Application of novel polypeptide in treatment or prevention of insulin resistance

Abstract

The invention discloses an application of a novel polypeptide in treating or preventing insulin resistance. The amino acid sequence of the polypeptide is as shown in SEQ ID NO: 1; or a sequence as shown in SEQ ID NO: 1; or a polypeptide derivative which is obtained by deleting, inserting or replacing one or more amino acids in the sequence and has the same biological function as the polypeptide molecule. The polypeptide can be used for preparing drugs for preventing and / or treating insulin resistance, drugs for reducing blood sugar level, glycogen synthesis agonists and gluconeogenesis inhibitor drugs.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to application of a novel polypeptide in treating or preventing insulin resistance. Background Art

[0002] Metabolic syndrome includes diabetes, obesity, hypertension and dyslipidemia, and the key factor is insulin resistance (IR) in the body.

[0003] Insulin is an important metabolic hormone produced by pancreatic β cells, which regulates glucose, lipid and protein metabolism and promotes energy balance, growth and aging. Disruption of the insulin signaling (IS) pathway leads to decreased insulin sensitivity, thus inducing IR.

[0004] The causes of IR are multifaceted, complex, and still scientifically controversial. However, given its mechanistic heterogeneity, diverse strategies that can improve insulin sensitivity and / or activate insulin signaling pathways may help improve IR and thus contribute to personalized medicine. Summary of the invention

[0005] The purpose of the present invention is to provide a novel polypeptide for use in treating or preventing insulin resistance.

[0006] To achieve the above object, the present invention provides a polypeptide, characterized in that the amino acid sequence of the polypeptide is as follows:

[0007] 1) shown in SEQ ID NO: 1;

[0008] 2) containing the sequence shown in SEQ ID NO: 1;

[0009] 3) A polypeptide derivative in which one or more amino acids are deleted, inserted or replaced in the sequence of 1) above and which has the same biological function as the polypeptide molecule described in (a) or (b).

[0010] Furthermore, the nucleic acid sequence of the polypeptide is shown in SEQ ID NO:2.

[0011] The present invention also protects the use of the polypeptide in preparing a drug for preventing and / or treating insulin resistance.

[0012] The present invention also protects the use of the polypeptide in preparing a drug for lowering blood sugar levels.

[0013] The present invention also protects the use of the polypeptide in preparing drugs for glycogen synthesis agonists and gluconeogenesis inhibitors.

[0014] Furthermore, the polypeptide has any of the following functions:

[0015] Directly inhibiting the exocytosis of ATG7; and / or

[0016] Activate signaling factors in the IS pathway; and / or

[0017] Increased glycogen synthesis; and / or

[0018] Reduce glucose production and inhibit gluconeogenesis; and / or

[0019] Regulates glucose metabolism.

[0020] Furthermore, the dosage form of the drug is any dosage form that is acceptable in pharmaceutical therapy.

[0021] KTADKKLLLEQAANE. SEQ ID NO:1.

[0022] AAGACTGCAGATAAGAAGCTCCTT TTG GAACAAGCAGCAAATGAG. SEQ ID NO:2.

[0023] The present invention also protects a pharmaceutical composition, characterized in that it comprises the polypeptide and a pharmaceutically acceptable carrier or excipient.

[0024] The present invention first discovered that the cell autophagy-related factor ATG7 is secreted into the body's circulatory system and participates in the regulation of glucose metabolism. Based on this discovery, the inventors of the present invention have found through creative research that the Aap1 polypeptide of the present invention can prevent the ATG7 protein from being secreted outside the cell, thereby affecting glucose metabolism.

[0025] Aap1 polypeptide is derived from the 97-111 amino acid sequence of human ATG7 protein or an ATG7 fragment containing the above amino acid sequence. It can specifically inhibit the exocytosis of ATG7, promote glycogen synthesis, inhibit gluconeogenesis, and thus improve the symptoms of insulin resistance; it only affects the metabolism of glucose, so it has few side effects and a long half-life. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The diagram shows the exocytosis of the cell autophagy-related factor ATG7. a shows that glucose promotes the secretion of ATG7 outside the cell; the left side of b shows that insulin promotes the uptake of ATG7 by cells; the right side of b shows that glucagon promotes the secretion of ATG7 outside the cell.

[0027] Figure 2A diagram showing the involvement of ATG7 in glucose metabolism regulation. a shows that ATG7 protein promotes the increase of glycogen synthesis in primary hepatocytes; b shows that ATG7 protein reduces glucose production in primary hepatocytes.

[0028] Figure 3 A diagram showing Aap1 inhibiting ATG7 exocytosis. a is a schematic diagram of ATG7 protein mutation; b is ATG7-NM mutation inhibiting its secretion to the extracellular space; c is a schematic diagram of Aap1 design; d is Aap1 inhibiting ATG7 secretion to the extracellular space.

[0029] Figure 4 A diagram showing how Aap1 regulates the insulin signaling pathway to affect glucose metabolism. A shows that Aap1 regulates the insulin signaling pathway in HepG2 cells; B shows that Aap1 reduces glucose tolerance in C57 mice. DETAILED DESCRIPTION

[0030] Embodiments of the present invention are described in detail below, and the examples of the embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals represent the same or similar elements or elements with the same or similar functions from beginning to end. The embodiments described below by reference to the accompanying drawings are exemplary, are intended to be used to explain the present invention, and are not to be construed as limitations of the present invention. Those who do not indicate specific techniques or conditions in the embodiments are carried out according to the techniques or conditions described in the documents in this area or according to the product specification. Those who do not indicate the manufacturer of reagents or instruments used are all conventional products that can be obtained commercially.

[0031] 1. General methods involved in the embodiments.

[0032] 1. Immunoprecipitation experiment: Cell culture medium was centrifuged at 800rpm, 4℃ for 5min, the supernatant was quantitatively collected, the corresponding antibody was added, incubated at 4℃ overnight, proteinA / G-beads were added, and incubated at 4℃ for 4-6 hours. After immunoprecipitation reaction, centrifuged at 4℃700g for 5min, the supernatant was discarded, proteinA / G-beads were washed 3 times, 2×SDS loading buffer 40μL was added, 95℃10min, and Western blotting was performed for analysis.

[0033] 2. Culture of primary hepatocytes: C57 mice were killed by cervical dislocation, and the livers were removed, chopped and ground, centrifuged, digested with trypsin, centrifuged, and inoculated on rat tail collagen.

[0034] 3. Liver glycogen detection: primary cultured hepatocytes, liver glycogen determination, specific experimental steps refer to the kit instructions.

[0035] 4. Glucose production assay: Primary cultured embryonic liver cells or hepatocytes were incubated in glucose production medium (sugar-free DMEM without phenol red, 20 mM sodium lactate and 2 mM sodium pyruvate) for 4 hours, the supernatant was taken and the glucose concentration was determined. For specific experimental steps, please refer to the kit instructions. The protein concentration of the sample was determined by the BCA method as a sample calibration.

[0036] 5. In vivo blood glucose level detection: Cut the end of the mouse's tail and use a Roche blood glucose meter and blood glucose test strips to measure the blood glucose level in the mouse.

[0037] 6. Glucose tolerance test: Mice fasted for 16 hours were intraperitoneally injected with glucose, 1 g of glucose per kg of body weight. Blood glucose levels were measured at 0, 15, 30, 50, and 120 minutes. The area under the curve (AUC) of the IPGTT results was calculated using the following formula using blood glucose levels at 0 (BG0), 30 (BG30), 60 (BG60), 90 (BG90), and 120 (BG120) minutes: AUC (min·mg / dL) = 30min×[1 / 2×(BG0+BG120)+1×(BG30+BG60+BG90)].

[0038] 7. Cell culture and transfection: Human liver cancer cell line HepG2 was cultured in MEM containing 10% FBS and 1% NEAA, human liver cancer cell line Huh7 was cultured in DMEM containing 10% FBS, and primary hepatocytes were cultured in DMEM containing 15% FBS. All transfections were performed using Lipofectamin 3000 (Invitrogen).

[0039] 8. Plasmid construction and point mutation: GFP-ATG7, GFP-NM, and GFP-CM were constructed. The specific experimental steps are shown in the kit instructions. The sequence of ATG7 is shown in SEQ ID NO: 3, the sequence of NM is shown in SEQ ID NO: 4 (wherein 313-315 bp of GCN represents GCT / GCA / GCC / GCG), and the sequence of CM is shown in SEQ ID NO: 5 (wherein 1714-1716 bp can also be TCA / TCC / TGC / AGT / AGC).

[0040] ATG7 WT (SEQ ID NO: 3):

[0041] ATGGCGGCAGCTACGGGGGATCCTGGACTCTCTAAACTGCAGTTTGCCCCTTTTAGTAGTGCCTTGGATGTTGGGTTTT

[0042] GGCATGAGTTGACCCAGAAGAAGCTGAACGAGTATCGGCTGGATGAAGCTCCCAAGGACATTAAGGGTTATTACTACAA

[0043] TGGTGACTCTGCTGGGCTGCCAGCTCGCTTAACATTGGAGTTCAGTGCTTTTGACATGAGTGCTCCCACCCCAGCCCGT

[0044] TGCTGCCCAGCTATTGGAACACTGTATAACACCAACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTTTTGG

[0045] AACAAGCAGCAAATGAGATATGGGAATCCATAAAATCAGGCACTGCTCTTGAAAACCCTGTACTCCTCAACAAGTTCCT

[0046] CCTCTTGACATTTGCAGATCTAAAGAAGTACCACTTCTACTATTGGTTTTGCTATCCTGCCCTCTGTCTTCCAGAGAGT

[0047] TTACCTCTCATTCAGGGGCCAGTGGGTTTGGATCAAAGGTTTTCACTAAAACAGATTGAAGCACTAGAGTGTGCATATG

[0048] ATAATCTTTGTCAAACAGAAGGAGTCACAGCTCTTCCTTACTTCTTAATCAAGTATGATGAGAACATGGTGCTGGTTTC

[0049] CTTGCTTAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACGAAGATAACAATTGGTGTATATGATCCCTGTAACTTA

[0050] GCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTAGCAGCCCACAGATGGAGTAGCAGTTTCCAGTCTGTTG

[0051] AAGTTGTTTGCTTCCGTGACCGTACCATGCAGGGGGCGAGAGACGTTGCCCACAGCATCATCTTCGAAGTGAAGCTTCC

[0052] AGAAATGGCATTTAGCCCAGATTGTCCTAAAGCAGTTGGATGGGAAAAGAACCAGAAAGGAGGCATGGGACCAAGGATG

[0053] GTGAACCTCAGTGAATGTATGGACCCTAAAAGGTTAGCTGAGTCATCAGTGGATCTAAATCTCAAACTGATGTGTTGGA

[0054] GATTGGTTCCTACTTTAGACTTGGACAAGGTTGTGTCTGTCAAATGTCTGCTGCTTGGAGCCGGCACCTTGGGTTGCAA

[0055] TGTAGCTAGGACGTTGATGGGTTGGGGCGTGAGACACATCACATTTGTGGACAATGCCAAGATCTCCTACTCCAATCCT

[0056] GTGAGGCAGCCTCTCTATGAGTTTGAAGATTGCCTAGGGGGTGGTAAGCCCAAGGCTCTGGCAGCAGCGGACCGGCTCC

[0057] AGAAAATATTCCCCGGTGTGAATGCCAGAGGATTCAACATGAGCATACCTATGCCTGGGCATCCAGTGAACTTCTCCAG

[0058] TGTCACTCTGGAGCAAGCCCGCAGAGATGTGGAGCAACTGGAGCAGCTCATCGAAAGCCATGATGTCGTCTTCCTATTG

[0059] ATGGACACCAGGGAGAGCCGGTGGCTTCCTGCCGTCATTGCTGCAAGCAAGAGAAAGCTGGTCATCAATGCTGCTTTGG

[0060] GATTTGACACATTTGTTGTCATGAGACATGGTCTGAAGAAACCAAAGCAGCAAGGAGCTGGGGACTTGTGTCCAAACCA

[0061] CCCTGTGGCATCTGCTGACCTCCTGGGCTCATCGCTTTTTGCCAACATCCCTGGTTACAAGCTTGGCTGCTACTTCTGC

[0062] AATGATGTGGTGGCCCCAGGAGATTCAACCAGAGACCGGACCTTGGACCAGCAGTGCACTGTGAGTCGTCCAGGACTGG

[0063] CCGTGATTGCAGGAGCCCTGGCCGTGGAATTGATGGTATCTGTTTTGCAGCATCCAGAAGGGGGCTATGCCATTGCCAG

[0064] CAGCAGTGACGATCGGATGAATGAGCCTCCAACCTCTCTTGGGCTTGTGCCTCACCAGGTTCTTGATCAATATGAACGA

[0065] GAAGGATTTAACTTCCTAGCCAAGGTGTTTAATTCTTCACATTCCTTCTTAGAAGACTTGACTGGTCTTACATTGCTGCATCAAGAAACCCAAGCTGCTGAGATCTGGGACATGAGCGATGATGAGACCATCTGA。

[0066] ATG7 NM(SEQ ID NO:4), where N represents A, T, G, C:

[0067] ATGGCGGCAGCTACGGGGGATCCTGGACTCTCTAAACTGCAGTTTGCCCCTTTTAGTAGTGCCTTGGATGTTGGGTTTT

[0068] GGCATGAGTTGACCCAGAAGAAGCTGAACGAGTATCGGCTGGATGAAGCTCCCAAGGACATTAAGGGTTATTACTACAA

[0069] TGGTGACTCTGCTGGGCTGCCAGCTCGCTTAACATTGGAGTTCAGTGCTTTTGACATGAGTGCTCCCACCCCAGCCCGT

[0070] TGCTGCCCAGCTATTGGAACACTGTATAACACCAACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTT GCN G

[0071] AACAAGCAGCAAATGAGATATGGGAATCCATAAAATCAGGCACTGCTCTTGAAAACCCTGTACTCCTCAACAAGTTCCT

[0072] CCTCTTGACATTTGCAGATCTAAAGAAGTACCACTTCTACTATTGGTTTTGCTATCCTGCCCTCTGTCTTCCAGAGAGT

[0073] TTACCTCTCATTCAGGGGCCAGTGGGTTTGGATCAAAGGTTTTCACTAAAACAGATTGAAGCACTAGAGTGTGCATATG

[0074] ATAATCTTTGTCAAACAGAAGGAGTCACAGCTCTTCCTTACTTCTTAATCAAGTATGATGAGAACATGGTGCTGGTTTC

[0075] CTTGCTTAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACGAAGATAACAATTGGTGTATATGATCCCTGTAACTTA

[0076] GCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTAGCAGCCCACAGATGGAGTAGCAGTTTCCAGTCTGTTG

[0077] AAGTTGTTTGCTTCCGTGACCGTACCATGCAGGGGGCGAGAGACGTTGCCCACAGCATCATCTTCGAAGTGAAGCTTCC

[0078] AGAAATGGCATTTAGCCCAGATTGTCCTAAAGCAGTTGGATGGGAAAAGAACCAGAAAGGAGGCATGGGACCAAGGATG

[0079] GTGAACCTCAGTGAATGTATGGACCCTAAAAGGTTAGCTGAGTCATCAGTGGATCTAAATCTCAAACTGATGTGTTGGA

[0080] GATTGGTTCCTACTTTAGACTTGGACAAGGTTGTGTCTGTCAAATGTCTGCTGCTTGGAGCCGGCACCTTGGGTTGCAA

[0081] TGTAGCTAGGACGTTGATGGGTTGGGGCGTGAGACACATCACATTTGTGGACAATGCCAAGATCTCCTACTCCAATCCT

[0082] GTGAGGCAGCCTCTCTATGAGTTTGAAGATTGCCTAGGGGGTGGTAAGCCCAAGGCTCTGGCAGCAGCGGACCGGCTCC

[0083] AGAAAATATTCCCCGGTGTGAATGCCAGAGGATTCAACATGAGCATACCTATGCCTGGGCATCCAGTGAACTTCTCCAG

[0084] TGTCACTCTGGAGCAAGCCCGCAGAGATGTGGAGCAACTGGAGCAGCTCATCGAAAGCCATGATGTCGTCTTCCTATTG

[0085] ATGGACACCAGGGAGAGCCGGTGGCTTCCTGCCGTCATTGCTGCAAGCAAGAGAAAGCTGGTCATCAATGCTGCTTTGG

[0086] GATTTGACACATTTGTTGTCATGAGACATGGTCTGAAGAAACCAAAGCAGCAAGGAGCTGGGGACTTGTGTCCAAACCA

[0087] CCCTGTGGCATCTGCTGACCTCCTGGGCTCATCGCTTTTTGCCAACATCCCTGGTTACAAGCTTGGCTGCTACTTCTGC

[0088] AATGATGTGGTGGCCCCAGGAGATTCAACCAGAGACCGGACCTTGGACCAGCAGTGCACTGTGAGTCGTCCAGGACTGG

[0089] CCGTGATTGCAGGAGCCCTGGCCGTGGAATTGATGGTATCTGTTTTGCAGCATCCAGAAGGGGGCTATGCCATTGCCAG

[0090] CAGCAGTGACGATCGGATGAATGAGCCTCCAACCTCTCTTGGGCTTGTGCCTCACCAGGTTCTTGATCAATATGAACGA

[0091] GAAGGATTTAACTTCCTAGCCAAGGTGTTTAATTCTTCACATTCCTTCTTAGAAGACTTGACTGGTCTTACATTGCTGCATCAAGAAACCCAAGCTGCTGAGATCTGGGACATGAGCGATGATGAGACCATCTGA。

[0092] ATG7 CM(SEQ ID NO:5)

[0093]

[0094] 9. Western blotting: cells were lysed in RIPA lysis buffer at 4°C for 30 min, centrifuged at 13000 rpm at 4°C for 20 min, and the supernatant was taken. The protein concentration of the samples was determined by BCA method and adjusted to the same concentration. The loading buffer was added, mixed and then subjected to SDS polyacrylamide gel electrophoresis at 95°C for 10 min, and the protein was transferred to PVDF membrane, blocked with 5% skim milk at room temperature for 1 hour, and the primary antibody was diluted to the appropriate concentration with antibody diluent, and incubated at 4°C overnight. After washing with PBST 3 times, the secondary antibody was incubated at room temperature for 1-4 hours, washed with PBST 3 times, and developed with ECL.

[0095] 2. Antibodies, kits and drugs used in the experiments in the examples.

[0096] 1.BIOVISION's glycogen detection kit.

[0097] 2. Sigma's glucose test kit.

[0098] 3. The commercial antibodies used in the experiments in the examples were from the following companies.

[0099] 1. Sigma's rabbit anti-ATG7 antibody, mouse anti-GFP antibody, and mouse anti-α-tubulin antibody.

[0100] 2. Rabbit anti-phosphorylated AKT and rabbit anti-GFP antibodies from CST.

[0101] 4. Unless otherwise specified, other drugs and reagents in the examples are from Sigma.

[0102] 5. Experimental animals: C57 mice were obtained from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.

[0103] 6. The Aap1 peptide (KTADKKLLLEQAANE, SAEQ ID NO: 1) of this application was directly synthesized by Shanghai Qiangyao Biotechnology Co., Ltd.

[0104] Example 1: Immunoprecipitation assay to detect exocytosis of autophagy-related factor ATG7

[0105] 1.1 Glucose concentration affects ATG7 excretion

[0106] HepG2 cells were cultured in the absence of glucose or with normal glucose for 24 hours, and the expression level of ATG7 in the culture medium was detected by immunoprecipitation assay, see General Methods 1 and 7.

[0107] The results showed that compared with HepG2 cells cultured without glucose, the protein level of ATG7 in the cell culture medium cultured with normal glucose was significantly reduced; the ATG7 protein level in the cells was significantly increased. Figure 1 A.

[0108] 1.2 Insulin inhibits the exocytosis of ATG7.

[0109] HepG2 cells were stimulated with insulin (100 ng / ml) for 4 hours, and the expression level of ATG7 in the culture medium was detected by immunoprecipitation assay, see General Methods 1 and 7.

[0110] The results showed that compared with the control cells (HepG2 cells without insulin), the ATG7 protein level in the insulin-stimulated cell culture medium was significantly reduced; the ATG7 protein level in the cells was significantly increased. Figure 1 Left image of b.

[0111] 1.3 Glucagon promotes the exocytosis of ATG7.

[0112] HepG2 cells were stimulated with glucagon (2 ng / ml) for 1 hour, and the expression level of ATG7 in the culture medium was detected by immunoprecipitation assay, see General Methods 1 and 7.

[0113] The results showed that compared with the control cells (HepG2 cells without glucagon), the ATG7 protein level in the cell culture medium stimulated by glucagon was significantly increased; the ATG7 protein level in the cells was significantly decreased, as shown in Figure 2. Figure 1 Right picture of b.

[0114] Example 2 ATG7 is involved in the regulation of glucose metabolism

[0115] 2.1 Detection of glucose metabolism in primary hepatocytes.

[0116] 2.1.1 Cultivation of primary hepatocytes, see General Method 2.

[0117] 2.1.2 Detection of glycogen synthesis and glucose production in primary hepatocytes, see General Methods 3 and 4.

[0118] Primary hepatocytes were stimulated with ATG7 protein (2 μM) for 24 hours, and the expression level of ATG7 in the culture medium was detected by immunoprecipitation assay, see General Methods 1 and 7.

[0119] The results showed that administration of ATG7 protein (2 μM) increased glycogen synthesis and decreased glucose production in primary hepatocytes. Figure 2 a and b. The ctrl control is primary hepatocytes without ATG7 protein administration.

[0120] Example 3 The polypeptide Aap1 of the present invention inhibits the exocytosis of ATG7

[0121] 3.1ATG7 NM site mediates its excretion.

[0122] Huh7 cells were transfected with ATG7 wild type (WT), 104 site mutant plasmid (NM) and 571 site mutant plasmid (CM, ATG7 E1 active site), and the expression level of ATG7 in the culture medium was detected by immunoprecipitation, see General Methods 7 and 8. CM is a positive control for mutant plasmids, proving that only the 104 site mediates the excretion of ATG7.

[0123] The results showed that the mutation at position 104 mediated the exocytosis of ATG7. Figure 3 3 of a and 3 of b.

[0124] 3.2Aap1 inhibits the exocytosis of ATG7.

[0125] Aap1 was designed and synthesized based on the 104 site-mediated ATG7 excretion. Huh7 cells were transfected with GFP-ATG7 for 24 hours, and then given Aap1 for 24 hours to detect the expression level of ATG7 in the culture medium.

[0126] The results showed that Aap1 inhibited the exocytosis of ATG7. Figure 3 c and d.

[0127] Example 4 Aap1 regulates the insulin signaling pathway to affect glucose metabolism

[0128] 4.1Aap1 promotes the insulin signaling pathway.

[0129] HepG2 cells were treated with Aap1 (2 μM) and then detected by WB, see General Method 7.

[0130] The results showed that after administration of Aap1, the expression level of ATG7 in cells increased significantly, and the downstream signal AKT was activated. Figure 4 A.

[0131] 4.2 C57 mice were intraperitoneally injected with Aap1 (0.5 mg / kg, n=5), and 24 hours later, a glucose tolerance test was performed, see General Method 6.

[0132] The results showed that after Aap1 was administered to C57 mice, glucose tolerance was impaired. Figure 4 b.

[0133] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and intent of the present invention.

Claims

1. A polypeptide, characterized in that The amino acid sequence of the polypeptide is as follows: 1) shown in SEQ ID NO: 1; 2) containing the sequence shown in SEQ ID NO: 1; 3) A polypeptide derivative in which one or more amino acids are deleted, inserted or replaced in the sequence of 1) above and which has the same biological function as the polypeptide molecule described in (a) or (b).

2. The polypeptide according to claim 1, characterized in that The nucleic acid sequence of the polypeptide is shown in SEQ ID NO:

2.

3. Use of the polypeptide according to claim 1 in the preparation of a drug for preventing and / or treating insulin resistance.

4. Use of the polypeptide according to claim 1 in the preparation of a drug for lowering blood sugar levels.

5. Use of the polypeptide according to claim 1 in the preparation of drugs for glycogen synthesis agonists and gluconeogenesis inhibitors.

6. The use according to any one of claims 3 to 5, characterized in that: The polypeptide has any of the following functions: Directly inhibiting the exocytosis of ATG7; and / or Activate signaling factors in the IS pathway; and / or Increased glycogen synthesis; and / or Reduce glucose production and inhibit gluconeogenesis; and / or Regulates glucose metabolism.

7. The use according to any one of claims 3 to 5, characterized in that: The dosage form of the drug is any pharmaceutically therapeutically acceptable dosage form.

8. A pharmaceutical composition, characterized in that The composition comprises the polypeptide according to claim 1 or 2 and a pharmaceutically acceptable carrier or excipient.

Images