A genetically engineered Escherichia coli bacteria for producing L-histidine by fermentation, method and application

Abstract

The invention belongs to the technical field of genetic engineering and metabolic engineering, and discloses a genetically engineered Escherichia coli strain for producing L-histidine by fermentation, a method and an application thereof, wherein the strain is a wild-type Escherichia coli MG1655 strain, and the genes lacI and purR are knocked out on the genome; the genes prs, zwf and gnd are integrated; the genes hisG, hisD, hisB, hisC, hisA, hisF / H and hisIE are integrated; and the gene cgl2458 is integrated. The present invention utilizes molecular biological techniques to integrate the histidine operon in a mutant strain of Serratia marcescens that produces high histidine into the Escherichia coli genome, and by strengthening the supply of precursor PRPP and strategies such as histidine efflux, a genetically engineered Escherichia coli strain capable of producing high histidine is obtained, which can solve the problem that the fermentation liquid is viscous and the product is difficult to extract, and has good industrial application potential.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and metabolic engineering, and in particular to a genetically engineered Escherichia coli bacteria for producing L-histidine by fermentation, a method and an application thereof. Background Art

[0002] L-histidine is a basic component of protein and is considered to be an essential amino acid for humans. It has good physiological properties and is widely used in food, medicine, feed and other industries. At present, the production methods of histidine mainly include protein hydrolysis, chemical synthesis and microbial fermentation. The chemical synthesis method is easy to produce racemic mixtures, and the process is complicated, and its product quality is difficult to meet the quality requirements of pharmaceutical-grade APIs. The protein hydrolysis method produces histidine, mainly using pig hair or pig blood powder as raw materials, and washing and extracting to produce histidine, but the raw materials used in this method contain complex impurities in the histidine produced, which cannot meet the pharmaceutical-grade standards, and there is a risk of introducing viruses. In comparison, the microbial fermentation method for producing histidine has the advantages of high production efficiency, high product purity, wide source of raw materials, low cost, and simple operation, which is more suitable for large-scale industrial production.

[0003] In the prior art, CN111154704A obtained a strain of Serratia marcescens that can produce high histidine through mutagenesis screening. The strain has the following characteristics: ① histidase deficiency; ② alanine at position 158 of ATP-phosphoribosyltransferase mutated to phenylalanine, threonine at position 252 mutated to glutamine, and glutamic acid at position 271 mutated to lysine; ③ resistance to histidine structural analogs and purine structural analogs. The strain was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on December 9, 2019, with a deposit number of CGMCC No.19116. After 45 h of fermentation in a 50 L fermenter, the strain's histidine production reached 40 g / L, and the sugar-acid conversion rate could reach 16%. However, the fermentation broth of Serratia marcescens is relatively viscous, which seriously affects the separation and extraction of histidine and is not conducive to industrial-scale production.

[0004] In order to solve the above problems, the present invention uses Escherichia coli MG1655 as chassis cells, uses molecular biology technology to integrate the histidine operon gene of Serratia marcescens CGMCC No.19116 strain into the chassis cells, and sorts out its related metabolic pathways to obtain a genetically engineered Escherichia coli strain that can produce high histidine. Escherichia coli has low nutritional requirements, simple fermentation broth components, and easy product extraction, so it is more suitable for industrial scale-up production. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a genetically engineered Escherichia coli for producing L-histidine by fermentation, a method and an application thereof.

[0006] The technical solution adopted by the present invention to solve its technical problem is:

[0007] The invention discloses an Escherichia coli genetic engineering bacterium for producing L-histidine by fermentation. The strain is based on wild-type Escherichia coli MG1655 as a starting strain, wherein the lactose operon repressor protein encoding gene lacI and the trans-regulatory gene purR of PRPP synthase are knocked out in the genome; the endogenous PRPP synthase encoding gene prs, the glucose-6-phosphate dehydrogenase encoding gene zwf and the 6-phosphate glucose dehydrogenase encoding gene gnd are integrated in the genome to strengthen the supply of precursor PRPP; seven histidine operon genes hisG, hisD, hisB, hisC, hisA, hisF / H and hisIE from Serratia marcescens CGMCC No.19116 are integrated in the genome to open up the anabolism of histidine; and the membrane protein gene cgl2458 from Corynebacterium glutamicum ATCC 13032 is integrated in the genome to promote the efflux of histidine.

[0008] Furthermore, the gene sequence of the lactose operon repressor protein encoding gene lacI is the sequence shown in GenBank: 945007, the gene sequence of the PRPP synthase trans-regulatory gene purR is the sequence shown in GenBank: 945226, the gene sequence of the PRPP synthase encoding gene prs is the sequence shown in SEQ ID NO.1, the gene sequence of the glucose-6-phosphate dehydrogenase encoding gene zwf is the sequence shown in GenBank: 946370, the gene sequence of the 6-phosphate glucose dehydrogenase encoding gene gnd is the sequence shown in GenBank: 946554, the gene sequence of the gene hisG is the sequence shown in SEQ ID NO.2 and a sequence with a similarity of greater than 80% thereto, the gene sequence of the hisD is the sequence shown in SEQ ID NO.3 and a sequence with a similarity of greater than 80% thereto, the gene sequence of the hisB is the sequence shown in SEQ ID NO.4 and a sequence with a similarity of greater than 80% thereto, the gene sequence of the hisC is the sequence shown in SEQ ID NO. The gene sequence of the hisA gene is the sequence shown in SEQ ID NO.6 and the sequence with a similarity of more than 80% thereto, the gene sequence of the hisF / H gene is the sequence shown in SEQ ID NO.7 and the sequence with a similarity of more than 80% thereto, the gene sequence of the hisIE gene is the sequence shown in SEQ ID NO.8 and the sequence with a similarity of more than 80% thereto, and the gene sequence of the membrane protein gene cgl2458 is the sequence shown in SEQ ID NO.9.

[0009] The method for constructing the genetically engineered Escherichia coli bacteria as described above is obtained by gradual transformation using CRISPR / Cas9-mediated gene editing technology, and the steps are as follows:

[0010] (1) Knockout the lacI gene encoding the lactose operon repressor protein;

[0011] (2) Knockout the trans-regulatory gene purR of PRPP synthase;

[0012] (3) The endogenous PRPP synthase encoding gene prs is integrated into the pseudogene site yghx, trc Promoter control;

[0013] (4) The endogenous glucose-6-phosphate dehydrogenase encoding gene zwf was integrated into the pseudogene locus yeep, and the P trc Promoter control;

[0014] (5) The endogenous 6-phosphate glucose dehydrogenase encoding gene gnd was integrated into the pseudogene site rph, and Ptrc Promoter control;

[0015] (6) Integrate the exogenous ATP phosphoribosyltransferase encoding gene hisG into the pseudogene site yciq, trc Promoter control;

[0016] (7) Integrate the exogenous histidine aldehyde dehydrogenase encoding gene hisD into the pseudogene site mbha, trc Promoter control;

[0017] (8) Integrate the exogenous histidyl phosphatase encoding gene hisB into the pseudogene site yjiv, trc Promoter control;

[0018] (9) Integrate the exogenous histidyl phosphate aminotransferase encoding gene hisC into the pseudogene site gapC, trc Promoter control;

[0019] (10) The exogenous 5'-ProFAR isomerase encoding gene hisA was integrated into the pseudogene site yeel, and P trc Promoter control;

[0020] (11) Integrate the exogenous IGP synthase encoding gene hisF / H into the pseudogene site ygay, trc Promoter control;

[0021] (12) Integrate the exogenous PR-ATP pyrophosphohydrolase gene hisIE into the pseudogene site yjgx, trc Promoter control;

[0022] (13) Integrate the exogenous membrane protein encoding gene cgl2458 into the pseudogene site yghE, and trc Promoter control.

[0023] Furthermore, the P trc The gene sequence of the promoter is the sequence shown in SEQ ID NO.110:

[0024] TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC;

[0025] Alternatively, the order of operations of steps (1) to (13) in the construction method is not limited, and can be performed in any order that can be implemented by a person skilled in the art. Preferably, steps (1) to (13) are performed sequentially.

[0026] Furthermore, the CRISPR / Cas9-mediated gene editing technology includes constructing a recombinant fragment and a pGRB plasmid, simultaneously transforming the pGRB plasmid and the recombinant fragment into electroporation competent cells containing pREDCas9, and a plasmid elimination step to obtain a recombinant genetically engineered strain.

[0027] Furthermore, the method for constructing the pGRB plasmid comprises: designing a target sequence, preparing a DNA fragment containing the target sequence, and recombining the DNA fragment containing the target sequence with a linearized vector fragment; preferably, the target sequence is 5'-NGG-3';

[0028] Alternatively, the construction of the recombinant fragment includes constructing a gene-integrated recombinant fragment or constructing a gene-knockout recombinant fragment; wherein the step of constructing a gene-integrated recombinant fragment includes: using the genome of the starting strain as a template, designing upstream and downstream homology arm primers according to the upstream and downstream sequences of the intended insertion site of the target gene, and designing primers according to the target genome, amplifying the target gene fragment, and then obtaining the recombinant fragment by PCR overlap technology.

[0029] The use of the genetically engineered Escherichia coli as described above in the fermentation production of histidine.

[0030] The method for producing histidine by fermentation of the genetically engineered Escherichia coli as described above comprises the following steps:

[0031] The genetically engineered strain is contacted with a fermentation medium for fermentation culture to prepare histidine.

[0032] Further, the fermentation culture includes shake flask fermentation or fermentation tank fermentation;

[0033] During shake flask fermentation, the genetically engineered strain was first inoculated from a solid slant into a triangular flask containing a seed culture medium, and cultured at 37°C and 180 r / min for 12 h. Then, the seed culture was inoculated with 10-15% of the inoculation amount into a triangular flask containing a fermentation culture medium for fermentation culture, and cultured at 37°C and 180 r / min for 24 h. During the fermentation process, ammonia water was added to maintain the pH between 7.0 to ensure the normal growth of the strain, and a 60% mass concentration of glucose solution was added in time to maintain the normal fermentation process.

[0034] During fermentation in a fermenter, use an inoculation loop to scrape 3-5 loops of bacteria from a -80℃ refrigerator tube, evenly spread on LB slant medium, culture at 37℃ for 12 h, transfer to an eggplant-shaped bottle and continue to culture for 12-15 h; take sterile water in an eggplant-shaped bottle, inoculate the bacterial suspension into the seed medium, maintain the pH of the fermentation liquid at 7.0, control the dissolved oxygen between 30-35%, stir at 200-500 r / min, and keep the temperature constant at 35℃ for 6 h, until the fermentation liquid OD reaches 0.600 The value reaches 10-15; fresh fermentation medium is added according to 20% inoculation amount, and fermentation is started. The fermentation temperature is 37 ℃, the stirring speed is 300-900 r / min, the dissolved oxygen is controlled between 25-35%, and the pH is maintained stable at 7.0; when the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is added to maintain the final mass concentration of residual sugar at 0.1-0.6%, and the fermentation time is 44 h.

[0035] Furthermore, the seed culture medium comprises: 25 g / L glucose, 5 g / L yeast powder, 1 g / L peptone, 1.5 g / L citric acid, 1.8 g / L K2HPO4, 0.5 g / L MgSO4, 10 mg / L FeSO4, 10 mg / L MnSO4, 1.0 mg / L B Mix, the rest is water, pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min;

[0036] The fermentation medium comprises: 20 g / L glucose, 4 g / L yeast powder, 2 g / L citric acid, 3.5 g / L K2HPO4, 1.8 g / L MgSO4, 20 mg / L FeSO4, 10 mg / L MnSO4, 2.0 mg / L B Mix, 0.2 g / L methionine, 1 g / L MSG, the rest is water, pH 7.0-7.5, 121°C, high pressure steam sterilization for 20 min;

[0037] Among them, the V B Mix is ​​composed of V B1 、V B3 、V B5 、V B12 The resulting mixture was mixed well.

[0038] The advantages and positive effects achieved by the present invention are:

[0039] 1. The present invention utilizes molecular biological techniques to integrate the histidine operon in a mutant strain of Serratia marcescens that produces high histidine production into the Escherichia coli genome, and obtains a strain of Escherichia coli genetically engineered bacteria that can produce high histidine production by strengthening the supply of precursor PRPP and strategies such as histidine efflux, and provides a related fermentation process. The strain is used to replace Serratia marcescens for histidine fermentation, which can solve the problem of thick fermentation broth and difficult product extraction, and has good industrial application potential.

[0040] 2. The histidine operon in the mutant strain of Serratia marcescens used in the present invention has multiple mutations compared to the histidine operon in the wild-type Serratia marcescens. Experimental verification shows that these mutation points have a positive effect on the synthesis of histidine. In addition, the present invention uses a novel membrane protein derived from Corynebacterium glutamicum, which can effectively enhance the transport of histidine to the extracellular space. The mining of these transformation targets and elements provides more strategies for the construction and iterative upgrading of histidine production bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 This is the electrophoresis diagram for the construction and verification of the lacI gene knockout fragment in the present invention; wherein: M: 1kb DNA Marker; 1: lacI upstream homology arm; 2: lacI downstream homology arm; 3: lacI overlapping fragment; 4: original bacteria PCR fragment; 5: positive single colony PCR identification fragment;

[0042] Figure 2 The electrophoresis diagram for constructing and verifying the △purR gene knockout fragment in the present invention; wherein: M: 1kb DNA Marker; 1: upstream homology arm of purR; 2: downstream homology arm of purR; 3: overlapping fragment of purR; 4: original bacteria PCR fragment; 5: positive single colony PCR identification fragment;

[0043] Figure 3 The electrophoresis diagram for constructing and verifying the prs gene integration fragment in the present invention; wherein: M: 1kb DNA Marker; 1: upstream homology arm of yghx; 2: downstream homology arm of yghx; 3: prs target gene; 4: prs overlapping fragment; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0044] Figure 4 This is the electrophoresis diagram for constructing and verifying the integration fragment of the zwf gene in the present invention; wherein: M: 1kb DNA Marker; 1: yeep upstream homology arm; 2: yeep downstream homology arm; 3: zwf target gene; 4: zwf overlapping fragment; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0045] Figure 5 This is the electrophoresis diagram for the construction and verification of the gnd gene knockout fragment in the present invention; wherein: M: 1kb DNA Marker; 1: rph upstream homology arm; 2: rph downstream homology arm; 3: gnd target gene; 4: gnd overlapping fragment; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0046] Figure 6The electrophoresis diagram for constructing and verifying the integration fragment of hisG gene in the present invention; wherein: M: 1kb DNA Marker; 1: upstream homology arm of yciq; 2: downstream homology arm of yciq; 3: target gene of hisG; 4: overlapping fragment of hisG; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0047] Figure 7 The electrophoresis diagram of the construction and verification of the hisD gene integration fragment in the present invention; wherein: M: 1kb DNA Marker; 1: mbha upstream homology arm; 2: mbha downstream homology arm; 3: hisD target gene; 4: hisD overlapping fragment; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0048] Figure 8 The electrophoresis diagram for constructing and verifying the integration fragment of hisB gene in the present invention; wherein: M: 1kb DNA Marker; 1: upstream homology arm of yjiv; 2: downstream homology arm of yjiv; 3: target hisB gene; 4: overlapping fragment of hisB; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0049] Fig. 9 The electrophoresis diagram of the construction and verification of the hisC gene integration fragment in the present invention; wherein: M: 1kb DNA Marker; 1: gapC upstream homology arm; 2: gapC downstream homology arm; 3: hisC target gene; 4: hisC overlapping fragment; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0050] Fig.10 The electrophoresis diagram for constructing and verifying the integration fragment of hisA gene in the present invention; wherein: M: 1kb DNA Marker; 1: yeel upstream homology arm; 2: yeel downstream homology arm; 3: hisA target gene; 4: hisA overlapping fragment; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0051] Fig.11 The electrophoresis diagram for constructing and verifying the integration fragment of hisFH gene in the present invention; wherein: M: 1kb DNA Marker; 1: upstream homology arm of ygay; 2: downstream homology arm of ygay; 3: hisFH target gene; 4: hisFH overlapping fragment; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0052] Fig.12The electrophoresis diagram for constructing and verifying the integration fragment of hisIE gene in the present invention; wherein: M: 1kb DNA Marker; 1: upstream homology arm of yjgx; 2: downstream homology arm of yjgx; 3: target gene of hisIE; 4: overlapping fragment of hisIE; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0053] Fig.13 The electrophoresis diagram for constructing and verifying the integration fragment of cgl2458 gene in the present invention; wherein: M: 1kb DNA Marker; 1: upstream homology arm of yghE; 2: downstream homology arm of yghE; 3: target gene of cgl2458; 4: overlapping fragment of cgl2458; 5: original bacteria PCR fragment; 6: positive single colony PCR identification fragment;

[0054] Fig.14 This is a process diagram of producing histidine by using genetically engineered bacteria in shake flask fermentation in an embodiment of the present invention;

[0055] Fig.15 This is a process diagram of producing histidine by fermentation in a fermenter using genetically engineered bacteria in an embodiment of the present invention;

[0056] Fig.16 This is a diagram of the metabolic transformation strategy of the histidine genetically engineered bacteria in the examples of the present invention. DETAILED DESCRIPTION

[0057] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0058] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0059] The invention discloses an Escherichia coli genetic engineering bacterium for fermentation and production of L-histidine. The strain is based on wild-type Escherichia coli MG1655 (a commercial product, directly purchased, such as the strain number ATCC 47076) as a starting strain, wherein the lactose operon repressor protein encoding gene lacI and the trans-regulatory gene purR of the PRPP synthase are knocked out in the genome; the endogenous PRPP synthase encoding gene prs, the glucose-6-phosphate dehydrogenase encoding gene zwf and the 6-phosphate glucose dehydrogenase encoding gene gnd are integrated in the genome to strengthen the supply of the precursor PRPP; the seven histidine operon genes hisG, hisD, hisB, hisC, hisA, hisF / H and hisIE from Serratia marcescens CGMCC No.19116 (disclosed in the patent publication CN111154704A) are integrated in the genome to open up the anabolism of histidine; the Corynebacterium The membrane protein gene cgl2458 derived from glutamicum ATCC 13032 (a commercial product, directly purchased) is used to promote the efflux of histidine.

[0060] Preferably, the gene sequence of the lactose operon repressor protein encoding gene lacI is the sequence shown in GenBank: 945007, the gene sequence of the PRPP synthase trans-regulatory gene purR is the sequence shown in GenBank: 945226, the gene sequence of the PRPP synthase encoding gene prs is the sequence shown in SEQ ID NO.1, the gene sequence of the glucose-6-phosphate dehydrogenase encoding gene zwf is the sequence shown in GenBank: 946370, the gene sequence of the 6-phosphate glucose dehydrogenase encoding gene gnd is the sequence shown in GenBank: 946554, the gene sequence of the gene hisG is the sequence shown in SEQ ID NO.2 and a sequence with a similarity of more than 80% thereto, the gene sequence of the hisD is the sequence shown in SEQ ID NO.3 and a sequence with a similarity of more than 80% thereto, the gene sequence of the hisB is the sequence shown in SEQ ID NO.4 and a sequence with a similarity of more than 80% thereto, the gene sequence of the hisC is the sequence shown in SEQ ID NO. The gene sequence of the hisA gene is the sequence shown in SEQ ID NO.6 and the sequence with a similarity of more than 80% thereto, the gene sequence of the hisF / H gene is the sequence shown in SEQ ID NO.7 and the sequence with a similarity of more than 80% thereto, the gene sequence of the hisIE gene is the sequence shown in SEQ ID NO.8 and the sequence with a similarity of more than 80% thereto, and the gene sequence of the membrane protein gene cgl2458 is the sequence shown in SEQ ID NO.9.

[0061] The method for constructing the genetically engineered Escherichia coli bacteria as described above is obtained by gradual transformation using CRISPR / Cas9-mediated gene editing technology, and the steps are as follows:

[0062] (1) Knockout the lacI gene encoding the lactose operon repressor protein;

[0063] (2) Knockout the trans-regulatory gene purR of PRPP synthase;

[0064] (3) The endogenous PRPP synthase encoding gene prs is integrated into the pseudogene site yghx, trc Promoter control;

[0065] (4) The endogenous glucose-6-phosphate dehydrogenase encoding gene zwf was integrated into the pseudogene locus yeep, and the P trc Promoter control;

[0066] (5) The endogenous 6-phosphate glucose dehydrogenase encoding gene gnd was integrated into the pseudogene site rph, and Ptrc Promoter control;

[0067] (6) Integrate the exogenous ATP phosphoribosyltransferase encoding gene hisG into the pseudogene site yciq, trc Promoter control;

[0068] (7) Integrate the exogenous histidine aldehyde dehydrogenase encoding gene hisD into the pseudogene site mbha, trc Promoter control;

[0069] (8) Integrate the exogenous histidyl phosphatase encoding gene hisB into the pseudogene site yjiv, trc Promoter control;

[0070] (9) Integrate the exogenous histidyl phosphate aminotransferase encoding gene hisC into the pseudogene site gapC, trc Promoter control;

[0071] (10) The exogenous 5'-ProFAR isomerase encoding gene hisA was integrated into the pseudogene site yeel, and P trc Promoter control;

[0072] (11) Integrate the exogenous IGP synthase encoding gene hisF / H into the pseudogene site ygay, trc Promoter control;

[0073] (12) Integrate the exogenous PR-ATP pyrophosphohydrolase gene hisIE into the pseudogene site yjgx, trc Promoter control;

[0074] (13) Integrate the exogenous membrane protein encoding gene cgl2458 into the pseudogene site yghE, and trc Promoter control.

[0075] Preferably, the P trc The gene sequence of the promoter is the sequence shown in SEQ ID NO.110:

[0076] TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC;

[0077] Alternatively, the order of operations of steps (1) to (13) in the construction method is not limited, and can be performed in any order that can be implemented by a person skilled in the art. Preferably, steps (1) to (13) are performed sequentially.

[0078] Preferably, the CRISPR / Cas9-mediated gene editing technology includes constructing a recombinant fragment and a pGRB plasmid, simultaneously transforming the pGRB plasmid and the recombinant fragment into electroporated competent cells containing pREDCas9, and a plasmid elimination step to obtain a recombinant genetically engineered strain.

[0079] Preferably, the method for constructing the pGRB plasmid comprises: designing a target sequence, preparing a DNA fragment containing the target sequence, and recombining the DNA fragment containing the target sequence with a linearized vector fragment; preferably, the target sequence is 5'-NGG-3';

[0080] Alternatively, the construction of the recombinant fragment includes constructing a gene-integrated recombinant fragment or constructing a gene-knockout recombinant fragment; wherein the step of constructing a gene-integrated recombinant fragment includes: using the genome of the starting strain as a template, designing upstream and downstream homology arm primers according to the upstream and downstream sequences of the intended insertion site of the target gene, and designing primers according to the target genome, amplifying the target gene fragment, and then obtaining the recombinant fragment by PCR overlap technology.

[0081] The use of the genetically engineered Escherichia coli as described above in the fermentation production of histidine.

[0082] The method for producing histidine by fermentation of the genetically engineered Escherichia coli as described above comprises the following steps:

[0083] The genetically engineered strain is contacted with a fermentation medium for fermentation culture to prepare histidine.

[0084] Further, the fermentation culture includes shake flask fermentation or fermentation tank fermentation;

[0085] During shake flask fermentation, the genetically engineered strain was first inoculated from a solid slant into a triangular flask containing a seed culture medium, and cultured at 37°C and 180 r / min for 12 h. Then, the seed culture was inoculated with 10-15% of the inoculation amount into a triangular flask containing a fermentation culture medium for fermentation culture, and cultured at 37°C and 180 r / min for 24 h. During the fermentation process, ammonia water was added to maintain the pH between 7.0 to ensure the normal growth of the strain, and a 60% mass concentration of glucose solution was added in time to maintain the normal fermentation process.

[0086] During fermentation in a fermenter, use an inoculation loop to scrape 3-5 loops of bacteria from a -80℃ refrigerator tube, evenly spread on LB slant medium, culture at 37℃ for 12 h, transfer to an eggplant-shaped bottle and continue to culture for 12-15 h; take sterile water in an eggplant-shaped bottle, inoculate the bacterial suspension into the seed medium, maintain the pH of the fermentation liquid at 7.0, control the dissolved oxygen between 30-35%, stir at 200-500 r / min, and keep the temperature constant at 35℃ for 6 h, until the fermentation liquid OD reaches 0.600 The value reaches 10-15; fresh fermentation medium is added according to 20% inoculation amount, and fermentation is started. The fermentation temperature is 37 ℃, the stirring speed is 300-900 r / min, the dissolved oxygen is controlled between 25-35%, and the pH is maintained stable at 7.0; when the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is added to maintain the final mass concentration of residual sugar at 0.1-0.6%, and the fermentation time is 44 h.

[0087] Preferably, the seed culture medium comprises: 25 g / L glucose, 5 g / L yeast powder, 1 g / L peptone, 1.5 g / L citric acid, 1.8 g / L K2HPO4, 0.5 g / L MgSO4, 10 mg / L FeSO4, 10 mg / L MnSO4, 1.0 mg / L B Mix, the rest is water, pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min;

[0088] The fermentation medium comprises: 20 g / L glucose, 4 g / L yeast powder, 2 g / L citric acid, 3.5 g / L K2HPO4, 1.8 g / L MgSO4, 20 mg / L FeSO4, 10 mg / L MnSO4, 2.0 mg / L B Mix, 0.2 g / L methionine, 1 g / L MSG, the rest is water, pH 7.0-7.5, 121°C, high pressure steam sterilization for 20 min;

[0089] Among them, the V B Mix is ​​composed of V B1 、V B3 、V B5 、V B12 The resulting mixture was mixed well.

[0090] Specifically, the relevant preparation and detection are as follows:

[0091] Example 1: Construction process of genetically engineered bacteria

[0092] 1Gene editing method:

[0093] The CRISPR / Cas9-mediated gene editing technology includes constructing a recombinant fragment and a pGRB plasmid, simultaneously transforming the pGRB plasmid and the recombinant fragment into electroporation competent cells containing pREDCas9, and performing a plasmid elimination step to obtain a recombinant genetically engineered strain.

[0094] The specific steps of this method are as follows:

[0095] 1.1 Construction of pGRB plasmid

[0096] The purpose of constructing the plasmid pGRB is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein, and recognizing the target gene target site through base pairing and PAM to achieve the target DNA double-strand break. The pGRB plasmid is constructed by recombination of a DNA fragment containing the target sequence with a linearized vector fragment.

[0097] 1.1.1 Construction of pGRB plasmid

[0098] Use CRISPR RGEN Tools to design the target sequence (PAM: 5'-NGG-3'), design primers: 5'-linearized vector end sequence (15 bp)-restriction site-target sequence (excluding PAM sequence)-linearized vector end sequence (15 bp)-3' and its reverse complementary primer (pGRB identification primer, i.e. SEQ ID NO.111: pGRB-JD-S: GTCTCATGAGCGGATACATATTTG; pGRB-JD-A, i.e. SEQ ID NO.112: ATGAGAAAGCGCCACGCT), and prepare DNA fragments containing the target sequence by annealing of single-stranded DNA. Reaction conditions: pre-denaturation at 95°C for 5 min; annealing at 50°C for 1 min; insulation at 4°C. The annealing system is as follows:

[0099]

[0100] 1.1.2 Preparation of linearized pGRB vector

[0101] The linearization of the vector was prepared by inverse PCR amplification.

[0102] 1.1.3 Recombination reaction

[0103] The recombinant enzymes used were all from the ClonExpress ® II One Step Cloning Kit series, and the recombination conditions were 37°C, 30 min. The recombination system is as follows:

[0104]

[0105] 1.1.4 Plasmid transformation

[0106] Add all the recombinant 10 μL system into 100 μL E. coli DH5α competent cells, pipette repeatedly to mix, place on ice for 20 min, place in a 42 °C water bath for 60 s, then immediately place on ice for 2-3 min, add 900 μL SOC, resuscitate at 37 °C for 1 h, centrifuge at 8000 r / min for 2 min, discard 700 μL supernatant, keep 200 μL and resuspend the cells, spread the resuscitation solution on a plate containing 100 μg / mL ampicillin resistance, and incubate at 37 °C inverted for 12-16 h. After a single colony grows on the plate, identify it by colony PCR and select the positive recombinants.

[0107] 1.2 Preparation of recombinant DNA fragments

[0108] The recombinant fragment used for integration consists of the upstream and downstream homologous arms of the integration site and the gene fragment to be integrated (upstream homologous arm-target gene-downstream homologous arm). Using the primer design software primer5, the upstream and downstream sequences of the gene to be knocked out or the site to be integrated are used as templates to design upstream and downstream homologous arm primers (amplification length is about 300-600 bp); using the gene to be integrated as a template, design the amplification primers of the integrated gene. After amplifying the upstream and downstream homologous arms and the target gene fragment by PCR, the recombinant fragment is prepared by overlapping PCR; the recombinant fragment used for knockout consists of the upstream and downstream homologous arms of the gene to be knocked out (upstream homologous arm-downstream homologous arm). The PCR amplification reaction system is as follows:

[0109] The PCR amplification system is as follows:

[0110]

[0111] The overlapping PCR amplification system is as follows:

[0112]

[0113] Pre-denaturation (95°C) for 5 min; then perform 30 cycles: denaturation at 98°C for 10 s, annealing at 55°C for 15 s, and extension at 72°C (this enzyme activity extends about 1 kb in 1 min), and start PCR.

[0114] 1.3 Recombinant DNA fragments and plasmid transformation

[0115] 1.3.1 Transformation with pREDCas9

[0116] The pREDCas9 plasmid was electrotransformed into the electrotransformation competent cells of E. coli MG1655 wild type by electrotransformation of E. coli (the preparation method is well known in the art, and the following competent cell preparation methods are all well known in the art). After the cells were revived and cultured, they were spread on LB plates containing 50 µg / mL spectinomycin and cultured at 32°C for 12-18 h. Single colonies grown on the resistant plates were subjected to colony PCR using identification primers to screen for correct positive recombinants.

[0117] 1.3.2 Preparation of electroporation competent cells for engineered strains (including pREDCas9)

[0118] The correct positive recombinants screened in 1.3.1 were inoculated into 2XYT medium, and OD was measured 1 hour after inoculation. 600 When OD is 0.1, add 100 μL IPTG (the purpose of adding IPTG is to induce the expression of the recombinase on the pREDCas9 plasmid). 600 =0.4, the competent cell preparation process was started. The electroporation competent cell preparation process referred to the conventional process to obtain electroporation competent cells containing pREDCas9, i.e., competent cells of E. coli ZL1.

[0119] 1.3.3 Recombinant DNA fragments and pGRB transformation

[0120] pGRB and the recombinant DNA fragment were simultaneously electrotransformed into electrocompetent cells containing pREDCas9. Then the cells were revived for 2 h and finally plated on LB plates containing 100 µg / mL ampicillin and spectinomycin and cultured at 32°C for 18-24 h. Colony PCR verification was performed using the upstream primer of the pseudogene site and the downstream primer of the homologous arm of the pseudogene site (because there are many pseudogene site names involved, the upstream primer of the pseudogene site and the downstream primer of the pseudogene site are uniformly used as replacement instructions, which are explained as: UP-pseudogene site-S, DN-pseudogene site-A), and positive recombinants were screened and preserved.

[0121] 1.4 Plasmid loss

[0122] 1.4.1 Loss of pGRB

[0123] The positive recombinant was transferred to 5mL LB liquid medium, and 150 μL of 20 mmol / L arabinose and 5 μL of spectinomycin resistance were added. The culture was carried out at 32℃ and 200 r / min overnight. The LB plate medium containing spectinomycin resistance was streaked three times to isolate single colonies. The LB plate containing 100μg / mL ampicillin and spectinomycin resistance was spotted, and the single colonies that did not grow on the ampicillin plate but grew on the spectinomycin resistance plate were selected for preservation.

[0124] 1.4.2 Loss of pREDCas9 plasmid

[0125] Transfer the positive recombinant to LB liquid medium without resistance, culture at 42℃ for 18-20h, make three-zone stripes on LB plates without resistance, and culture at 37℃ for 12-16h. Spot LB plates containing 100µg / mL spectinomycin resistance and LB plates without resistance, and select single colonies that do not grow on spectinomycin resistance plates but grow on non-resistance plates.

[0126] 2 Specific implementation process of genetic engineering strain construction

[0127] 2.1 Knockout of lacI gene

[0128] According to the upstream and downstream sequences of the E. coli MG1655 lacI gene, upstream homology arm primers UP-△lacI-S (see Sequence Listing 10) / UP-△lacI-A (see Sequence Listing 11) and downstream homology arm primers DN-△lacI-S (see Sequence Listing 12) / DN-△lacI-A (see Sequence Listing 13) were designed, and the upstream and downstream homology arm fragments were PCR amplified; the above fragments were fused by overlapping PCR to obtain the integrated fragment (U-△lacI-D) of the △lacI gene, and the DNA fragment containing the target sequence used to construct pGRB-△lacI was obtained by annealing primers gRNA-△lacI-S (see Sequence Listing 84) and gRNA-△lacI-A (see Sequence Listing 85), and the recombinant plasmid pGRB-△lacI was obtained according to the operating method of 1.1 in Example 1. The recombinant plasmid pGRB-△lacI and the overlapping fragment U-△lacI -D were transformed into competent cells of E. coli ZL1 containing the pREDcas9 plasmid, and the plasmid was lost according to the operation method 1.4 in Example 1, and finally the strain E. coli ZL2 was obtained. The verification results were as follows Figure 1 shown.

[0129] 2.2 Knockout of purR gene

[0130] According to the upstream and downstream sequences of the E. coli MG1655 purR gene, upstream homology arm primers UP-△purR-S (see Sequence Listing 14) / UP-△purR-A (see Sequence Listing 15) and downstream homology arm primers DN-△purR-S (see Sequence Listing 16) / DN-△purR-A (see Sequence Listing 17) were designed, and the upstream and downstream homology arm fragments were amplified by PCR; the above fragments were fused by overlapping PCR to obtain the integrated fragment (U-△purR-D) of the △purR gene, and the DNA fragment containing the target sequence used to construct pGRB-△purR was obtained by annealing primers gRNA-△purR-S (see Sequence Listing 86) and gRNA-△purR-A (see Sequence Listing 87), and the recombinant plasmid pGRB-△purR was obtained according to the operating method of 1.1 in Example 1. The recombinant plasmid pGRB-△purR and the overlapping fragment U-△purR-D were transformed into competent cells of E. coli ZL2 containing pREDcas9 plasmid, and the plasmid was lost according to the operation method 1.4 in Example 1, and finally the strain E. coli ZL3 was obtained. The verification results were as follows Figure 2 shown.

[0131] 2.3 P trc - Integration of pr gene

[0132] Using the genome of Escherichia coli MG1655 as a template, upstream homology arm primers UP-yghx-S (see sequence table 18) / UP-yghx-A (see sequence table 19) and downstream homology arm primers DN-yghx-S (see sequence table 20) / DN-yghx-A (see sequence table 21) were designed according to the upstream and downstream sequences of its yghx gene, and PCR was performed to amplify the upstream and downstream homology arm fragments; primers prs-S (see sequence table 22) / prs-A (see sequence table 23) were designed according to the prs gene sequence, and PCR was performed to amplify the prs gene fragment (P trc Promoter and T trc The terminator has been designed in the primers prs-S and prs-A). The above fragments were fused by overlapping PCR to obtain P trc -prs gene integration fragment (U yghx -P trc -prs-T trc -D yghx ), the DNA fragment containing the target sequence used to construct pGRB-yghx was prepared by annealing primers gRNA-yghx-S (see sequence list 88) and gRNA-yghx-A (see sequence list 89), and the recombinant plasmid pGRB-yghx was obtained according to the operation method of 1.1 in Example 1. The recombinant plasmid pGRB-yghx and the overlapping fragment U yghx -Ptrc -prs-T trc -D yghx Transformed into competent cells of E. coli ZL3 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL4, and the verification results were as follows Figure 3 shown.

[0133] 2.4 P trc - Integration of the zwf gene

[0134] Using the E. coli MG1655 genome as a template, upstream homology arm primers UP-yeep-S (see sequence table 24) / UP-yeep-A (see sequence table 25) and downstream homology arm primers DN-yeep-S (see sequence table 26) / DN-yeep-A (see sequence table 27) were designed according to the upstream and downstream sequences of its yeep gene, and PCR amplification of its upstream and downstream homology arm fragments; primers zwf-S (see sequence table 28) / zwf-A (see sequence table 29) were designed according to the zwf gene sequence, and PCR amplification of the zwf gene fragment (P trc Promoter and T trc The terminator has been designed in the primers zwf-S and zwf-A). The above fragments were fused by overlapping PCR to obtain P trc -zwf gene integration fragment (U yeep -P trc -zwf-T trc -D yeep ), the DNA fragment containing the target sequence used to construct pGRB-yeep was prepared by annealing primers gRNA-yeep-S (see sequence list 90) and gRNA-yeep-A (see sequence list 91), and the recombinant plasmid pGRB-yeep was obtained according to the operation method of 1.1 in Example 1. The recombinant plasmid pGRB-yeep and the overlapping fragment U yeep -P trc -zwf-T trc -D yeep Transformed into competent cells of E. coli ZL4 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL5, and the verification results were as follows Figure 4 shown.

[0135] 2.5 P trc -gnd gene integration

[0136] Using the genome of E. coli MG1655 as a template, upstream homology arm primers UP-rph-S (see sequence table 30) / UP-rph-A (see sequence table 31) and downstream homology arm primers DN-rph-S (see sequence table 32) / DN-rph-A (see sequence table 33) were designed according to the upstream and downstream sequences of its rph gene, and PCR was performed to amplify the upstream and downstream homology arm fragments; primers gnd-S (see sequence table 34) / gnd-A (see sequence table 35) were designed according to the gnd gene sequence, and PCR was performed to amplify the gnd gene fragment (P trc Promoter and T trc The terminator has been designed in the primers gnd-S and gnd-A). The above fragments were fused by overlapping PCR to obtain P trc -gnd gene integration fragment (U rph -P trc -gnd-T trc -D rph ), the DNA fragment containing the target sequence used to construct pGRB-rph was prepared by annealing primers gRNA-rph-S (see sequence list 92) and gRNA-rph-A (see sequence list 93), and the recombinant plasmid pGRB-rph was obtained according to the operation method of 1.1 in Example 1. rph -P trc -gnd-T trc -D rph Transformed into competent cells of E. coli ZL5 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL6, and the verification results were as follows Figure 5 shown.

[0137] 2.6 P trc -hisG gene integration

[0138] Using the genome of Serratia marcescens CGMCC No.19116 as a template, upstream homology arm primers UP-yciq-S (see sequence table 36) / UP-yciq-A (see sequence table 37) and downstream homology arm primers DN-yciq-S (see sequence table 38) / DN-yciq-A (see sequence table 39) were designed according to the upstream and downstream sequences of its yciq gene, and PCR amplification of its upstream and downstream homology arm fragments; primers hisG-S (see sequence table 40) / hisG-A (see sequence table 41) were designed according to the hisG gene sequence, and PCR amplification of the hisG gene fragment (P trc Promoter and T trcThe terminator has been designed in the primers hisG-S and hisG-A). The above fragments were fused by overlapping PCR to obtain P trc -hisG gene integration fragment (U yciq -P trc -hisG-T trc -D yciq ), the DNA fragment containing the target sequence used to construct pGRB-yciq was prepared by annealing primers gRNA-yciq-S (see sequence table 94) and gRNA-yciq-A (see sequence table 95), and the recombinant plasmid pGRB-yciq was obtained according to the operation method of 1.1 in Example 1. The recombinant plasmid pGRB-yciq and the overlapping fragment U yciq -P trc -hisG-T trc -D yciq Transformed into competent cells of E. coli ZL6 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL7, and the verification results were as follows Figure 6 shown.

[0139] 2.7 P trc - Integration of hisD gene

[0140] Using the genome of Serratia marcescens CGMCC No.19116 as a template, upstream homology arm primers UP-mbha-S (see sequence table 42) / UP-mbha-A (see sequence table 43) and downstream homology arm primers DN-mbha-S (see sequence table 44) / DN-mbha-A (see sequence table 45) were designed according to the upstream and downstream sequences of its mbha gene, and PCR was performed to amplify the upstream and downstream homology arm fragments; primers hisD-S (see sequence table 46) / hisD-A (see sequence table 47) were designed according to the hisD gene sequence, and PCR was performed to amplify the hisD gene fragment (P trc Promoter and T trc The terminator has been designed in the primers hisD-S and hisD-A). The above fragments were fused by overlapping PCR to obtain P trc -hisD gene integration fragment (U mbha -P trc -hisD-T trc -D mbha), the DNA fragment containing the target sequence used to construct pGRB-mbha was prepared by annealing primers gRNA-mbha-S (see sequence list 96) and gRNA-mbha-A (see sequence list 97), and the recombinant plasmid pGRB-mbha was obtained according to the operation method of 1.1 in Example 1. The recombinant plasmid pGRB-mbha and the overlapping fragment U mbha -P trc -hisD-T trc -D mbha Transformed into competent cells of E. coli ZL7 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL8, and the verification results were as follows Figure 7 shown.

[0141] 2.8 Integration of the Ptrc-hisB gene

[0142] Using the genome of Serratia marcescens CGMCC No.19116 as a template, upstream homology arm primers UP-yjiv-S (see sequence table 48) / UP-yjiv-A (see sequence table 49) and downstream homology arm primers DN-yjiv-S (see sequence table 50) / DN-yjiv-A (see sequence table 51) were designed according to the upstream and downstream sequences of its yjiv gene, and PCR was performed to amplify the upstream and downstream homology arm fragments; primers hisB-S (see sequence table 52) / hisB-A (see sequence table 53) were designed according to the hisB gene sequence, and PCR was performed to amplify the hisB gene fragment (P trc Promoter and T trc The terminator has been designed in the primers hisB-S and hisB-A). The above fragments were fused by overlapping PCR to obtain P trc -hisB gene integration fragment (U yjiv -P trc -hisB-T trc -D yjiv ), the DNA fragment containing the target sequence used to construct pGRB-yjiv was prepared by annealing primers gRNA-yjiv-S (see sequence table 98) and gRNA-yjiv-A (see sequence table 99), and the recombinant plasmid pGRB-yjiv was obtained according to the operation method of 1.1 in Example 1. The recombinant plasmid pGRB-yjiv and the overlapping fragment U yjiv -P trc -hisB-T trc -D yjivTransformed into competent cells of E. coli ZL8 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL9, and the verification results were as follows Figure 8 shown.

[0143] 2.9 P trc -hisC gene integration

[0144] Using the genome of Serratia marcescens CGMCC No.19116 as a template, upstream homology arm primers UP-gapC-S (see sequence table 54) / UP-gapC-A (see sequence table 55) and downstream homology arm primers DN-gapC-S (see sequence table 56) / DN-gapC-A (see sequence table 57) were designed according to the upstream and downstream sequences of its gapC gene, and PCR was performed to amplify the upstream and downstream homology arm fragments; primers hisC-S (see sequence table 58) / hisC-A (see sequence table 59) were designed according to the hisC gene sequence, and PCR was performed to amplify the hisC gene fragment (P trc Promoter and T trc The terminator has been designed in the primers hisC-S and hisC-A). The above fragments were fused by overlapping PCR to obtain P trc -hisC gene integration fragment (U gapC -P trc -hisC-T trc -D gapC ), the DNA fragment containing the target sequence used to construct pGRB-gapC was prepared by annealing primers gRNA-gapC-S (see sequence table 100) and gRNA-gapC-A (see sequence table 101), and the recombinant plasmid pGRB-gapC was obtained according to the operation method of 1.1 in Example 1. The recombinant plasmid pGRB-gapC and the overlapping fragment U gapC -P trc -hisC-T trc -D gapC Transformed into competent cells of E. coli ZL9 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL10, and the verification results were as follows Fig. 9 shown.

[0145] 2.10 P trc - Integration of hisA gene

[0146] Using the genome of Serratia marcescens CGMCC No.19116 as a template, upstream homology arm primers UP-yeel-S (see sequence list 60) / UP-yeel-A (see sequence list 61) and downstream homology arm primers DN-yeel-S (see sequence list 62) / DN-yeel-A (see sequence list 63) were designed according to the upstream and downstream sequences of its yeel gene, and PCR was performed to amplify the upstream and downstream homology arm fragments; primers hisA-S (see sequence list 64) / hisA-A (see sequence list 65) were designed according to the hisA gene sequence, and PCR was performed to amplify the hisA gene fragment (P trc Promoter and T trc The terminator has been designed in the primers hisA-S and hisA-A). The above fragments were fused by overlapping PCR to obtain P trc -hisA gene integration fragment (U yeel -P trc -hisA-T trc -D yeel ), the DNA fragment containing the target sequence used to construct pGRB-gapC was prepared by annealing primers gRNA-yeel-S (see sequence list 102) and gRNA-yeel-A (see sequence list 103), and the recombinant plasmid pGRB-yeel was obtained according to the operation method of 1.1 in Example 1. The recombinant plasmid pGRB-yeel and the overlapping fragment U yeel -P trc -hisA-T trc -D yeel Transformed into competent cells of E. coli ZL10 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL11, and the verification results were as follows Fig.10 shown.

[0147] 2.11 P trc - Integration of hisF / H genes

[0148] Using the genome of Serratia marcescens CGMCC No.19116 as a template, upstream homology arm primers UP-ygay-S (see sequence table 66) / UP-ygay-A (see sequence table 67) and downstream homology arm primers DN-ygay-S (see sequence table 68) / DN-ygay-A (see sequence table 69) were designed according to the upstream and downstream sequences of its ygay gene, and PCR was performed to amplify the upstream and downstream homology arm fragments; primers hisF / HS (see sequence table 70) / hisF / HA (see sequence table 71) were designed according to the hisF / H gene sequence, and PCR was performed to amplify the hisF / H gene fragment (P trcPromoter and T trc The terminator has been designed in the primers hisF / HS and hisF / HA). The above fragments were fused by overlapping PCR to obtain P trc -hisF / H gene integration fragment (U ygay -P trc -hisF / HT trc -D ygay ), the DNA fragment containing the target sequence used to construct pGRB-ygay was prepared by annealing primers gRNA-ygay-S (see sequence list 104) and gRNA-ygay-A (see sequence list 105), and the recombinant plasmid pGRB-ygay was obtained according to the operation method of 1.1 in Example 1. The recombinant plasmid pGRB-ygay and the overlapping fragment U ygay -P trc -hisF / HT trc -D ygay Transformed into competent cells of E. coli ZL11 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL12, verification results such as Fig.11 shown.

[0149] 2.12 P trc - Integration of hisIE gene

[0150] Using the genome of Serratia marcescens CGMCC No.19116 as a template, upstream homology arm primers UP-yjgx-S (see sequence table 72) / UP-yjgx-A (see sequence table 73) and downstream homology arm primers DN-yjgx-S (see sequence table 74) / DN-yjgx-A (see sequence table 75) were designed according to the upstream and downstream sequences of its yjgx gene, and PCR was performed to amplify the upstream and downstream homology arm fragments; primers hisIE-S (see sequence table 76) / hisIE-A (see sequence table 77) were designed according to the hisIE gene sequence, and PCR was performed to amplify the hisIE gene fragment (P trc Promoter and T trc The terminator has been designed in the primers hisIE-S and hisIE-A). The above fragments were fused by overlapping PCR to obtain P trc -hisIE gene integration fragment (U yjgx -P trc -hisIE-T trc -D yjgx), the DNA fragment containing the target sequence used to construct pGRB-yjgx was prepared by annealing primers gRNA-yjgx-S (see sequence list 106) and gRNA-yjgx-A (see sequence list 107), and the recombinant plasmid pGRB-yjgx was obtained according to the operation method of 1.1 in Example 1. The recombinant plasmid pGRB-yjgx and the overlapping fragment U yjgx -P trc -hisIE-T trc -D yjgx Transformed into competent cells of E. coli ZL12 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL13, verification results such as Fig.12 shown.

[0151] 2.13 P trc - Integration of cgl2458 gene

[0152] The genome of Corynebacterium glutamicum was used as a template, upstream homology arm primers UP-yghE-S (see sequence table 78) / UP-yghE-A (see sequence table 79) and downstream homology arm primers DN-yghE-S (see sequence table 80) / DN-yghE-A (see sequence table 81) were designed according to the upstream and downstream sequences of its yghE gene, and the upstream and downstream homology arm fragments were amplified by PCR; primers cgl2458-S (see sequence table 82) / cgl2458-A (see sequence table 83) were designed according to the cgl2458 gene sequence, and the cgl2458 gene fragment (P trc Promoter and T trc The terminator has been designed in the primers cgl2458-S and cgl2458-A). The above fragments were fused by overlapping PCR to obtain P trc -Integrated fragment of cgl2458 gene (U yghE -P trc -cgl2458-T trc -D yghE ), the DNA fragment containing the target sequence used to construct pGRB-yghE was prepared by annealing primers gRNA-yghE-S (see sequence list 108) and gRNA-yghE-A (see sequence list 109), and the recombinant plasmid pGRB-yghE was obtained according to the operation method of 1.1 in Example 1. The recombinant plasmid pGRB-yghE and the overlapping fragment U yghE -P trc -cgl2458-T trc -D yghETransformed into competent cells of E. coli ZL13 containing pREDcas9 plasmid, and lost the plasmid according to the operation method 1.4 in Example 1, and finally obtained strain E. coli ZL14, verification results such as Fig.13 shown.

[0153] Example 2: Production of histidine by shake flask fermentation using genetically engineered bacteria

[0154] The composition of the seed culture medium is: 25 g / L glucose, 5 g / L yeast powder, 1 g / L peptone, 1.5 g / L citric acid, 1.8 g / L K2HPO4, 0.5 g / L MgSO4, 10 mg / L FeSO4, 10 mg / L MnSO4, 1.0 mg / L B Mix(V B Mix is ​​composed of V B1 、V B3 、V B5 、V B12 The mixture was mixed evenly. ), the rest was water, pH was 7.0-7.5, 121°C, and high pressure steam sterilized for 20 min.

[0155] The fermentation medium composition is: 20 g / L glucose, 4 g / L yeast powder, 2 g / L citric acid, 3.5 g / L K2HPO4, 1.8 g / L MgSO4, 20 mg / L FeSO4, 10 mg / L MnSO4, 2.0 mg / L B Mix(V B Mix is ​​composed of V B1 、V B3 、V B5 、V B12 The mixture was mixed evenly. ), 0.2 g / L methionine, 1 g / L monosodium glutamate, the rest was water, pH was 7.0-7.5, 121°C, and high pressure steam sterilization was performed for 20 min.

[0156] First, the genetically engineered strain was inoculated from the solid slant into a triangular flask containing a seed culture medium, and cultured at 37°C and 180 r / min for 12 h. Then, the seed culture was inoculated with 10-15% of the inoculation amount into a triangular flask containing a fermentation culture medium for fermentation culture, and cultured at 37°C and 180 r / min for 24 h. During the fermentation process, ammonia water was added to maintain the pH between 7.0 to ensure the normal growth of the strain, and a glucose solution with a mass concentration of 60% (m / v) was added in time to maintain the normal fermentation process.

[0157] The concentration of histidine in the fermentation supernatant was detected by high performance liquid chromatography. Fig.14 As shown. E. coliZL14 had the highest histidine production in shake flask fermentation, reaching 4.5 g / L. The experimental results show that the introduction of the histidine operon can significantly improve the ability of engineered bacteria to produce histidine by fermentation. After the genome overexpressed hisG / D / B, the strain E. coli ZL10 was able to produce 0.78 g / L histidine. Further, by overexpressing the hisA gene in the genome, the yield of the strain E. coli ZL11 increased by 1.9 times to 1.48 g / L. Further, by overexpressing the hisF / H gene in the genome, the yield of the strain E. coli ZL12 increased by 2.1 times to 3.15 g / L. In addition, the introduction of exogenous histidine transporter increased the efflux of histidine and promoted the growth of the bacteria. By overexpressing the cgl2458 gene in the genome, the biomass OD of the strain E. coli ZL14 600 The value increased from 39.5 to 55.8, and the histidine production increased from 3.15 g / L to 4.5 g / L.

[0158] Example 3: Production of histidine by fermentation in a fermenter using genetically engineered bacteria

[0159] The composition of the seed culture medium is: 25 g / L glucose, 5 g / L yeast powder, 1 g / L peptone, 1.5 g / L citric acid, 1.8 g / L K2HPO4, 0.5 g / L MgSO4, 10 mg / L FeSO4, 10 mg / L MnSO4, 1.0 mg / L B Mix(V B Mix is ​​composed of V B1 、V B3 、V B5 、V B12 The mixture was mixed evenly. ), the rest was water, pH was 7.0-7.5, 121°C, and high pressure steam sterilized for 20 min.

[0160] The fermentation medium composition is: 20 g / L glucose, 4 g / L yeast powder, 2 g / L citric acid, 3.5 g / L K2HPO4, 1.8 g / L MgSO4, 20 mg / L FeSO4, 10 mg / L MnSO4, 2.0 mg / L B Mix(V B Mix is ​​composed of V B1 、V B3 、V B5 、V B12The mixture was mixed evenly. ), 0.2 g / L methionine, 1 g / L monosodium glutamate, the rest was water, pH was 7.0-7.5, 121°C, and high pressure steam sterilization was performed for 20 min.

[0161] Use an inoculation loop to scrape 3-5 loops of bacteria from the -80℃ refrigerator tube, evenly spread on the LB slant medium, culture at 37℃ for 12 h, transfer to an eggplant-shaped bottle and continue to culture for 12-15 h; take 100-150 mL of sterile water in the eggplant-shaped bottle, inoculate the bacterial suspension into the seed culture medium, maintain the pH of the fermentation liquid at around 7.0, control the dissolved oxygen between 30-35%, stir at 200-500 r / min, keep the temperature constant at 35℃ for 6 h, and culture until the fermentation liquid OD reaches 0. 600 The value reached 10-15. According to the inoculation rate of 20%, the fresh fermentation medium was added and the fermentation was started. The fermentation temperature was 37 ℃, the stirring speed was 300-900 r / min, the dissolved oxygen was controlled between 25-35%, and the pH was maintained stable at about 7.0; when the glucose in the medium was consumed, 80% (m / v) glucose solution was added to maintain the final mass concentration of residual sugar at 0.1-0.6% (m / v) and fermented for 48 hours.

[0162] The concentration of histidine in the fermentation supernatant was detected by high performance liquid chromatography. Fig.15 As shown. The maximum histidine yield of E. coli ZL14 after 44 h fermentation reached 45.8 g / L, and the sugar-acid conversion rate reached 20.3%. The primer sequence information used in the implementation of the present invention is as follows:

[0163]

[0164] The relevant sequences in the present invention are as follows:

[0165] 1 prs gene from Escherichia coli MG1655

[0166] ATGCCTGATATGAAGCTTTTTGCTGGTAACGCCACCCCGGAACTAGCACAACGTATTGCCAACCGCCTGTACACTTCACTCGGCGACGCCGCTGTAGGTCGCTTTAGCGATGGCGAAGTCAGCGTACAAATTAATGAAAATGTACGCGGTGGTGATATTTTCATCATCCAGTCCACTTGTGCCCCTACTAACGACAACCTGATGGAATTAGTCGTTATGGTTGATGCCCTGCGTCGTGCTTCCGCAGGTCGTATCACCGCTGTTATCCCCTACTTTGGCTATGCGCGCCAGGACCGTCGCGTCCGTTCCGCTCGTGTACCAATCACTGCGAAAGTGGTTGCAGACTTCCTCTCCAGCGTCGGTGTTGACCGTGTGCTGACAGTGGCTCTGCACGCTGAACAGATTCAGGGTTTCTTCGACGTTCCGGTTGATAACGTATTTGGTAGCCCGATCCTGCTGGAAGACATGCTGCAGCTGAATCTGGATAACCCAATTGTGGTTTCTCCGGACATCGGCGGCGTTGTGCGTGCCCGCGCTATCGCTAAGCTGCTGAACGATACCGATATGGCAATCATCGACAAACGTCGTCCGCGTGCGAACGTTTCACAGGTGATGCATATCATCGGTGACGTTGCAGGTCGTGACTGCGTACTGGTCGATGATATGATCGACACTGGCGGTACGCTGTGTAAAGCTGCTGAAGCTCTGAAAGAACGTGGTGCTAAACGTGTATTTGCGTACGCGACTCACCCGATCTTCTCTGGCAACGCGGCGAACAACCTGCGTAACTCTGTAATTGATGAAGTCGTTGTCTGCGATACCATTCCGCTGAGCGATGAAATCAAATCACTGCCGAACGTGCGTACTCTGACCCTGTCAGGTATGCTGGCCGAAGCGATTCGTCGTATCAGCAACGAAGAATCGATCTCTGCCATGTTCGAACACTAA

[0167] hisG gene derived from Serratia marcescens CGMCC No.19116

[0168] ATGCTGGACAAGACACGTTTACGGATCACAATGCAGAAGTCGGGCCGCCTGAGCGATGAATCCCAGGAATTGCTGGCGCGCTGCGGCATCAAGATTAACCTGCAGCAGCAGCGTCTGATCGCCTTCGCCGAAAACATGCCGATCGATATCCTGCGCGTGCGCGACGACGACATTCCGGGTCTGGTGATGGACGGCGTGGTCGATCTCGGCATCATCGGCGAGAACGTGCTGGAAGAAGAGCTGCTCAGCCGCCGCGCACAGGGTGAAGACCCGCGCTACTTCACCCTGCGCCGCCTCGATTTCGGCGGCTGCCGCCTGTCGCTGGCCACCCCGCTCGACGCCGAATACGCCGGCCCGCAAAGCCTGCAGGACGCCCGCATCGCCACTTCTTACCCGCACCTGCTGAAGCAATACCTCGACAAACAGGGCGTGCGCTTCAAATCTTACCTGCTGAACGGCTCGGTGGAAGTGTTTCCGCGCGCCGGCCTGGCCGACGCCATCTGCGATCTGGTCTCTACCGGCGCCACGCTGGAGGCCAACGGCCTGCGCGAAGTGGAGGTGATCTACCGCTCCAAAGCTTGCCTGATCCAGCGCGACGGCGAAATGCCTGAAGCCAAACAGCAGCTGATTGACCGCCTGATGACCCGCATTCAGGGCGTGATCCAGGCGCGCGAATCCAAATACATCATGCTGCACGCGCCGAGCGAGAAACTGGATGAGATCGTCGCGCTGCTGCCGGGCGCCGAACGCCCGCAGATTCTGCCGCTGGCCGGTGCGCAGAACCGCGTGGCGATGCACATGGTCAGCAGCAAAACCCTGTTCTGGGAAACCATGGAAAAACTGAAAGCGCTCGGCGCCAGCTCGATTCTGGTGCTGCCGATTGAAAAGATGATGGAGTAA

[0169] 3 hisD gene from Serratia marcescens CGMCC No.19116

[0170]

[0171] 4 hisB gene from Serratia marcescens CGMCC No.19116

[0172]

[0173] 5 hisC gene from Serratia marcescens CGMCC No.19116

[0174]

[0175] The hisA gene derived from Serratia marcescens CGMCC No.19116

[0176] ATGATTATTCCGGCTTTGGATTTGATCGACGGCAACGTGGTGCGTTTGCATCAGGGCGATTACGGCCAACAGCGCGACTACGGCAACGATCCGCTGCTGCGCCTGCAGGACTATCAACAACAGGGCGCCCAGGTGCTGCACCTGGTCGATCTGACCGGCGCCAAAGATCCGGCCGCGCGCCAGATCCCGCTGCTGCGCAAGCTGCTGGCGGGGGTTAACGTGCCGGTGCAGGTCGGCGGCGGCATCCGCAACGAGCAAGACGTCAGCGCCCTGCTGGAGGCCGGCGCCACGCGCGTGGTGATCGGCTCCACCGCGGTGAAACAGCCGCAGTTGGTGCAAAGCTGGTTCGAACGCTATGGCGCCGACGCGCTGGTATTGGCGTTGGATGTGCGCATCGACGCGCAGGGCGTGAAGCGCGTGGCCATCAGCGGCTGGCAGGAAGACTCCGACGCCACGCTTGAACAGGTGGTAGAGCAGTTCCTGCCCTACGGGCTGAAACACGTGCTGTGCACCGACATTTCGCGCGACGGCACGCTGGCCGGTTCCAACGTGGCGCTGTATCAGGCGATCAGCCGCCGCTATCCGCAAGTGGCCTTCCAGGCCTCAGGCGGCATCGGCAATCTGGACGACATCGCCCAGTTGCGCGGCAGCGGCGTTGCCGGCGTGATCGTCGGGCGCGCCCTGCTGGAAGGTAAATTTAGCGTTGAGGAGGCGATTGCATGCTGGCAAAACGGATAA

[0177] The hisF / H gene derived from Serratia marcescens CGMCC No.19116

[0178]

[0179] The hisIE gene derived from Serratia marcescens CGMCC No.19116

[0180] GTGCTGACAGAACAACAGAGAAACCAGCTGGACTGGGAGAAAACCGACGGCCTGATGCCGGCCATCGTGCAACACGCCGTTTCCGGCGAAGTGCTGATGCTGGGTTACATGACGCCGGAAGCGCTGGCGACCACCGAGCAGAGCGGCAATGTCACCTTCTTTTCGCGCACCAAGCAGCGCCTGTGGACCAAAGGCGAAAGTTCCGGCCACTTCCTCAAGGTGGTCAGCATCACGCCGGACTGCGATAACGACACGCTGCTGGTATTGGCCAACCCGATCGGCCCGACCTGCCACCTGGGCAACAGCAGCTGCTTCCATCCGGCCGCCAGCGACTGGACGTTCCTCTATCAGCTGGAACAGCTGTTGGCGGAGCGCAAGCATGCCAGCCCGGACAGCTCATACACCGCCAGCCTGTACGCCAGCGGCACCAAACGCATCGCGCAGAAGGTCGGGGAAGAAGGCGTGGAAACCGCGCTGGCCGCCACGGTCAACGATCGCGAAGAGCTGACCAACGAGGCCTCGGATCTGATCTATCACTTGCTGGTGCTGCTGCAGGACCAGGATTTGGATCTGAGCGCGGTGATCGGCCGGCTGCGCGAGCGGCATCAGAAAAAAGCGTGA

[0181] The cgl2458 gene derived from Corynebacterium glutamicum ATCC 13032

[0182] ATGAATCGCATACTCGGCCCCGAATCGAAGTTCTATGCTGCTCTGAGCCTCTTCGCTGACCTAGTCATCGTGAATGTTCTCTTGGTGATAACGTGCTTTCCCGTATTCACCGGGGGAATGTCCTTGCGCACCGCCCACGCGGTGACCGGCCAGATGGTCC GCGAGGAAGGTTCTCGCCGCGGCTCGGCCTTCGTTCGGGGCCTTTTGACGCGTCCCGGGGTCAACACCGCATGGTGGCTCATTTCCCTCGCCGTCGCCGCCTTAGCCGCGTATGAATTCGCTATCATTGCCAAGGCAGATCTGGGTTCAATGGGCCTGATA CTGCGCGCAGCCTTGATCTCGGGGCTTATCGTATTGGGCTCTGTCAGCGTATGGTTCTTCCATCTCGATGCACCGGGGCTCGGCTTCCGCCAAAGAATCACACAGGCCATGATGAAGGCGGTAGGGCACCTACCGCGTACTCTTTTTGGCAATATTGCCTG GCATAGTGCTTGTTTTGTACCCCGTCTTTTTCCCAGGCAGAGTGGGGAGGCTACCTGTTCTTCCTCGCAGTGCTCGGCCCGGCTCTCGCGGTCTATCTCGCCGAGCTAGTGCTGCAGTGGCCCGAACTCAATTCGCAAACGCCCGATAGCCCCTCTGCATAA

[0183] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A genetically engineered Escherichia coli for producing L-histidine by fermentation, characterized in that: The genetically engineered bacteria are wild-type Escherichia coli ( Escherichia coli MG1655 is the starting strain, and the gene encoding the lactose operon repressor protein is knocked out in the genome lacI and PRPP synthase trans-regulated genes purR ; Integrate the endogenous PRPP synthase encoding gene into the genome prs , Glucose-6-phosphate dehydrogenase encoding gene wxya and 6-phosphate glucose dehydrogenase encoding genes gnd , used to enhance the supply of precursor PRPP; integrating from Serratia marcescens Seven histidine operon genes of CGMCC No.19116 hisG, hisD, hisB, hisC, hisA, hisF / H, hisIE , used to open up the anabolism of histidine; integrated into the genome Corynebacterium glutamicum Membrane protein gene from ATCC 13032 cgl2458 , used to promote the efflux of histidine; The lac operon repressor protein encoding gene lacI The gene sequence is the sequence shown in GenBank: 945007, and the trans-regulatory gene of the PRPP synthase purR The gene sequence is shown in GenBank: 945226, and the PRPP synthase encoding gene prs The gene sequence is the sequence shown in SEQ ID NO.1, and the glucose-6-phosphate dehydrogenase encoding gene wxya The gene sequence is the sequence shown in GenBank: 946370, and the 6-phosphate glucose dehydrogenase encoding gene gnd The gene sequence is the sequence shown in GenBank: 946554. his The gene sequence is the sequence shown in SEQ ID NO.2, hisD The gene sequence is the sequence shown in SEQ ID NO.3, hisB The gene sequence is the sequence shown in SEQ ID NO.4, hisC The gene sequence is the sequence shown in SEQ ID NO.5, hisA The gene sequence is the sequence shown in SEQ ID NO.6, hisF / H The gene sequence is the sequence shown in SEQ ID NO.7, hisIE The gene sequence is the sequence shown in SEQ ID NO.8, and the membrane protein gene cgl2458 The gene sequence is the sequence shown in SEQ ID NO.

9.

2. The method for constructing a genetically engineered Escherichia coli according to claim 1, wherein: The method is obtained by gradual transformation using CRISPR / Cas9-mediated gene editing technology, and the steps are as follows: (1) Knockout of the gene encoding the lactose operon repressor protein lacI ; (2) Knockout of the trans-regulatory gene of PRPP synthase purR ; (3) At pseudogene loci ygh Integration of endogenous PRPP synthase encoding gene prs , by P trc Promoter control; (4) At pseudogene loci yeep Integration of endogenous glucose-6-phosphate dehydrogenase encoding gene wxya , by P trc Promoter control; (5) At pseudogene loci r Integration of endogenous 6-phosphate glucose dehydrogenase encoding gene gnd , by P trc Promoter control; (6) At pseudogene loci yq Integration of exogenous ATP phosphoribosyltransferase encoding gene his , by P trc Promoter control; (7) At pseudogene loci mbha Integration of exogenous histidine aldehyde dehydrogenase encoding gene hisD , by P trc Promoter control; (8) At pseudogene loci yjiv Integration of exogenous histidinol phosphatase encoding gene hisB , by P trc Promoter control; (9) At pseudogene loci gapC Integration of exogenous histidinol phosphate aminotransferase encoding gene hisC , by P trc Promoter control; (10) At pseudogene loci yeel Integration of exogenous 5'-ProFAR isomerase encoding gene hisA , by P trc Promoter control; (11) At pseudogene loci ygay Integration of exogenous IGP synthase encoding gene hisF / H , by P trc Promoter control; (12) At pseudogene loci yj Integration of exogenous PR-ATP pyrophosphohydrolase gene hisIE , by P trc Promoter control; (13) At pseudogene loci yE Integration of foreign membrane protein encoding genes cgl2458 , by P trc Promoter control; The order of operations of steps (1) to (13) in the construction method is not limited and can be performed in any order that can be implemented by a person skilled in the art.

3. The construction method according to claim 2, characterized in that: The P trc The gene sequence of the promoter is the sequence shown in SEQ ID NO.

110.

4. The construction method according to claim 2 or 3, characterized in that: The CRISPR / Cas9-mediated gene editing technology includes constructing a recombinant fragment and a pGRB plasmid, simultaneously transforming the pGRB plasmid and the recombinant fragment into electroporated cells containing pREDCas9, and performing a plasmid elimination step to obtain a recombinant genetic engineering strain.

5. The construction method according to claim 4, characterized in that: The method for constructing the pGRB plasmid comprises: designing a target sequence, preparing a DNA fragment containing the target sequence, and recombining the DNA fragment containing the target sequence with a linearized vector fragment; the target sequence is 5'-NGG-3'; Alternatively, the construction of the recombinant fragment includes constructing a gene-integrated recombinant fragment or constructing a gene-knockout recombinant fragment; wherein the step of constructing a gene-integrated recombinant fragment includes: using the genome of the starting strain as a template, designing upstream and downstream homology arm primers according to the upstream and downstream sequences of the intended insertion site of the target gene, and designing primers according to the target genome, amplifying the target gene fragment, and then obtaining the recombinant fragment by PCR overlap technology.

6. Use of the genetically engineered Escherichia coli bacteria as claimed in claim 1 in the fermentation production of histidine.

7. The method for producing histidine by fermentation of the genetically engineered Escherichia coli bacteria as claimed in claim 1, characterized in that: The steps include: The genetically engineered strain is contacted with a fermentation medium for fermentation culture to prepare histidine.

8. The method according to claim 7, characterized in that: The fermentation culture includes shake flask fermentation or fermentation tank fermentation; During shake flask fermentation, the genetically engineered strain was first inoculated from a solid slant into a triangular flask containing a seed culture medium, and cultured at 37°C and 180 r / min for 12 h. Then, the seed culture was inoculated with 10-15% of the inoculation amount into a triangular flask containing a fermentation culture medium for fermentation culture, and cultured at 37°C and 180 r / min for 24 h. During the fermentation process, ammonia water was added to maintain the pH at 7.0 to ensure the normal growth of the strain, and a 60% mass concentration of glucose solution was added in time to maintain the normal fermentation process. During fermentation in a fermenter, use an inoculation loop to scrape 3-5 loops of bacteria from a -80℃ refrigerator tube, evenly spread on LB slant medium, culture at 37℃ for 12 h, transfer to an eggplant-shaped bottle and continue to culture for 12-15 h; take sterile water in an eggplant-shaped bottle, inoculate the bacterial suspension into the seed medium, maintain the pH of the fermentation liquid at 7.0, control the dissolved oxygen between 30-35%, stir at 200-500 r / min, and keep the temperature constant at 35℃ for 6 h, until the fermentation liquid OD reaches 0. 600 The value reaches 10-15; fresh fermentation medium is added according to 20% inoculation amount, and fermentation is started. The fermentation temperature is 37 ℃, the stirring speed is 300-900 r / min, the dissolved oxygen is controlled between 25-35%, and the pH is maintained stable at 7.0; when the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is added to maintain the final mass concentration of residual sugar at 0.1-0.6%, and the fermentation time is 44 h.

9. The method according to claim 8, characterized in that: The seed culture medium comprises: 25 g / L glucose, 5 g / L yeast powder, 1 g / L peptone, 1.5 g / L citric acid, 1.8 g / L K2HPO4, 0.5 g / L MgSO4, 10 mg / L FeSO4, 10 mg / L MnSO4, 1.0 mg / L B Mix, the rest is water, pH 7.0-7.5, 121℃, high pressure steam sterilization for 20min; The fermentation medium comprises: 20 g / L glucose, 4 g / L yeast powder, 2 g / L citric acid, 3.5 g / L K2HPO4, 1.8 g / L MgSO4, 20 mg / L FeSO4, 10 mg / L MnSO4, 2.0 mg / L B Mix, 0.2 g / L methionine, 1 g / L MSG, the rest is water, pH 7.0-7.5, 121°C, high pressure steam sterilization for 20 min; Among them, the V B Mix is ​​composed of V B1 、V B3 、V B5 、V B12 The resulting mixture was mixed well.

Images