Bacterial strain for preparing glycollic acid through whole-cell catalysis of ethylene glycol and construction method and application of bacterial strain

Abstract

The invention discloses a strain for preparing glycollic acid through whole-cell catalysis of ethylene glycol and a construction method and application of the strain, escherichia coli serves as host bacteria, propylene glycol oxidoreductase fucO mutant fucOI6L, L7V genes, acetaldehyde dehydrogenase aldA genes and glycollic aldehyde reductase ycdW genes are over-expressed in the host bacteria to obtain a recombinant strain E.coli GA-02, namely the strain, the E.coli GA-02 can catalyze 400 mM of ethylene glycol to prepare 367.73 mM of glycollic acid, and the E.coli GA-02 can catalyze 400 mM of ethylene glycol to prepare glycollic acid. The yield reaches 91.93%, efficient conversion from ethylene glycol to glycollic acid is realized, and conversion from glycollic acid to a downstream byproduct glyoxylic acid is avoided. The recombinant strain E.coli GA-02 constructed by the invention has important significance in the aspect of high-value conversion of waste carbon resources containing ethylene glycol, such as polyethylene glycol terephthalate (PET) plastic depolymers, and also provides a support technology for efficient preparation of glycollic acid.

Description

Technical Field

[0001] The invention relates to the fields of genetic engineering technology and biocatalysis technology, and in particular to a strain capable of preparing glycolic acid by catalyzing ethylene glycol with whole cells, a construction method and application thereof. Background Art

[0002] Glycolic acid and its polymers are widely used in cosmetics, surgical sutures and other fields. Traditional chemical synthesis has problems such as highly toxic raw materials, difficult product separation, and high production costs.

[0003] With the growing global demand for sustainable and environmentally friendly technologies, the development of bioconversion technology from ethylene glycol to glycolic acid has received widespread attention. Ethylene glycol is a chemical monomer widely used in the production of plastics and other synthetic materials, while glycolic acid is an important bio-based platform compound that can be used to produce a variety of chemicals and materials. Through bioconversion technology, ethylene glycol produced by plastic depolymerization can be converted into glycolic acid, which not only realizes the high-value utilization of plastic waste and reduces environmental pollution, but also provides a new source of raw materials for the fermentation industry.

[0004] Since the research on the production of glycolic acid by microbial fermentation began, a variety of engineered strains, including Saccharomyces cerevisiae, Escherichia coli, Kluyveromyces lactis, and Corynebacterium glutamicum, have been used for glycolic acid biosynthesis. Various carbon sources such as xylose and glucose have also been used as substrates for the fermentation synthesis of glycolic acid. Technical means such as whole-cell catalysis, enzyme catalysis, metabolic engineering, and synthetic biology have been used to improve the yield and conversion rate of glycolic acid. The development of microbial fermentation production technology can, on the one hand, reduce dependence on fossil fuels and promote the production of bio-based chemicals; on the other hand, it provides a new way for plastic recycling and reuse, helps to build a circular economy, and realize the green transformation of the plastics industry. In addition, as a multifunctional bio-based platform compound, the wide application of glycolic acid has further enhanced the market potential and environmental value of this technology. Therefore, the development of bioconversion technology from ethylene glycol to glycolic acid is of great strategic significance for promoting the sustainable development of the chemical industry.

[0005] In recent years, the demand for glycolic acid has increased significantly. It is expected that in the future, the demand in high-end fields such as medicine and polymer materials will continue to grow, thereby promoting the expansion of the 99% solid glycolic acid product market. Therefore, in order to adapt to this trend, the glycolic acid industry will be more inclined to develop new purification processes to produce high-content, high-quality superior products. At present, the existing technology of Escherichia coli using ethylene glycol whole cells to catalyze glycolic acid is mostly to knock out the downstream pathway for by-products, or design oxygen valves for dynamic regulation, and there is no report on the construction of the reflux path. Summary of the invention

[0006] The first object of the present invention is to provide a strain that catalyzes ethylene glycol to produce glycolic acid.

[0007] To achieve the above object, the present invention adopts the following technical solution: A strain for catalyzing ethylene glycol to produce glycolic acid with whole cells, wherein the strain uses Escherichia coli as a host bacterium and overexpresses propanediol oxidoreductase in the host bacterium fucO Mutants fucO I6L,L7V Gene, aldehyde dehydrogenase aldA Gene, glycolaldehyde reductase ycdW Genes obtained.

[0008] As a preferred embodiment, the aldA Gene ID: 945672, ycdW Gene ID: 946431, the mutant fucO I6L,L7V It is an I6L, L7V mutant of propanediol oxidoreductase shown in Gene ID: 947273. The I6L, L7V mutant refers to the amino acid I (isoleucine) at the 6th position in the amino acid sequence of the enzyme mutated to L (leucine), and the L (leucine) at the 7th position mutated to V (valine).

[0009] As a preferred embodiment, the fucO I6L,L7V Gene, aldA Genes and ycdW The gene expression vector used was pET-29a(+).

[0010] As a preferred embodiment, the host bacteria is Escherichia coli Escherichia coli BL21.

[0011] As a preferred embodiment, the fucO I6L,L7V , aldA , ycdW The three genes were connected by primers carrying inserted RBS sequences.

[0012] The second object of the present invention is a method for constructing the above-mentioned strain, comprising: The fucO I6L,L7V Gene, aldA Gene, ycdW The gene is connected to the expression vector to obtain a recombinant plasmid; The recombinant plasmid is introduced into a host bacterium for expression to obtain the strain.

[0013] The third object of the present invention is to provide a whole-cell catalyst, which contains the above-mentioned strain.

[0014] As a preferred embodiment, the whole-cell catalyst is the bacterial cell of the strain after protein induction expression.

[0015] As a preferred embodiment, the whole-cell catalyst is prepared by: culturing the strain until the cell concentration reaches a preset value, adding IPTG to induce protein expression; and centrifuging the culture fluid after induced expression to obtain cells, i.e., the whole-cell catalyst.

[0016] The fourth object of the present invention is to provide the use of the above-mentioned strain or whole-cell catalyst in the preparation of glycolic acid.

[0017] As a preferred embodiment, ethylene glycol is used as a substrate, the strain / whole cell catalyst is used as a catalyst, and PB buffer is used as a catalytic system to carry out whole cell catalytic conversion.

[0018] As a preferred embodiment, the pH of the PB buffer is 7.0-9.5; the concentration of the PB buffer is 50 mM-400 mM; and the catalytic temperature is 25°C-45°C.

[0019] The present invention has the following beneficial effects: (1) The present invention uses genetic engineering and biocatalysis technology to construct a recombinant plasmid pET-29a(+)- fucO* -RBS- aldA , and transformed into Escherichia coli BL21, ethylene glycol whole cells catalyzed the production of glycolic acid, and further overexpressed glycolaldehyde reductase for the spontaneous conversion of glycolic acid to glyoxylic acid ycdW , achieving the conversion and reflux of ethanolaldehyde into glycolic acid, and obtaining a recombinant strain of Escherichia coli that can utilize ethylene glycol whole-cell catalysis to prepare glycolic acid, achieving the efficient conversion of glycolic acid using Escherichia coli as the chassis and ethylene glycol whole-cell catalysis.

[0020] (2) The present invention provides a new idea for the high-value conversion of waste carbon resources containing ethylene glycol, such as polyethylene terephthalate (PET) and other polymers, and also provides a cheap raw material for the biosynthesis of glycolic acid. It has practical significance and guiding value for the biosynthesis of glycolic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a metabolic catalytic roadmap of recombinant Escherichia coli.

[0022] Figure 2 It is double enzyme digestion verification pET- fucO* -RBS- aldA Plasmid results diagram.

[0023] Figure 3 pET -ycdW-fucO* - aldA Plasmid results diagram.

[0024] Figure 4 This is a protein expression gel map, protein size: fucO :40.5kDa; aldA :52.3kDa; ycdW :35.3kDa.

[0025] Figure 5 pET-29a(+)- fucO* -RBS- aldA Plasmid maps.

[0026] Figure 6 pET-29a(+) -ycdW-fucO* - aldA Plasmid maps.

[0027] Figure 7 yes E. coli GA-01 and E. coli The yield of glycolic acid and glyoxylic acid catalyzed by GA-02 ethylene glycol whole cells.

[0028] Figure 8 These are graphs of glycolic acid production during the optimization process of the whole-cell catalytic system, including (a) graph of glycolic acid production during whole-cell catalytic temperature optimization; (b) graph of glycolic acid production during whole-cell catalytic PB buffer concentration optimization; and (c) graph of glycolic acid production during whole-cell catalytic pH optimization. DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and specific implementation methods.

[0030] Material: 1. Escherichia coli Escherichia coli DH5α competent cell (General Biotechnology (Anhui) Co., Ltd.) 2. Escherichia coli Escherichia coli BL21(DE3) competent cells (General Biotechnology (Anhui) Co., Ltd.) 3. High-fidelity DNA polymerase 2 × Phanta Max Master Mix (Nanjing Novozymes Co., Ltd.).

[0031] 4. Colony PCR enzyme Green Taq Master Mix (Nanjing Novozyme Co., Ltd.) 5. ClonExpressII One Step Cloning Kit (Nanjing Novogene Corporation).

[0032] 6. Restriction endonucleases such as EcoRI, XhoI, NedI, etc. 7. Plasmid extraction kit (Beijing Zhuangmeng International Biogene Technology Co., Ltd.).

[0033] 8. DNA gel recovery kit (Beijing Zhuangmeng International Biogene Technology Co., Ltd.).

[0034] 9.Kanamycin, Sinopharm Chemical Reagent Co., Ltd.

[0035] 10. Luria-Bertani (LB) liquid medium (g / L): peptone 10, yeast extract 5, sodium chloride 10.

[0036] 11. Luria-Bertani (LB) solid medium (g / L): peptone 10, yeast extract powder 5, sodium chloride 10, agar powder 20.

[0037] 12. Transformant screening medium (g / L): peptone 20, yeast extract 10, glucose 20, ampicillin 0.1 / kanamycin.

[0038] 13. Terrific Broth (TB) liquid culture medium (g / L): peptone 11.8, yeast extract powder 23.6, KH2PO4 2.2, K2HPO4 9.4, glycerol 4. Peptone and yeast extract powder are dissolved in 900 mL of water, KH2PO4, K2HPO4, and glycerol are dissolved in 100 mL of water, and sterilized separately in an autoclave at 115°C for 15 min. When the temperature drops below 60°C, mix the above two solutions.

[0039] 14. Catalytic system (g / L): 50 mM PB buffer (pH = 7.0): KH2PO4 2.7218, K2HPO4·3H2O6.8466.

[0040] In the embodiment fucO Mutants fucO I6L,L7V for fucO The (I6L, L7V) mutant, referred to herein as fucO* .

[0041] Example 1: Construction of ethylene glycol to glycolic acid pathway (1) According to NCBI report Escherichia coli MG1655 source fucO (Gene ID: 947273) and aldA (Gene ID: 945672) DNA sequence,Escherichia coli MG1655 genome was used as template, double-digested pET-29a(+) was used as vector (EcoRI and XhoI restriction sites), and primers were designed. fucO* -F / R and aldA -F / R was used for PCR amplification to obtain the target gene. fucO* -F primer amplification fucO Perform site-directed mutagenesis on the sixth and seventh amino acids to obtain fucO Mutants fucO* .

[0042] fucO* -F 5'-CCATGGCTGATATCGGATCCATGGCTAACAGAATGCTGGTGAAC-3' (EcoRI restriction site) fucO* -R 5'-GAACGGGTACTGACATTATATCTCCTTTTTACCAGGCGG-3' aldA -F 5'- ACCATACCGCCTGGTAAAAGGAGATATAATGTCAGTACCCGTTC-3' aldA -R 5'- TCGACGGAGCTCGAATTCCCCATTCGCCAATCCGGATATAG -3' (XhoI restriction site) Will fucO* and aldA After the gene amplification fragments were purified and recovered, they were cloned and connected with the pET-29a(+) vector plasmid after enzyme digestion, purification and recovery. The RBS sequence (AAGGAG) was inserted through the primer carrier. fucO* and aldA The fragments were transformed into DH5α Escherichia coli competent cells, positive transformants were screened on kanamycin resistance plates, plasmids were extracted, and double enzyme digestion was performed with restriction endonucleases XhoI and NdeI. After enzyme digestion, two enzyme-cut fragments of about 5.2 kb and 2.7 kb were obtained by agarose gel electrophoresis. The plasmid was named pET-29a(+)- fucO* -RBS- aldA , and the transformants were sequenced.

[0043] (2) pET-29a(+)- fucO* -RBS- aldAThe plasmid was transformed into BL21 (DE3) Escherichia coli competent cells by chemical transformation, and positive transformants were screened on kanamycin resistance plates. The plasmid was extracted and single enzyme digestion was verified using restriction endonuclease NdeI. After digestion, a 7.9 kb enzyme fragment was obtained by agarose gel electrophoresis. The positive transformants were inoculated into 5 mL LB liquid culture medium and cultured at 37 ° C overnight to obtain seed liquid. The seed liquid was inoculated into a 2L shake flask containing 500 mL LB at a 1% inoculation rate and cultured at 37 ° C until OD 600 The concentration of IPTG was 0.6-0.8, and 1mM IPTG was added. The cells were cultured at 18°C ​​to induce protein expression. After 24 hours, the cells were centrifuged at 2266×g for 10 minutes, the supernatant was discarded, and the bacterial sludge was collected. The bacterial sludge was resuspended in 50mM PB (pH=7.0) buffer and ultrasonically broken until clear. The cells were centrifuged at 8000rpm for 20 minutes, and protein expression was detected by protein electrophoresis. Figure 4 The final constructed E. coli was named E.coli GA-1.

[0044] Example 2: Construction of glycolate reflux pathway (1) According to NCBI report Escherichia coli MG1655 source ycdW (Gene ID: 946431), Escherichia coli MG1655 genome was used as template, and pET-29a(+)- fucO* -RBS- aldA Design primers for vector ycdW -F / R was used for PCR amplification to obtain the target gene.

[0045] ycdW -F 5'- TGATATCGGATCCGAATTCATGGATATCATCTTTTATC-3' ycdW- R 5'-TTCTGTTAGCCATGAATTCTATATCTCCTTTTAGTAGCCGCG-3' Will ycdW After the gene amplification fragment is purified and recovered, it is compared with the pET-29a(+)- fucO* -RBS- aldA The vector plasmid was cloned and connected for single fragments, and the RBS sequence (AAGGAG) was inserted by primer carrying ycdW and fucOThe fragments were transformed into DH5α Escherichia coli competent cells, positive transformants were screened on kanamycin resistance plates, plasmids were extracted, and single enzyme digestion verification was performed using restriction endonuclease NdeI. After enzyme digestion, an enzyme digestion fragment of about 8.9 kb was obtained by agarose gel electrophoresis to obtain plasmid pET-29a(+)- ycdW- RBS- fucO* -RBS- aldA, Hereinafter referred to as pET-29a(+)- ycdW - fucO* - aldA , and the transformants were sequenced.

[0046] (2) pET-29a(+)- ycdW - fucO* - aldA The plasmid was transformed into competent E. coli cells including BL21 (DE3), and positive transformants were screened on kanamycin-resistant plates. The plasmid was extracted and single digestion was verified using restriction endonuclease NdeI. After digestion, a 8.9 kb digestion fragment was obtained by agarose gel electrophoresis. The positive transformants were inoculated into 5 mL LB liquid medium and cultured at 37 ° C overnight to obtain seed liquid. The seed liquid was inoculated into a 2L shake flask containing 500 mL LB at a 1% inoculation rate and cultured at 37 ° C until OD 600 The concentration of IPTG was 0.6-0.8, and 1mM IPTG was added. The culture was cultured at 18℃ to induce protein expression. After 24 hours, the cells were centrifuged at 2266×g for 10 minutes, the supernatant was discarded, and the bacterial sludge was collected. The bacterial sludge was resuspended in 50mM PB (pH=7.0) buffer and ultrasonically broken until clear. The cells were centrifuged at 8000rpm for 20 minutes, and protein expression was detected by protein electrophoresis. Figure 4 The final engineered bacteria was named E.coli GA-2.

[0047] Embodiment 3: E.coli GA-1 and E.coli Experiment on the production of glycolic acid by GA-2 strain using ethylene glycol (1) Culture medium Seed solution LB medium (g / L): sodium chloride 10, tryptone 10, yeast extract powder 5.

[0048] Fermentation TB medium (g / L): see Material 13.

[0049] (2) Whole-cell catalytic bacteria collection experiment: Pick the activated cells from the plate E.coli GA-1 and E.coliGA-2 strains were inoculated into 5 mL of liquid LB medium and cultured at 37 °C and 200 rpm for 12 h to obtain seed solution; the seed solution was inoculated into a 2L shake flask containing 500 mL of LB at 1% inoculum and cultured at 37 °C until OD600 was 0.6-0.8, and 2 mM IPTG was added and cultured at 18 °C to induce protein expression. After 24 h, centrifuged at 2266 × g for 10 min, discarded the supernatant, resuspended in 50 mM PB (pH = 7.0) buffer, centrifuged again, removed the residual culture medium, and collected the cells.

[0050] (3) Experiment on the preparation of glycolic acid by whole-cell catalysis of ethylene glycol: Accurately weigh 0.6207 g of reagent-grade ethylene glycol into a 100-mL volumetric flask, dilute to volume with 50 mM PB (pH = 7.0) buffer, and prepare a catalytic system containing 100 mM ethylene glycol as a substrate.

[0051] Accurately weigh the collected in (2) E.coli GA-1 and E.coli 1.05 g of GA-2 cells were placed in a 100 mL shake flask and resuspended in 20 mL of a catalytic system containing 100 mM ethylene glycol as a substrate. The reaction was incubated at 40 °C and 200 rpm for 8 h, during which 4 M NaOH was used to maintain a constant pH of 7.0.

[0052] The whole-cell catalytic system was used to measure the production of glycolic acid and glyoxylic acid using high performance liquid chromatography. The results showed that the recombinant Escherichia coli strain constructed by the present invention produced glycolic acid and glyoxylic acid under the catalytic conditions of a substrate concentration of 100 mM, a catalytic temperature of 40°C, a catalytic system of 50 mM Pb buffer, and a constant pH of 7.0. E.coli The accumulation of glyoxylate in GA-1 was 2.23 mM, and the production of glycolate was 92.93 mM. E.coli The accumulation of GA-2 glyoxylate was 1.65 mM, the production of glycolate was 97.80 mM, and the yield was 97.80%. E.coli GA-2 compared to E.coli The yield of GA-1 increased by 5.24% and the accumulation of glyoxylic acid decreased by 26.00%. E.coli GA-2 catalyzed the conversion of substrate concentrations from 0 to 300 mM, with yields greater than 70%, while the yield at 400 mM was only 51.17%.

[0053] Embodiment 4: E.coli Experiment on optimization of catalytic conditions of GA-2 strain E.coli GA-2 cells were prepared using the method described in (1)-(2) in Example 3.

[0054] (1) Experiment on temperature optimization of the catalytic process of preparing glycolic acid by whole-cell catalysis of ethylene glycol: Accurately weigh 2.4828 g of reagent-grade ethylene glycol into a 100 mL volumetric flask, dilute to volume with 50 mM PB (pH = 7.0) buffer, and prepare a catalytic system containing 400 mM ethylene glycol as a substrate.

[0055] Accurately weigh E.coli 1.05 g of GA-2 cells were placed in a 100 mL shaking flask and resuspended in 20 mL of a catalytic system containing 400 mM ethylene glycol as a substrate. The cells were catalyzed at 25°C, 30°C, 35°C, 40°C, and 45°C at 200 rpm for 72 h. During the catalytic period, 4 M NaOH was used to maintain a constant pH of 7.0.

[0056] (2) pH optimization experiment of the catalytic process of preparing glycolic acid by whole-cell catalysis of ethylene glycol: Accurately weigh 2.4828 g of reagent-grade ethylene glycol into a 100 mL volumetric flask, dilute to volume with 50 mM PB (pH = 7.0) buffer, and prepare a catalytic system containing 400 mM ethylene glycol as a substrate.

[0057] Accurately weigh E.coli 1.05 g of GA-2 cells were placed in a 100 mL shake flask and resuspended in 20 mL of a catalytic system containing 400 mM ethylene glycol as a substrate. The initial pH of the PB buffer was adjusted to 7.0, 7.5, 8.0, 8.5, 9.0, and 9.5 using 4 M NaOH. The cells were catalyzed at 40 °C and 200 rpm for 72 h. During the catalytic period, 4 M NaOH was used to maintain a constant pH value that was the same as the initial pH value.

[0058] (3) Experiment on optimizing the concentration of PB buffer in the whole-cell catalytic process of preparing glycolic acid: PB buffer with a pH of 7.0 and a concentration of 50 mM, 100 mM, 200 mM, 300 mM, and 400 mM was prepared. 2.4828 g of reagent-grade ethylene glycol was accurately weighed into a 100 mL volumetric flask. The volume was fixed with the above-mentioned buffers of different concentrations to prepare a catalytic system with buffers of different concentrations containing 400 mM ethylene glycol as a substrate.

[0059] Accurately weigh the collected in Example 4 (2) E.coli 1.05 g of GA-2 cells were placed in a 100 mL shake flask and resuspended in 20 mL of a catalytic system containing 400 mM ethylene glycol as a substrate. The cells were catalyzed at 40 °C and 200 rpm for 72 h. 4 M NaOH was used to maintain a constant pH during the catalysis.

[0060] The whole cell catalytic system was used to measure the glycolic acid production using high performance liquid chromatography. Figure 8 As shown, it can be seen that E.coli The optimal conditions for single factor optimization of GA-2 strain were catalytic temperature of 25°C, catalytic system of 200 mM PB buffer, and constant pH of 7.5. Under the conditions of 400 mM substrate, 25°C, 200 mM PB buffer, and constant pH 7.5, E.coli The maximum accumulation of GA-2 glycolic acid was 367.73 mM, and the yield was 91.93%, which was 79.66% higher than that before optimization.

[0061] Example 5 Catalytic experiments with different host strains This example studies the catalytic effects of different host bacteria.

[0062] The plasmid pET-29a(+)- ycdW - fucO* - aldA Introduction into host cells E. coli MG1655, positive transformants were obtained E. coli GA-3. Prepared by the method described in Example 3 (1)-(2) E. coli GA-3 cells were used as whole cell catalysts to prepare glycolic acid using the optimal conditions of Example 4, namely, substrate concentration of 400 mM, catalytic temperature of 25°C, catalytic system of 200 mM PB buffer, pH maintained constant at 7.5, and other conditions were the same as in Example 4. The maximum accumulation of glycolic acid obtained was 339.52 mM, and the yield was 84.88%. Preparation of glycolic acid recombinant Escherichia coli strain using ethylene glycol whole cell catalysis E.coli The yield of GA-2 (BL21) was significantly better than E.coli GA-3 (MG1655).

Claims

1. A strain that catalyzes the production of glycolic acid from ethylene glycol, characterized in that: The strain uses Escherichia coli as a host bacterium and overexpresses propanediol oxidoreductase in the host bacterium. f Mutants f I6L,L7V Gene, acetaldehyde dehydrogenase aldA Gene, glycolaldehyde reductase wxya Genes obtained.

2. The strain according to claim 1, characterized in that Said aldA Gene ID: 945672, wxya Gene ID: 946431, the mutant f I6L,L7V Gene ID: 947273 Propylene glycol oxidoreductase f The I6L,L7V mutants.

3. The strain according to claim 1, characterized in that Said f I6L,L7V Gene, aldA Genes and wxya The gene expression vector used was pET-29a(+).

4. The strain according to claim 1, characterized in that The host bacteria is Escherichia coli Escherichia coli BL21.

5. The strain according to claim 1, characterized in that Said f I6L,L7V , aldA , wxya The three genes were connected by primers carrying inserted RBS sequences.

6. The method for constructing the strain according to any one of claims 1 to 5, characterized in that: include: The f I6L,L7V Gene, aldA Gene, wxya The gene is connected to the expression vector to obtain a recombinant plasmid; The recombinant plasmid is introduced into a host bacterium for expression to obtain the strain.

7. A whole cell catalyst, characterized in that Contains the strain according to any one of claims 1 to 5.

8. Use of the strain according to any one of claims 1 to 5 or the whole-cell catalyst according to claim 7 in catalyzing the preparation of glycolic acid from ethylene glycol.

9. The use according to claim 8, characterized in that: The whole-cell catalytic conversion is carried out using ethylene glycol as a substrate, the strain / whole-cell catalyst as a catalyst, and PB buffer as a catalytic system.

10. The use according to claim 9, characterized in that The pH of the PB buffer is 7.0-9.5; the concentration of the PB buffer is 50 mM-400 mM; and the catalytic temperature is 25°C-45°C.

Images