Construction and application of a recombinant Escherichia coli for increasing difucosyllactose production

Abstract

The present invention relates to the construction and application of a recombinant Escherichia coli for improving the production of difucosyllactose, by <h2 style=";text-align:left;direction:ltr">AspSAMT , <h2 style=";text-align:left;direction:ltr"> BfFut3BC and difucosyllactose synthesis pathway <h2 style=";text-align:left;direction:ltr"> manB,manC,gmd,wcaG The recombinant E. coli was integrated into the host E. coli genome to construct a complete synthesis pathway for difucosyllactose, while achieving overexpression of key enzyme genes and strengthening of precursor pathways. By integrating the target gene into the host genome, the purpose of high production of difucosyllactose without the addition of exogenous plasmids and antibiotics was achieved. The recombinant E. coli constructed can efficiently produce difucosyllactose, with a yield of 58.6 g / L in a 5 L fermenter, and has good prospects for industrial application.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to the construction and application of a recombinant Escherichia coli capable of increasing the production of difucosyllactose. Background Art

[0002] The World Health Organization considers breastfeeding to be important for the healthy growth of newborns, mainly due to its nutritional and bioactive components, including human milk oligosaccharides (HMOs). HMOs provide a variety of physiological functions, including establishing a balanced infant gut microbiota, strengthening the gastrointestinal barrier, preventing infection, and potentially supporting the immune system, brain and cognitive development. Difucosyllactose (DFL) is one of the typical fucosylated HMOs. DFL not only promotes the growth and development of newborns, but also has important antibacterial activity. Compared with 2'-FL and 3-FL, it can significantly inhibit the growth and reproduction of group B streptococci (GBS). At the same time, DFL can also inhibit the release of platelet proinflammatory proteins. In addition, DFL has been shown to promote intestinal health by selectively promoting the colonization of bifidobacteria. To date, DFL has been approved and authorized as a new food additive by the European Food Safety Authority (EFSA) and the US Food and Drug Administration (FDA).

[0003] At present, the synthesis methods of DFL include chemical synthesis, enzymatic synthesis and microbial synthesis. The synthesis of DFL by chemical methods requires chemical reagents and harsh reaction conditions, which is neither environmentally friendly nor economical. In contrast, the biosynthesis method only requires mild conditions and low-cost reagents, providing a more economical and environmentally friendly strategy for the synthesis of DFL. At present, the DFL yield obtained by microbial cell factories is still low. The present invention aims to use synthetic biology to construct a high-yield strain that can increase the yield of DFL by weakening metabolic branch pathways, enhancing precursor synthesis pathways, fusion proteins and other strategies, in order to achieve efficient synthesis of DFL. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a construction and application of a recombinant Escherichia coli for increasing the production of difucosyllactose.

[0005] The technical solution adopted by the present invention is: a recombinant Escherichia coli for increasing the production of difucosyllactose, using Escherichia coli as the chassis host, knocking out the gene encoding β-galactosidase lacZ , genes encoding outer membrane polysaccharide export proteins wza , knockout of genes encoding protein tyrosine phosphatases wzb , knockout of genes encoding protein tyrosine kinases wzc , knockout of the gene encoding UDP-glucuronosyltransferase wcaA , knocking out the gene encoding galactosyltransferase wcaC, knocking out the gene encoding colanic acid polymerase wcaD , knockout of the gene encoding fucosyltransferase wcaE , knockout of the gene encoding acetyltransferase wcaF ;

[0006] Knockout of the gene encoding UDP-glucose lipid transporter wcaJ , knock out the gene encoding Enterobacterial common antigen polymerase wzyE , knockout of the gene encoding dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase vioA , knockout of the gene encoding imidazole glycerol phosphate synthase hisF , knockout of the gene encoding UDP-N-acetyl-D-mannosamine uronosyltransferase wecG , knock out the gene encoding α-D-acetylglucosamine-pyrophosphate-polyphenol β-1,3-galactosyltransferase wbbD , knockout of the gene encoding dTDP-glucose 4,6-dehydratase rffG ;

[0007] Integration of a gene encoding phosphomannose mutase into the genome of the chassis host manB , integration of the gene encoding mannose-1-phosphate guanosyltransferase manC , integration of the gene encoding GDP-D-mannose-4,6-dehydratase gmd , integration of the gene encoding GDP-L-fucose synthase fcl , integration of the gene encoding α-1,3-fucosyltransferase BfFut3BC , integration of the gene encoding α-1,2-fucosyltransferase AspSAMT .

[0008] Preferably, the gene fragment encoding the fusion protein of α-1,3-fucosyltransferase and α-1,2-fucosyltransferase linked by a flexible linker peptide GSAGSAAGSGEF is integrated into the genome of the chassis host.

[0009] Preferably, the gene encoding UDP-glucose lipid carrier transferase is knocked out. wcaJ and the gene encoding Enterobacterial common antigen polymerase wzyE phosphomannose mutase gene manB and the gene encoding mannose-1-phosphate guanosyltransferase manC ;

[0010] knockout of the gene encoding dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase vioA and the gene encoding imidazole glycerol phosphate synthase hisF The gene encoding GDP-D-mannose-4,6-dehydratase was integrated into the gmdand the gene encoding GDP-L-fucose synthase fcl ;

[0011] In the knockout of the gene encoding UDP-N-acetyl-D-mannosamine uronosyltransferase wecG , encoding α-D-acetylglucosamine-pyrophosphate-polyphenol β-1,3-galactosyltransferase gene wbbD and the gene encoding dTDP-glucose 4,6-dehydratase rffG The gene encoding α-1,3-fucosyltransferase was integrated into the BfFut3BC and the gene encoding α-1,2-fucosyltransferase AspSAMT .

[0012] Preferably, the gene encoding GDP-D-mannose-4,6-dehydratase is replaced gmd The original promoter is the strong promoter J23119.

[0013] Preferably, the gene encoding α-1,3-fucosyltransferase BfFut3BC The codon-optimized nucleotide sequence is shown in SEQ ID NO.1; encoding α-1,2-fucosyltransferase gene AspSAMT The codon-optimized nucleotide sequence is shown in SEQ ID NO.2.

[0014] A method for preparing difucosyllactose is obtained by culturing and fermenting recombinant Escherichia coli with increased difucosyllactose production.

[0015] Preferably, the recombinant Escherichia coli with increased difucosyllactose production is cultured and fermented using glycerol as a carbon source and lactose as a substrate.

[0016] Preferably, the culture medium comprises: 15-20 g / L glycerol, 10-13.5 g / L potassium dihydrogen phosphate, 1.0-2.0 g / L citric acid, 3.0-5.0 g / L diammonium hydrogen phosphate, 1.0-2.0 g / L magnesium sulfate heptahydrate, and 5-10 ml / L trace metal elements;

[0017] Trace metal elements include 2.25 g / L zinc sulfate water, 10 g / L ferrous sulfate, 0.35 g / L manganese sulfate monohydrate, 1.0 g / L anhydrous copper sulfate, 0.23 g / L sodium borate decahydrate, 2.0 g / L calcium chloride dihydrate, and 0.11 g / L ammonium molybdate.

[0018] Preferably, the specific steps are: inoculating the recombinant Escherichia coli with improved difucosyllactose production into the fermentation tank culture medium, and when the cell density OD 600 When it reached 10, lactose was added to the fermentation system to 10 g / L, and the culture temperature was set at 30 °C;

[0019] Every 12 hours, lactose was added to the fermenter to 10 g / L and glycerol was added to 20 g / L; the pH value of the fermentation liquid was maintained at 6.8-7.2;

[0020] Preferably, during the fermentation process, the ventilation volume is set to 3-7 vvm and the stirring speed is set to 250-850 r / min.

[0021] The invention relates to an application of a preparation method of difucosyllactose in preparing food or medicine containing difucosyllactose.

[0022] The advantages and significant results of the present invention are specifically embodied in the following aspects: by precisely modifying the chassis host, Escherichia coli, we have successfully constructed a complete biosynthetic pathway for difucosyllactose; the advantage of this method is that it does not require the introduction of exogenous plasmids, and does not require the addition of antibiotics during the fermentation process, thereby significantly improving the biosafety of the final product while ensuring high yield of difucosyllactose;

[0023] Shake flask fermentation experiments verified that recombinant Escherichia coli can produce 8.42 g / L of difucosyllactose. In a 5 L fermenter experiment, the difucosyllactose output was 58.6 g / L, proving that the constructed recombinant Escherichia coli can exhibit excellent difucosyllactose production capacity, indicating that it has broad application potential and good market prospects in industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Synthesize difucosyllactose metabolic pathway for recombinant Escherichia coli;

[0025] Figure 2 Comparison of the yield of difucosyllactose produced by fermentation of different integrated strains;

[0026] Figure 3 The dynamic changes of products and substrates and the growth curve of strain B8 in fed-batch fermentation in a 5L fermenter. DETAILED DESCRIPTION

[0027] The embodiments of the present invention are described below with reference to the accompanying drawings.

[0028] The present invention relates to the construction and application of a recombinant Escherichia coli for increasing the production of difucosyllactose. λ -Red gene editing method to knock out the bypass gene β-galactosidase lacZ UDP-glucose lipid carrier transferase gene wcaJ et al., integrating the key enzyme genes of the precursor substance GDP-L-fucose synthesis pathway manB , manC ,gmd and fcl . Further, the integration insertion is derived from Bacillus fengqiuensis α-1,3-fucosyltransferase gene BfFut3BC and from Azospirillum sp. α-1,2-fucosyltransferase gene AspSAMT , constructing a complete synthesis pathway for difucosyllactose. By integrating the key enzyme gene into the host genome, the stable expression of the gene is achieved, and no antibiotics are added, which is more in line with the concept of green, healthy and safe production of difucosyllactose. Figure 1 As shown, through the transformation, the proportion of the difucosyllactose synthesis pathway in Escherichia coli was significantly increased, and the production of difucosyllactose was increased.

[0029] Using Escherichia coli BL21 (DE3) as the host, the gene encoding β-galactosidase was knocked out lacZ ; Knockout of genes encoding outer membrane polysaccharide export proteins wza (NP_310894.1), knockout of the gene encoding protein tyrosine phosphatase wzb (NP_310893.1), knockout of the gene encoding protein tyrosine kinase wzc (NP_416564.4), knockout of the gene encoding UDP-glucuronosyltransferase wcaA (NP_310891.1), knockout of the gene encoding galactosyltransferase wcaC (NP_310889.1), knockout of the gene encoding colanic acid polymerase wcaD (NP_416560.1), knockout of the gene encoding fucosyltransferase wcaE (NP_310887.1), knockout of the gene encoding acetyltransferase wcaF (NP_416558.1) and replace the gene encoding GDP-D-mannose-4,6-dehydratase gmd The original promoter is the strong promoter J23119.

[0030] Knockout of the gene encoding UDP-glucose lipid transporter wcaJ (NP_310879.1), knock out the gene encoding Enterobacter common antigen polymerase wzyE (NP_312754.1), and the gene encoding phosphomannose mutase was integrated at the above sites manB (WP_001590293.1) and mannose-1-phosphate guanosine transferase gene manC (NP_310881.1); Knockout of the gene encoding dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase vioA(WP_000998544.1), knockout of the gene encoding imidazole glycerol phosphate synthase hisF (NP_310853.1), and the gene encoding GDP-D-mannose-4,6-dehydratase was integrated at the above sites gmd (WP_005128297.1) and GDP-L-fucose synthase gene fcl (NP_416556.1);

[0031] Knockout of the gene encoding UDP-N-acetyl-D-mannosamine uronosyltransferase wecG (NP_418242.1), knockout of the gene encoding α-D-acetylglucosamine-pyrophosphate-polyphenol β-1,3-galactosyltransferase wbbD (WP_001278664.1), knockout of the gene encoding dTDP-glucose 4,6-dehydratase rffG (YP_026255.1), the fusion protein gene α-1,3-fucosyltransferase gene connected by the flexible linker peptide GSAGSAAGSGEF was integrated at the above site BfFut3BC (MDQ0246204.1) and α-1,2-fucosyltransferase gene AspSAMT (WP_10915602.1). A flexible connecting peptide is used to connect α-1,3-fucosyltransferase and α-1,2-fucosyltransferase to form a fusion protein, which mediates the self-assembly of key pathway enzymes to form a skeleton-free multi-enzyme complex, bringing pathway enzymes together, which can improve spatial organization and enhance metabolic flux. The gene fragment integrated into the genome can be a single copy or multiple copies, specifically single copy, double copy, three copies or four copies.

[0032] Among them, the gene encoding α-1,3-fucosyltransferase BfFut3BC The codon-optimized nucleotide sequence is shown in SEQ ID NO.1; encoding α-1,2-fucosyltransferase gene AspSAMT The codon-optimized nucleotide sequence is shown in SEQ ID NO.2.

[0033] SEQ ID NO.1

[0034] ATGAAGCCGAAAATCAAGATCAACTTCACCGATTTTTGGCCGGGTTTTGATAAAAAGAATAACTTCTTCACCAACCTGCTGGAAACCAAATATAAAATCACCATCAGCGACGTGCCGGATTATCTGTTTTATAGTTGCTTTGGCATGGACTTTCTGAATTATGATTGCGTGCGCATTTTCTATACCGGCGAAGATCGCCAGCCGGATTTTAATCTGTGCGATTATGCCATTGGCTTTAGTTATCTGAGCTTTGATAACCGTTACATCCGCTTTCCGCTGTATTTTCTGTATACCGAAGATTATATGCTGGCCAAAAACAAACACCTGATTAGTGAAAACGAGATCGAAGAAAAGGTGCTGTTTTGCAATTTCATCTACAGTAACGGCAGTGCACATCGCAATCGTGAATTTTTCTATGATCTGCTGAGCAAATACAAGACCGTGGATAGTGGCGGCGGCTTTCGCAATAATCTGAGCTATCGTGTTGGCAATAAGCTGCAGTTTCAGAAAAAATACAAGTTCAGCATCGCCTTTGAGAATAATACCAGCGAAGGCTATACCACCGAAAAAATTATTCAGGCCTTCGCCGCACAGACCATTCCGATCTATTGGGGTAATCCGAGTATTAGTAAGGAATTCAATAGCAACGCGTTCATTAACTGCCATGATTTTCATAGTTTCGAGGATGTGGTGAAACGCATTGAAGAAATTGATAACGACAAGCAGCTGTTTTGCAAAATTCTGAAAGAGCCGATCTATCTGGATGATGTTAATCAGGATGAGATCGGCGAAAAACAGCTGCTGAAATTTCTGAGTAGCATTTTTAACAGCAAGTACGATCTGGCATTCAAACGTAGTAAATAA

[0035] SEQ ID NO.2

[0036] ATGAAGGCCTGGCTGCCTCTGCTGCTGCGTTTAGCACTGGTTGTTCTGCTGGTGGCCTTTGTGACCAGCCCGGGTTGGTTTGAACCGCTGCTGAAACCGCTGACCGAAAATAATGCCCCGGTTATCTATAATCAGGGTAGCCTGCTGACCCTGACCCTGTTACATCTGCGCACCGTGCTGATTGCCA CCGTTGCAGCTACCATTGTTGCAGTTGCCCTGGCCATTCTGGTTACCCGTCCGGCAGGTGCTGAATTTCTGCCGCTGAGCCGCAGCCTGGTTAATATTGGCCAGACCTTTCCGCCGGTTGCAGTTTCTGGCACTGGCCGTGCCTGCTGTTGGTTTTGGCGAAAAACCGACCCTGATTGCCCTGTTTCTG TATGGTCTGCTGCCGATTTTTGAAAATGCCCTGACCGGCCTGACCACCCTGCCTACCAATGTTGTTGAAGCAGCCCGCGGCGCAGGTATGACAGGTTGGCAGAGACTGACCAAAGTGGAACTGCCGCTGAGTGCACCGATTATTCTGGGTGGTATTCGTCTGAGTGTGGTTATTAGTCTGGCCACCG CAACCATTGGTAGTACCGTGGCAGCCAAAACCCTGGGTGAAGTTATTATTGCAGGCCTGCTGAGTAATAATCTGGCATTCATTCTGCAGGGTGGCCTGATTGTGGCCGCCTTAGCAGTGCTGATCTATGATGGCCTGAGCGCAGTGGAACGCTATGCCGCACGTCGTATGGGCCGTGAAGCCGAGTAA

[0037] In a specific embodiment of the present invention, we used the λ-Red homologous recombination system to achieve precise knockout of the target gene. First, the pKD46 plasmid (with the gentamicin resistance gene) was introduced into the host strain BL21 (DE3) to induce the expression of the recombinase. Subsequently, a two-step homologous recombination strategy was performed using the strain carrying the recombinase activity. In the first step, the chloramphenicol resistance gene ( cat ) and sucrose sensitive gene ( sacB ) fused to form cat-sacBAfter completing this step, the recombinant product is introduced into the cell by electroporation and screened on a selective plate containing chloramphenicol and gentamicin to obtain successful integration. cat-sacB Then, the selected colonies were identified by PCR to confirm the initial knockout of the target gene. sacB The cell-lethal effect caused by sucrose polymerization of the gene was eliminated by implementing a reverse screening strategy to exclude strains that still carried the cat-sacB fragment. After this process, the remaining strains were identified by PCR again, and combined with sequencing technology, a double verification method was used to ensure the successful integration of the target gene and the complete elimination of the knockout fragment, and finally the target strain with successful integration of the target gene was obtained.

[0038] In this study, recombinant Escherichia coli was used as a fermentation strain, glycerol was used as the main carbon source, and lactose was used as a substrate for cultivation or fermentation. In this process, the cultivation of recombinant Escherichia coli can be achieved through a shake flask system or a fermentation tank system. In the selection of culture medium, the optimized DM culture medium was used to promote the growth and metabolism of recombinant Escherichia coli. The main components of DM culture medium are: 15-20 g / L glycerol, 10-13.5 g / L potassium dihydrogen phosphate, 1.0-2.0 g / L citric acid, 3.0-5.0 g / L diammonium hydrogen phosphate, 1.0-2.0 g / L magnesium sulfate heptahydrate and 5-10 ml / L trace metal elements; trace metal elements contain 2.25 g / L zinc sulfate, 10 g / L ferrous sulfate, 0.35 g / L manganese sulfate monohydrate, 1.0 g / L anhydrous copper sulfate, 0.23 g / L sodium borate decahydrate, 2.0 g / L calcium chloride dihydrate, and 0.11 g / L ammonium molybdate.

[0039] In this study, the previously constructed recombinant E. coli was cultured and fermented in a 5L fermenter (containing 2L DM medium). 600When it reached 10, lactose was added to the system to increase its concentration to 10 g / L, and the culture temperature was adjusted to 30 degrees Celsius. In order to maintain the stability of the culture conditions and ensure the normal growth of the bacteria, a periodic feeding strategy was implemented, that is, lactose (10 g / L) and glycerol (20 g / L) were added to the fermenter every 12 hours. In addition, the pH value of the fermentation broth was maintained in the range of 6.8 to 7.2 by timely addition of concentrated ammonia water. During the fermentation process, the ventilation volume was set at 3 vvm ~ 7vvm, and the stirring speed was set at 250-850 r / min. Finally, the shake flask fermentation experiment verified that the recombinant Escherichia coli can produce 8.42 g / L of difucosyllactose. In the 5 L fermenter experiment, the difucosyllactose production was 58.6 g / L. This achievement demonstrates the great potential and broad application prospects of the recombinant engineering bacteria in industrial production.

[0040] The scheme of the present invention is described below in conjunction with the accompanying drawings, wherein the experimental methods without specific operating steps are carried out in accordance with the corresponding product instructions. The instruments, reagents, and consumables used in the examples can be purchased from commercial companies unless otherwise specified. The commercial products such as plasmids, PCR enzymes, column DNA extraction kits, DNA gel recovery kits, and bacterial genome extraction kits used in the examples are specifically operated in accordance with the instructions in the kits. Colony PCR, agarose gel electrophoresis, electrotransformation, preparation of competent cells, etc. are performed in accordance with conventional operating methods. The construction of the plasmid was completed by Suzhou Hongxun Biotechnology Co., Ltd., and DNA product sequencing and PCR primer synthesis were completed by Anshengda (Tianjin) Biotechnology Co., Ltd.

[0041] Preparation of competent E. coli: The night before, inoculate the bacterial solution in the E. coli preservation tube into a shake flask containing 20 ml LB medium at a ratio of 1:1000, and add the corresponding resistance antibiotics in proportion. The next day, inoculate the bacterial solution in the shake flask into 100 mL LB medium at a ratio of 1:100, and add the corresponding resistance antibiotics and inducers in proportion. When the bacteria grow to OD 600 When the concentration reaches 0.4-0.6, place it on ice for 25-30 minutes, then centrifuge the bacterial solution in batches at 4°C and 5500rpm for 5 minutes, collect the precipitate, wash the precipitate three times with a 10% glycerol aqueous solution precooled at 4°C, and finally resuspend the precipitate with 500ul-800ul 10% glycerol aqueous solution, divide it into 1ml centrifuge tubes and place it in a -80°C refrigerator for later use. Inducer concentration: The final concentration of L-arabinose added during the preparation of E. coli sensing is 5%.

[0042] Antibiotic concentration: ampicillin 100 mg / L, streptomycin 50 mg / L, gentamicin 25 mg / L, chloramphenicol 25 mg / L.

[0043] LB liquid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride; LB solid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride, 15 g / L agar.

[0044] Example 1: Construction of recombinant Escherichia coli with increased difucosyllactose production

[0045] 1.1 Escherichia coli lacZ Gene knockout

[0046] Design primers lacZ-csF / R, use pRE112 plasmid as template, amplify lacZ-cat-sacB fragment, and recover DNA fragment by primer gel.

[0047] The PCR system is as follows;

[0048]

[0049] PCR reaction conditions: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 68°C for 30 s / kb, 35 cycles, final extension at 68°C for 10 min, and storage at 4°C.

[0050] Prepare competent E. coli containing pKD46 plasmid and add 0.5% arabinose to induce λ - Red recombinase expression.

[0051] Add an appropriate amount of lacZ-cat-sacB fragment to the prepared competent cells and transform them by electroporation. Place the transformed bacterial solution in a recovery medium, then place it in a 30°C shaker for recovery for 1.5-2 h, then apply it to a double-resistant solid culture dish with chloramphenicol resistance and gentamicin resistance, and culture it at 30°C overnight to obtain lacZ Successful recombination of gene positions cat- scaB Fragments of Escherichia coli.

[0052] Primers lacZ-up-F / R and lacZ-down-F / R were designed, and the BL21 (DE3) genome was used as a template. The fragments were recovered by gel, and then the two fragments were connected by overlap extension PCR.

[0053] The PCR system is as follows;

[0054] GenStar 2xSuper HiFi

[0055]

[0056] PCR reaction conditions: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 30 s / kb, 30 cycles, final extension at 72°C for 5 min, and storage at 4°C.

[0057] Get in lacZ Successful recombination of gene positions cat-scaB After the E. coli with the fragment was further prepared, the competent cells were added with the lacZ-up-down fragment and transformed by electroporation. After resuscitation in a 30°C shaker for 1.5-2 h, the cells were transferred to a shake flask containing 20 ml LB medium (containing 20% ​​sucrose and no NaCl), and cultured in a 30°C incubator overnight. After that, 1 ml of the bacterial solution was diluted to 10 with sterile water. -1 ~10 -7 Different gradients, take 10 -3 ~10 -5 1 ml of the gradient dilution solution was spread on solid LB culture plates containing 10% sucrose and no NaCl. After overnight culture in a 30°C incubator, single colonies were picked by plate copying and placed on solid culture plates with gentamicin and chloramphenicol resistance and solid culture plates with only gentamicin resistance. After overnight culture in a 30°C incubator, colonies that did not grow on the double-resistance culture plates but grew normally on the single-resistance culture plates were picked for colony PCR identification. After successful identification, the sequencing company was responsible for the relevant sequencing work.

[0058] After verifying that the gene has been successfully knocked out, pick a single colony and inoculate it into a shake flask containing 20 ml LB medium and place it in a 30℃ shaker for overnight culture. Also, take part of the bacterial liquid and streak it onto a solid LB culture dish without antibiotic resistance. After culture, pick a single colony and verify by PCR whether the pKD46 plasmid has been eliminated. Successful verification is the recombinant E. coli EL, named B0.

[0059] 1.2 wza-wcaF Whole-segment knockout of genes and gmd Gene promoter replacement

[0060] wza-wcaF The specific operation process of knocking out the entire gene is the same as step 1.1. The knockout fragment includes gmd The original promoter, when wza-wcaFAfter the cat-scaB fragment was successfully recombined at the gene position, primers wza-up-F / R and wcaF-down-F / R were designed, using the BL21 (DE3) genome as a template; primers J23119-up-F / R and J23119-down-F / R were designed, using the plasmid carrying J23119 as a template, and the three fragments were recovered by gel. The three fragments were then connected by overlap extension PCR, and the fragments were electroporated into B0 competent cells. After verifying the successful recombination, strain B1 was obtained.

[0061] Gene gmd The original promoter was replaced with the strong promoter J23119, which can enhance the expression of the precursor pathway gene gmd. Experiments have shown that the expression vectors before and after the promoter modification will have differences in the production of difucosyllactose. After replacing the expression vector with the strong promoter J23119, the production of difucosyllactose was significantly increased.

[0062] 1.3 wcaJ Gene knockout and manC , manB Genetic recombination

[0063] manC , manB The recombinant fragment of the gene wcaJ Upstream and downstream homology arms and those initiated by M1-93 manC , manB The three fragments were connected together by overlapping extension PCR. Knockout was performed as described in step 1.1 wcaJ Gene and recombination manC , manB gene, and strain B2 was constructed.

[0064] 1.4 Construction of recombinant E. coli

[0065] Knock out the gene as in step 1.1 or step 1.2 wzyE and integrate the gene at the knockout site manC , manB , strain B3 was constructed; knockout gene vioA , and integrate the gene at the knockout site gmd , fcl , strain B4 was constructed; knockout gene hisF , recombinant gene gmd , fcl , strain B5 was constructed; knockout gene wecG , recombinant expression of the gene fragment of α-1,3-fucosyltransferase and α-1,2-fucosyltransferase fusion protein connected by flexible linker peptide BfFut3BC- Flexible linker peptide- AspSAMT, strain B6 was constructed; knockout gene wbbD , recombinant expression of the gene fragment of α-1,3-fucosyltransferase and α-1,2-fucosyltransferase fusion protein connected by flexible linker peptide BfFut3BC- Flexible linker peptide- AspSAMT , strain B7 was constructed; knockout gene rffG , recombinant expression of the gene fragment of α-1,3-fucosyltransferase and α-1,2-fucosyltransferase fusion protein connected by flexible linker peptide BfFut3BC- Flexible linker peptide- AspSAMT , strain B8 was constructed; the specific construction method is shown in Table 1, and the primer information used is shown in Table 2.

[0066] Table 1. Construction of different strains

[0067]

[0068] Table 2. Primer sequences

[0069]

[0070]

[0071]

[0072]

[0073] Example 2: Analysis of the ability of recombinant Escherichia coli to express and produce difucosyllactose

[0074] 2.1 Strain culture and fermentation:

[0075] The B0-B8 strains prepared in Example 1 were cultured and fermented respectively. A single colony was picked from the corresponding solid LB culture dish and added to a 50 ml conical flask containing 20 ml LB medium without antibiotics. The culture was placed in a 37°C shaker overnight for 11 to 15 h. The next day, 5 ml of the seed solution was transferred to a 250 ml shake flask containing 50 ml DM medium and cultured in a 37°C shaker at 220 rpm until the bacterial OD 600 When the pH value reached 2.4-2.6, the substrate lactose was added to a final concentration of 10 g / L, and the inducer IPTG was added to a final concentration of 0.2 mmol / L. The shaking temperature was then changed to 30°C, the speed remained unchanged, and the culture was continued for 72 h.

[0076] In the 5 L fermentation tank experiment, the initial DM medium was 2 L, the seed inoculation volume was 10% (v / v), and the seed solution was transferred to the fermentation tank at the beginning, the temperature was 37 °C, and when the bacterial OD 600When the fermentation time reaches 10-11 hours, the substrate lactose is added to a concentration of 10 g / L, and the temperature is adjusted to 30°C. 10 g / L lactose and 20 g / L glycerol are added every 12 hours. During the fermentation, 16% ammonia water is added through a constant flow pump to stabilize the pH of the culture medium between 6.8 and 7.2. The dissolved oxygen content is maintained at 25% to 35% by linking the aeration volume (3vvm to 7vvm) and the stirring speed (250 to 850rpm) with the dissolved oxygen value. When the glycerol in the tank is consumed to less than 6g / L, 30 ml of 800 g / L glycerol is added through a constant flow pump. When the lactose concentration is below 2g / L, 30 ml of 300 g / L lactose is added through a constant flow pump.

[0077] The main components of DM medium are: 20 g / L glycerol, 13.5 g / L potassium dihydrogen phosphate, 1.7 g / L citric acid, 1.4 g / L diammonium hydrogen phosphate, 2.0 g / L magnesium sulfate heptahydrate and 10 ml / L trace elements. Trace metal elements include 2.25 g / L zinc sulfate, 10 g / L ferrous sulfate, 0.35 g / L manganese sulfate monohydrate, 1.0 g / L anhydrous copper sulfate, 0.23 g / L sodium borate decahydrate, 2.0 g / L calcium chloride dihydrate and 0.11 g / L ammonium molybdate.

[0078] 2.2 Production detection of difucosyllactose

[0079] The difucosyllactose in the fermentation broth of strains B0-B8 was detected respectively. 1 ml of the fermentation broth was taken into a 2 ml centrifuge tube and centrifuged at 5500 rpm for 15 min. The supernatant was aspirated with a 1 ml sterile syringe and filtered into a liquid phase vial with a 0.22 μm water filter. The DFL production at each period was detected by high performance liquid chromatography (Thermo Scientific UltiMate 3000). HPLC detection conditions: differential refractive index detector; chromatographic column: RezexROA-organic acid (Phenomenex, USA), column temperature: 60 ºC; mobile phase: 5 mM H 2 SO 4 Aqueous solution, flow rate 0.6 mL / min; injection volume 10 μL.

[0080] Figure 2 The comparison of the production of difucosyllactose produced by strains B0-B8 during fermentation is shown. As shown in the figure, the recombinant engineered bacteria B8 transformed by gene editing technology showed a significant advantage in the production capacity of difucosyllactose. This advantage is due to the knockout of key bypass genes and overexpression of key enzyme genes in the synthesis pathway. The difucosyllactose production has been significantly improved by strengthening the difucosyllactose synthesis pathway and regulating the metabolic flow. Figure 3The dynamic changes of product and substrate concentrations and the growth curve of the strain were shown in the 5L fermenter when the B8 strain was fermented using a batch feeding strategy from 0 to 72 hours. As can be seen from the figure, as the fermentation process progresses, the strain continuously consumes the carbon source glycerol and the substrate lactose. At the same time, the strain growth density (OD 600 ) gradually increased, and the production of difucosyllactose also achieved rapid growth. This shows that the reconstructed and optimized engineered bacteria B8 can efficiently produce difucosyllactose. This study has laid a solid foundation for subsequent industrial applications.

[0081] The embodiments of the present invention are described in detail above, but the contents described are only preferred embodiments of the present invention and cannot be considered to limit the scope of implementation of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.

Claims

1. A recombinant Escherichia coli for increasing the production of difucosyllactose, characterized in that: Using Escherichia coli BL21 (DE3) as the host, the gene encoding β-galactosidase was knocked out lacZ , genes encoding outer membrane polysaccharide export proteins wxya , knockout of genes encoding protein tyrosine phosphatases wxya , knockout of genes encoding protein tyrosine kinases wxya , knockout of the gene encoding UDP-glucuronosyltransferase wxya , knocking out the gene encoding galactosyltransferase wxya , knocking out the gene encoding colanic acid polymerase wxya , knockout of the gene encoding fucosyltransferase wxya , knockout of the gene encoding acetyltransferase wxya ; Replacement of the gene encoding GDP-D-mannose-4,6-dehydratase gmd The original promoter is the strong promoter J23119; UDP-glucose lipid transporter transferase gene wxya and the gene encoding Enterobacterial common antigen polymerase wxya phosphomannose mutase gene manB and the gene encoding mannose-1-phosphate guanosyltransferase manC ; knockout of the gene encoding dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase vioA and the gene encoding imidazole glycerol phosphate synthase hisF The gene encoding GDP-D-mannose-4,6-dehydratase was integrated into the gmd and the gene encoding GDP-L-fucose synthase fcl ; In the knockout of the gene encoding UDP-N-acetyl-D-mannosamine uronosyltransferase wxya , encoding α-D-acetylglucosamine-pyrophosphate-polyphenol β-1,3-galactosyltransferase gene wxya and the gene encoding dTDP-glucose 4,6-dehydratase rF The gene encoding α-1,3-fucosyltransferase connected by a flexible linker peptide was integrated into the BfFut3BC and the gene encoding α-1,2-fucosyltransferase AspSAMT ; Among them, the NCBI sequence number of the outer membrane polysaccharide export protein is NP_310894.1, the NCBI sequence number of the protein tyrosine phosphatase is NP_310893.1, the NCBI sequence number of the protein tyrosine kinase is NP_416564.4, the NCBI sequence number of the UDP-glucuronosyltransferase is NP_310891.1, the NCBI sequence number of the galactosyltransferase is NP_310889.1, the NCBI sequence number of the colanic acid polymerase is NP_416560.1, the NCBI sequence number of the fucosyltransferase is NP_310887.1, and the NCBI sequence number of the acetyltransferase is NP_416558.1; The NCBI sequence number of UDP-glucose lipid carrier transferase is NP_310879.1, the NCBI sequence number of Enterobacterial common antigen polymerase is NP_312754.1, the NCBI sequence number of phosphomannose mutase is WP_001590293.1, the NCBI sequence number of mannose-1-phosphate guanosine transferase is NP_310881.1, the NCBI sequence number of dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase is WP_000998544.1, the NCBI sequence number of imidazole glycerol phosphate synthase is NP_310853.1, and the NCBI sequence number of GDP-D-mannose-4,6-dehydratase is WP_00512 8297.1, GDP-L-fucose synthase NCBI sequence number is NP_416556.1, UDP-N-acetyl-D-mannosamine uronyltransferase NCBI sequence number is NP_418242.1, α-D-acetylglucosamine-pyrophosphate-dolexol β-1,3-galactosyltransferase NCBI sequence number is WP_001278664.1, dTDP-glucose 4,6-dehydratase NCBI sequence number is YP_026255.1, α-1,3-fucosyltransferase NCBI sequence number is MDQ0246204.1, and α-1,2-fucosyltransferase NCBI sequence number is WP_10915602.

1.

2. The recombinant Escherichia coli with increased difucosyllactose production according to claim 1, characterized in that: The flexible linker peptide sequence is GSAGSAAGSGEF.

3. The recombinant Escherichia coli with increased difucosyllactose production according to claim 1 or 2, characterized in that: Gene encoding α-1,3-fucosyltransferase BfFut3BC The codon-optimized nucleotide sequence is shown in SEQ ID NO.1; encoding α-1,2-fucosyltransferase gene AspSAMT The codon-optimized nucleotide sequence is shown in SEQ ID NO.

2.

4. A method for preparing difucosyllactose, characterized in that: The difucosyllactose is obtained by culturing and fermenting the recombinant Escherichia coli with improved difucosyllactose production as described in any one of claims 1 to 3.

5. The method for preparing difucosyllactose according to claim 4, characterized in that: The recombinant Escherichia coli with improved difucosyllactose production was cultured and fermented using glycerol as a carbon source and lactose as a substrate.

6. The method for preparing difucosyllactose according to claim 5, characterized in that: The culture medium includes: Glycerol 15-20 g / L, potassium dihydrogen phosphate 10-13.5 g / L, citric acid 1.0-2.0 g / L, diammonium hydrogen phosphate 3.0-5.0 g / L, magnesium sulfate heptahydrate 1.0-2.0 g / L and trace metal elements 5-10 ml / L; Trace metal elements include 2.25 g / L zinc sulfate water, 10 g / L ferrous sulfate, 0.35 g / L manganese sulfate monohydrate, 1.0 g / L anhydrous copper sulfate, 0.23 g / L sodium borate decahydrate, 2.0 g / L calcium chloride dihydrate, and 0.11 g / L ammonium molybdate.

7. The method for preparing difucosyllactose according to claim 6, characterized in that: The specific steps are as follows: the recombinant Escherichia coli with improved difucosyllactose production is inoculated into the fermentation tank medium, and when the cell density OD 600 When it reached 10, lactose was added to the fermentation system to 10 g / L, and the culture temperature was set at 30 °C; Every 12 hours, lactose was added to the fermenter to 10 g / L and glycerol was added to 20 g / L; the pH value of the fermentation liquid was maintained at 6.8-7.

2.

8. The method for preparing difucosyllactose according to claim 7, characterized in that: During the fermentation process, the ventilation volume was set to 3-7 vvm and the stirring speed was set to 250-850 r / min.

9. Use of the method for preparing difucosyllactose according to any one of claims 4 to 8 in preparing foods or medicines containing difucosyllactose.

Images