the functional additives prepared in Example 1 and Comparative Example 1 was measured. A PBS buffer solution was prepared by forward dynamic membrane dialysis, and the pH of the PBS buffer solution was adjusted to 5.8 as a release medium to simulate the pig intestinal environment. 0.5 g of the functional additives prepared in Example 1 and Comparative Example 1 were dispersed in 10 mL of deionized water. After mixing evenly, the functional additives were placed in a dialysis bag with a molecular cutoff of 10,000. After one end was clamped, it was placed in 200 mL of the medium and placed in a shaker at 37° C. and 120 rpm for shaking treatment. Samples were taken at regular intervals, and the curcumin content in the sample was determined by high performance liquid chromatography, and the cumulative release rate of curcumin was calculated.

[0107] Cumulative release rate (%) = ×100%;

[0108] Wherein, Vs is the volume of the sustained-release solution in the receiving pool, mL; Ct is the concentration of curcumin in the receiving pool at time t, mg / L; V is the sampling volume, mL; is the sum of the concentrations of curcumin before time t, mg / L; Vg is the volume in the dosing pool, mL; Cg is the concentration of curcumin in the dosing pool, mg / L;

[0109] Figure 1 The sustained-release performance result diagram of the functional additive curcumin in pig feed prepared in Example 1 of the present invention and Comparative Example 1 is shown in the figure. As shown in the figure, the functional additive prepared in Example 1 has a higher sustained-release performance, while the functional additive prepared in Comparative Example 1 basically has no sustained-release performance.

[0110] Experimental Example 2

[0111] In this experimental example, the growth performance of the pig feed prepared in Examples 1-3 and Comparative Examples 1-3 was measured. According to the examples and comparative examples, the pigs were divided into 6 groups, each with 5 pigs. In addition, a control group was set up. The control group was fed with a basic feed, and rapeseed oil was added according to 5wt% of the basic feed. The pigs were fed twice a day, in the morning (8:00) and in the evening (18:00). The pigs were allowed to eat and drink freely. The test period was 56 days.

[0112] All experimental pigs were weighed on the 1st, 28th and 56th days, and the average daily feed intake (ADFI), average daily weight gain (ADG) and feed-to-weight ratio (F / G) were calculated. At the end of the experiment, one experimental pig with a weight close to the average was selected from each replicate, and 6 pigs were selected from each group. They were fasted for 12 hours and slaughtered. The longissimus dorsi muscle and subcutaneous adipose tissue at the 13th to 14th ribs of the right half of the carcass were quickly collected, rinsed with phosphate buffer, and frozen in liquid nitrogen for fatty acid content and gene expression analysis.

[0113] IMF content: The IMF content of the longissimus dorsi muscle was determined by Soxhlet extraction and expressed as a percentage of the fresh weight of the muscle.

[0114] Fatty acid content: The lipids of the longissimus dorsi muscle sample were extracted with chloroform:methanol (2:1, volume ratio), and then fatty acid methyl esters were prepared with potassium hydroxide-methanol solution and placed on a DB5 capillary column (30m×0.25mm). The fatty acid content was determined using a gas chromatography-mass spectrometer (Agilent6890N / 5975B). The measurement results were expressed as the percentage of each fatty acid in the total fatty acids.

[0115] Figure 2 The results of the back fat thickness of pigs after feeding with the feed prepared by Examples 1-3 of the present invention and Comparative Examples 1-3 are shown in the figure. As shown in the figure, the back fat thickness of the test pigs fed with the pig feed described in Examples 1-3 is significantly higher than that of Comparative Examples 1 and 3, as well as the control group.

[0116] Figure 3The IMF content result of the longissimus dorsi muscle of pigs after feeding the feed prepared by Examples 1-3 of the present invention and Comparative Examples 1-3 is shown in the figure. As shown in the figure, the pig feed described in Examples 1-3 has a promoting effect on the deposition of intramuscular fat in pigs, and the intramuscular fat content is significantly improved compared with the control group, while the lack of polyamino acid carrier formed by glutamic acid and lysine in Comparative Example 1 causes the solubility and utilization of curcumin and piperine in the body to be further reduced, and the lack of piperine in Comparative Example 2 has a small effect on the deposition of intramuscular fat, because the main effect of piperine is to promote the activation of PPARγ receptors by curcumin. In the absence of piperine, PPARγ receptors can also be activated, but the efficiency is low; the lack of curcumin and piperine in the pig feed prepared by Comparative Example 3 further reduces the activation efficiency of PPARγ receptors, thereby causing the deposition of intramuscular fat to be significantly affected.

[0117] Real-time fluorescence quantitative PCR was used to detect the expression of related genes. The total mRNA of each tissue was extracted using a ribonucleic acid (RNA) extraction kit (TaKaRa, Japan) according to the operating instructions. 1 μL of total mRNA was taken and cDNA was synthesized using a reverse transcription kit (TaKaRa, Japan). The real-time fluorescence quantitative PCR amplification system was 10.0 μL, including SYBR Premix ExTaq TM 5.0μL, 0.4μL each of upstream and downstream primers, 1.0μL cDNA, 3.2μL ddH2O; PCR reaction program: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s, 60℃ annealing for 30s, a total of 40 cycles. β-actin was used as the internal reference gene, and 2 -ΔΔCt The relative expression of target gene mRNA was calculated by the PCR method; the primer sequence of peroxisome proliferator-activated receptor γ (PPARγ) was:

[0118] Upstream: TGCTGATCCCCACAATTCCC; downstream: CTCCCGGGGGCTAATAGTCT.

[0119] Figure 4The results of peroxisome proliferator-activated receptor γ activation by the pig feed prepared in Examples 1-3 of the present invention and Comparative Examples 1-3 are shown in the figure. As shown in the figure, the pig feed prepared in Examples 1-3 has a promoting effect on the activation of peroxisome proliferator-activated receptor γ, and activates peroxisome proliferator-activated receptor γ, thereby affecting the differentiation of adipocytes and the synthesis of fat. The activation of PPARγ promotes the maturation and lipid storage of adipocytes, so an appropriate amount of lysine may contribute to the differentiation and lipid storage of adipocytes in muscle tissue, so an appropriate amount of lysine may contribute to the differentiation and lipid storage of adipocytes in muscle tissue.

[0120] While the embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that many changes, modifications, substitutions and variations can be made to the embodiments without departing from the principles and spirit of the invention.

[0121] The present invention and its implementation methods are described above, which is not restrictive. The drawings are only one of the implementation methods of the present invention, and the actual application is not limited thereto. In short, if ordinary technicians in the field are inspired by it and design methods and embodiments similar to the technical solution without creativity without departing from the purpose of the invention, they should all fall within the protection scope of the present invention.

Claims

1. A pig feed for increasing pork intramuscular fat, characterized in that: The pig feed comprises the following components in parts by weight: 100-120 parts of basic feed, 3-4 parts of compound enzyme agent, 5-7 parts of compound probiotic bacteria agent, 1-3 parts of vitamin additive, 20-30 parts of rice bran, 10-15 parts of fat supplement, and 3-6 parts of functional additive; the basic feed comprises the following components in parts by weight: 5-7 parts of corn, 2-4 parts of soybean cake, and 1-3 parts of wheat germ; the raw materials for preparing the functional additive comprise the following components in parts by weight: 10-12 parts of polypeptide polymer, 1-1.5 parts of curcumin, and 0.5-1 part of piperine.

2. A pig feed for increasing pork intramuscular fat according to claim 1, characterized in that: The compound enzyme agent comprises the following components in parts by weight: 1-2 parts of cellulase, 2-3 parts of amylase, and 0.5-1 parts of xylanase; the compound probiotic agent comprises the following components in parts by weight: 1-2 parts of lactic acid bacteria agent, 1-2 parts of yeast agent, and 1-2 parts of Bifidobacterium longum agent.

3. The pig feed for increasing pork intramuscular fat according to claim 2, characterized in that: The vitamin additive comprises the following components in parts by weight: 8-10 parts of vitamin A, 0.5-1 parts of vitamin E, 1-3 parts of vitamin D, 0.2-0.4 parts of vitamin B3, 0.1-0.2 parts of vitamin B5, and 5-7 parts of calcium hydrogen phosphate.

4. The pig feed for increasing pork intramuscular fat according to claim 3, characterized in that: The fat supplement comprises the following components in parts by weight: 2-3 parts of olive oil, 2-3 parts of rapeseed oil, 1-2 parts of soybean oil, 0.2-0.3 parts of fish oil, and 0.1-0.2 parts of linseed oil.

5. A method for preparing a pig feed for increasing pork intramuscular fat according to any one of claims 1 to 4, characterized in that: The specific steps include: S1. Place corn, soybean cake, wheat germ and rice bran in a feed grinder, grind to 0.5-2 mm, add a composite enzyme agent into a fermentation tank, add water for enzymolysis according to a feed-liquid ratio of 1:4, and obtain enzymolysis feed; S2, stirring and mixing the enzymatic feed prepared in step S2 with the probiotic composite bacterial agent, standing for 6-8 hours, adding vitamin additives, fat supplements and functional additives and stirring and mixing to obtain pretreated feed; S3, placing the pre-treated feed prepared in step S2 in a pelletizer for pelleting, placing it at 40-50° C. for drying, and obtaining pig feed with increased pork intramuscular fat.

6. The method for preparing a pig feed for increasing pork intramuscular fat according to claim 5, characterized in that: The preparation method of the functional additive specifically comprises the following steps: K1. Place Boc-Lys(Z)-OH and L-glutamic acid diethyl ester hydrochloride in chloroform, mix and dissolve, add 1-hydroxybenzotriazole, mix well, place at 0°C, add triethylamine, mix, add EDC, place at 23-28°C, stir at 150-180 rpm for 20-28 hours, wash with 5%w NaHCO3 aqueous solution and saturated sodium chloride solution, separate the organic layer, dry with magnesium sulfate, concentrate to remove the organic solvent, and vacuum dry to obtain Boc-Lys-Gly-oET; K2, dissolving the Boc-Lys-Gly-oET prepared in step K1 in dichloromethane, adding trifluoroacetic acid, stirring at room temperature and 150-180 rpm for 6-8 hours, removing the organic solvent by vacuum distillation, adding to the dioxane solution, mixing evenly, adding ether for precipitation, filtering, collecting the precipitate, washing with ether, and vacuum drying to obtain Lys-Gly hydrochloride; K3, dissolving the Lys-Gly hydrochloride prepared in step K2 in 1M phosphate buffer solution, placing at 40°C, adding trypsin, stirring at 800-900 rpm for reaction for 2-3h, centrifuging at 8000-10000 rpm for 15-25min, collecting the precipitate, washing with deionized water, freeze-drying to obtain intermediate product 1, dissolving it in HBr solution, stirring at room temperature for reaction for 2-3h, adding ether for precipitation, filtering, collecting the precipitate, washing with ether, vacuum drying, dissolving it in NaOH aqueous solution, stirring at room temperature for reaction for 12-18h, dialyzing with deionized water to neutrality, freeze-drying to obtain a polypeptide polymer; K4. The polypeptide polymer prepared in step K3 is placed in dimethyl sulfoxide, mixed until completely dissolved, and then the dimethyl sulfoxide solution of curcumin and piperine is added, stirred at a speed of 200 rpm, and after mixing evenly, subjected to ultrasonic treatment at a power of 300 W, dialyzed with deionized water overnight, and freeze-dried to obtain a functional additive.

7. The method for preparing a pig feed for increasing pork intramuscular fat according to claim 6, characterized in that: In step K1, the mass ratio between the Boc-Lys(Z)-OH and L-glutamic acid diethyl ester hydrochloride is 1.4-1.6:1; the mass concentration of the Boc-Lys(Z)-OH in chloroform is 0.1-0.2 g / mL; the mass concentration of the 1-hydroxybenzotriazole in chloroform is 0.08-0.09 g / mL; the added volume of the triethylamine is 8%-10% of the volume of chloroform; and the mass concentration of the EDC in chloroform is 0.1-0.12 g / mL.

8. The method for preparing a pig feed for increasing pork intramuscular fat according to claim 7, characterized in that: In step K2, the mass concentration of Boc-Lys-Gly-oET in dichloromethane is 0.2-0.25 g / mL; the volume ratio of trifluoroacetic acid to dichloromethane is 1-1.2:1.5; the dioxane solution is a solution of dioxane dissolved in 1M hydrochloric acid solution, and the mass concentration of dioxane in the hydrochloric acid solution is 0.1-0.2 g / mL.

9. The method for preparing a pig feed for increasing pork intramuscular fat according to claim 8 is characterized in that: In step K3, the mass concentration of Lys-Gly hydrochloride in the phosphate buffer solution is 15-25 mg / mL, and the pH value of the phosphate buffer solution is 8-8.5; the mass concentration of trypsin in the phosphate buffer solution is 8-10 mg / mL; and the mass concentration of NaOH in the NaOH aqueous solution is 0.08-0.1 g / mL.

10. The method for preparing a pig feed for increasing pork intramuscular fat according to claim 9, characterized in that: In step K4, the mass concentration of the polypeptide polymer in dimethyl sulfoxide is 5-10 mg / mL; the curcumin solution is a solution of curcumin dissolved in dimethyl sulfoxide, wherein the mass concentration of curcumin is 10-20 mg / mL; the piperine solution is a solution of curcumin dissolved in dimethyl sulfoxide, wherein the mass concentration of piperine is 30-40 mg / mL.

Images