Activatable transmembrane constructs and degraders

Abstract

The present invention relates to an activatable transmembrane construct and an activatable degrader comprising the same, the activatable transmembrane construct comprising a cell penetrating portion, a cleavable portion and a shielding portion wherein the cell penetrating portion is selected from: a transmembrane peptide, an oligosaccharide peptide and any combination thereof, and / or the shielding portion is selected from a shielding peptide. The activatable transmembrane construct is connected with a target molecule binding part to form an activatable degradant. After the cleavable part is subjected to enzyme digestion, the cell penetrating part shielded by the shielding part is activated, so that the target molecule binding part connected with the cell penetrating part can be mediated to enter the cell to be degraded. After being connected with the activatable transmembrane construct, either a blocking antibody or a non-blocking antibody can achieve the effects of activating T cells and killing tumor cells, and the activatable transmembrane construct has additional benefits.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to an activatable transmembrane construct for membrane protein degradation. Background Art

[0002] Membrane proteins are the main participants in cell-to-cell interactions and play an extremely important role in life processes such as cell signal transduction, differentiation and proliferation, and stress response. They directly affect the occurrence and development of many diseases including malignant tumors and neuropathic pain, and are an important class of drug targets. However, traditional drugs work by blocking the interaction between the extracellular region of membrane proteins and ligands or inhibiting the activity of their intracellular regions, and often have problems of incomplete inhibition or inducing drug resistance. Emerging protein targeted degradation technologies (such as PROTAC) provide a new idea for drug development. By specifically degrading intracellular targets, the protein machinery that causes abnormal phenotypes is directly eliminated. This unique mechanism of action is also applicable to traditional undruggable targets, greatly expanding its drugability range. It is worth noting that PROTACs mainly target intracellular proteins, and the development of membrane protein targeted degradation technology is still in its infancy. There is still huge technical demand and room for expansion, especially membrane protein degradation technology that can be applied to living bodies. Summary of the invention

[0003] In order to solve the above problems existing in the prior art, the present invention provides the following technical solutions.

[0004] In a first aspect of the present invention, an activatable membrane-penetrating construct is provided, which comprises a cell penetrating moiety (CPM), a cleavable moiety (CM) and a blocking moiety (BM).

[0005] In some embodiments, the cell penetrating moiety is selected from the group consisting of: a cell penetrating peptide (CPP), an oligosaccharide peptide, and any combination thereof.

[0006] In some embodiments, the cell penetrating moiety comprises 1 to 30 positively charged amino acid residues.

[0007] In some embodiments, the cell penetrating moiety is selected from polyarginine or polylysine, wherein the polyarginine or polylysine comprises at least 2 amino acid residues.

[0008] In some embodiments, the polymerized monomers of the polyarginine contain D-configuration arginine and / or L-configuration arginine.

[0009] In some embodiments, the polymerized monomer of the polylysine comprises D-configuration lysine and / or L-configuration lysine.

[0010] In some embodiments, the shielding moiety is selected from a blocking peptide (BP).

[0011] In some embodiments, the shielding moiety comprises 1 to 30 negatively charged amino acid residues.

[0012] In some embodiments, the shielding moiety is selected from polyglutamic acid or polyaspartic acid, wherein the polyglutamic acid or polyaspartic acid comprises at least 2 amino acid residues.

[0013] In some embodiments, the polymerized monomer of the polyglutamic acid comprises D-configuration glutamic acid and / or L-configuration glutamic acid.

[0014] In some embodiments, the polymerized monomer of the polyaspartic acid comprises D-configuration aspartic acid and / or L-configuration aspartic acid.

[0015] In some embodiments, the cleavable moiety is a protease substrate peptide, ie, a peptide containing the cleavage site of the protease.

[0016] In some embodiments, the protease is selected from fibroblast activation protein, urokinase-type plasminogen activator, matriptase, legumain and matrix metalloprotease (MMP), preferably MMP2, MMP3 or MMP9 or uPA.

[0017] In some embodiments, the cleavable portion has an amino acid sequence selected from SEQ ID NOs. 33-57 and 79-81.

[0018] In some embodiments, the various parts of the activatable transmembrane construct are linked as follows: CPM-CM-BM.

[0019] In some embodiments, the free end of the cell penetrating portion in the activatable membrane-penetrating construct (i.e., the end opposite to the end to which the cleavable portion is linked) is linked to a sequence (G)n, wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5.

[0020] In some embodiments, the activatable transmembrane construct further comprises an Fc domain, and the Fc domain is selected from the Fc domain of IgG, IgM, IgE, IgA or IgD.

[0021] In some embodiments, the Fc domain is an Fc domain of an IgG, such as an Fc domain of at least one of IgG1, IgG2, IgG3, or IgG4.

[0022] In some embodiments, the Fc domain is from human.

[0023] In some embodiments, the activatable transmembrane construct comprises Fc-CPM-CM-BM from N-terminus to C-terminus.

[0024] In some embodiments, the activatable transmembrane construct comprises Fc-LPXT(G)n-CPM-CM-BM from N-terminus to C-terminus, wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5.

[0025] In some embodiments, the C-terminus of the Fc domain is connected to the cell penetrating portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO.58), wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, wherein X is any amino acid, preferably E, K, N, Q, A.

[0026] In some embodiments, the activatable transmembrane construct further comprises a target binding moiety (TBM). The target binding moiety specifically binds to a membrane protein, such as PD-L1 (programmed cell death-ligand 1), PD-1 (programmed cell death receptor 1), EGFR (epidermal growth factor receptor), HER-2 (human epidermal growth factor receptor-2), or a functional fragment thereof.

[0027] In some embodiments, the target molecule is selected from the group consisting of polypeptides, nucleic acids, small molecules, polysaccharides, lipids, nanoparticles, and any combination thereof.

[0028] In some embodiments, the target molecule binding portion comprises an antibody or an antigen binding fragment thereof. In some embodiments, the target molecule binding portion is connected to the N-terminus of the activatable transmembrane construct.

[0029] In some embodiments, the antigen binding fragment is selected from Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH and any combination thereof.

[0030] In some embodiments, the target molecule binding portion comprises a plurality (eg, 2, 3, 4) of tandemly connected VHHs. Preferably, each of the plurality of tandemly connected VHHs is directed against a different binding epitope.

[0031] In a second aspect of the present invention, an antibody or an antigen-binding fragment thereof that specifically binds to PD-L1 or a fragment thereof is provided.

[0032] In some embodiments, the antibody or its antigen-binding fragment contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, wherein the amino acid sequence of CDR1 is shown in SEQ ID NO.6, 12, 15, or 18, and / or the amino acid sequence of CDR2 is shown in SEQ ID NO.7, 13, 16, or 19, and / or the amino acid sequence of CDR3 is shown in SEQ ID NO.8, 9, 10, 11, 14, 17, or 20.

[0033] In some embodiments, the antibody or antigen-binding fragment thereof contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NO. 6, 7 and 8, respectively (P43).

[0034] In some embodiments, the antibody or antigen-binding fragment thereof contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NO. 6, 7 and 9, respectively (P15).

[0035] In some embodiments, the antibody or antigen-binding fragment thereof contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NO. 6, 7 and 10, respectively (P28).

[0036] In some embodiments, the antibody or antigen-binding fragment thereof contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NO. 6, 7 and 11, respectively (P24).

[0037] In some embodiments, the antibody or antigen-binding fragment thereof contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NO. 12, 13 and 14, respectively (P69).

[0038] In some embodiments, the antibody or antigen-binding fragment thereof contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NO. 15, 16 and 17, respectively (P60).

[0039] In some embodiments, the antibody or antigen-binding fragment thereof contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NO. 18, 19 and 20, respectively (P14).

[0040] In some embodiments, these CDRs may contain amino acid mutations and can maintain the antibody's function of specifically binding to PD-L1. Preferably, the amino acid mutation is an amino acid substitution, and the number of the amino acid substitutions may be 1-3.

[0041] In some embodiments, the VH contained in the antibody or its antigen-binding fragment comprises an amino acid sequence as shown in any one of SEQ ID NO.21-27 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0042] In some embodiments, the VH contained in the antibody or antigen-binding fragment thereof has an amino acid sequence as shown in any one of SEQ ID NOs. 21-27.

[0043] In some embodiments, the antibody or antigen-binding fragment thereof further comprises an Fc domain, such as an Fc domain derived from IgG, IgM, IgE, IgA or IgD.

[0044] In some embodiments, the Fc domain is an Fc domain of an IgG, such as an Fc domain of at least one of IgG1, IgG2, IgG3, or IgG4.

[0045] In some embodiments, the Fc is the Fc of human IgG.

[0046] In some embodiments, the Fc comprises N297A and / or N297G mutations.

[0047] In some embodiments, the C-terminus of the Fc has or is connected to the amino acid sequence LPXTGGGHHHHHH as shown in SEQ ID NO.28, wherein X is any amino acid, preferably E, K, N, Q, or A.

[0048] In a third aspect of the present invention, a heavy chain antibody that specifically binds to PD-L1 or a fragment thereof is provided.

[0049] In some embodiments, the heavy chain antibody comprises at least two heavy chain antigen binding domains selected from cluster 1 (VHH 1 ), cluster 2 heavy chain antigen binding domain (VHH 2 ), cluster 3 heavy chain antigen binding domain (VHH 3 ), and cluster 4 heavy chain antigen binding domain (VHH 4 ), wherein:

[0050] The cluster 1 heavy chain antigen binding domain (VHH 1 ) comprises a first CDR1, a first CDR2 and a first CDR3, whose amino acid sequences are shown in SEQ ID NOs. 6, 7 and 8, respectively (P43);

[0051] The cluster 1 heavy chain antigen binding domain (VHH 1 ) comprises a first CDR1, a first CDR2 and a first CDR3, whose amino acid sequences are shown in SEQ ID NOs. 6, 7 and 9, respectively (P15);

[0052] The cluster 1 heavy chain antigen binding domain (VHH 1 ) comprises a first CDR1, a first CDR2 and a first CDR3, whose amino acid sequences are shown in SEQ ID NOs. 6, 7 and 10, respectively (P28);

[0053] The cluster 1 heavy chain antigen binding domain (VHH 1 ) comprises a first CDR1, a first CDR2 and a first CDR3, whose amino acid sequences are shown in SEQ ID NOs. 6, 7 and 11, respectively (P24);

[0054] The cluster 2 heavy chain antigen binding domain (VHH 2 ) comprises a second CDR1, a second CDR2 and a second CDR3, whose amino acid sequences are shown in SEQ ID NOs. 12, 13 and 14, respectively (P69);

[0055] The cluster 3 heavy chain antigen binding domain (VHH 3 ) comprises a third CDR1, a third CDR2 and a third CDR3, whose amino acid sequences are shown in SEQ ID NOs. 15, 16 and 17, respectively (P60);

[0056] The cluster 4 heavy chain antigen binding domain (VHH 4 ) comprises a fourth CDR1, a fourth CDR2 and a fourth CDR3, whose amino acid sequences are shown in SEQ ID NOs. 18, 19 and 20, respectively (P14).

[0057] In some embodiments, VHH 1It comprises or consists of an amino acid sequence as shown in any one of SEQ ID NOs. 21-24, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0058] In some embodiments, VHH 2 It comprises or consists of the amino acid sequence shown in SEQ ID NO. 25 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0059] In some embodiments, VHH 3 It comprises or consists of the amino acid sequence shown in SEQ ID NO. 26 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0060] In some embodiments, VHH 4 It comprises or consists of the amino acid sequence shown in SEQ ID NO. 27 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0061] In some embodiments, the heavy chain antibodies comprise (1) cluster 1 and cluster 2 heavy chain antigen binding domains; (2) cluster 1 and cluster 3 heavy chain antigen binding domains; (3) cluster 1 and cluster 4 heavy chain antigen binding domains; (4) cluster 2 and cluster 3 heavy chain antigen binding domains; (5) cluster 2 and cluster 4 heavy chain antigen binding domains; or (6) cluster 3 and cluster 4 heavy chain antigen binding domains; or any combination thereof.

[0062] In some embodiments, the heavy chain antibody comprises cluster 1 and cluster 2 heavy chain antigen binding domains.

[0063] In some embodiments, the heavy chain antibody is a dimer comprising two peptide chains, wherein at least one peptide chain comprises, from N-terminus to C-terminus, a first heavy chain antigen binding domain (VHH1)-L1-a second heavy chain antigen binding domain (VHH2)-Fc, wherein the first heavy chain antigen binding domain (VHH1) and the second heavy chain antigen binding domain (VHH2) are each independently selected from the following group: cluster 1 heavy chain antigen binding domain (VHH 1 ), cluster 2 heavy chain antigen binding domain (VHH 2 ), cluster 3 heavy chain antigen binding domain (VHH 3 ), and cluster 4 heavy chain antigen binding domain (VHH 4), wherein L1 represents a linker. Preferably, VHH1 and VHH2 are selected from different clusters.

[0064] In some embodiments, the at least one peptide chain may further comprise a third heavy chain antigen binding domain (VHH3), wherein the third heavy chain antigen binding domain (VHH3) is selected from the following group: cluster 1 heavy chain antigen binding domain (VHH 1 ), cluster 2 heavy chain antigen binding domain (VHH 2 ), cluster 3 heavy chain antigen binding domain (VHH 3 ), and cluster 4 heavy chain antigen binding domain (VHH 4 ). Preferably, VHH3 is selected from a different cluster than VHH1 and VHH2.

[0065] In some embodiments, the heavy chain antibody is a homodimer. In some other embodiments, the heavy chain antibody is a heterodimer, that is, at least one of the at least two VHHs contained in one peptide chain is different from any one of the at least two VHHs contained in the other peptide chain (for example, selected from different clusters or having different sequences), or the arrangement or series sequence of at least two VHHs contained in one peptide chain is different from the arrangement or series sequence of at least two VHHs contained in the other peptide chain. In some embodiments, the VHHs in the two peptide chains of the heterodimer are each independently selected from the cluster 1 heavy chain antigen binding domain and the cluster 2 heavy chain antigen binding domain.

[0066] In some embodiments, the heavy chain antibody further comprises an Fc domain, such as an Fc domain derived from IgG, IgM, IgE, IgA or IgD. Preferably, the Fc domain is an Fc domain of IgG, such as an Fc domain of at least one of IgG1, IgG2, IgG3 or IgG4.

[0067] In some embodiments, the Fc is the Fc of human IgG.

[0068] In some embodiments, the Fc comprises an N297A mutation and / or N297G.

[0069] In some embodiments, the C-terminus of the Fc is connected to the amino acid sequence LPXTGGGHHHHHH as shown in SEQ ID NO.28, wherein X is any amino acid, preferably E, K, N, Q, or A.

[0070] In the fourth aspect of the present invention, an activatable degrader for degrading membrane proteins is provided, wherein the activatable degrader comprises (1) a target molecule binding portion (TBM), which specifically binds to the membrane protein, and (2) an activatable transmembrane construct according to the first aspect of the present invention.

[0071] In some embodiments, the target molecule binding portion comprises an antibody or an antigen binding fragment thereof, preferably, the antigen binding fragment is selected from Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH and any combination thereof.

[0072] In some embodiments, the membrane protein is selected from PD-L1, PD-1, EGFR, HER-2 or a functional fragment thereof.

[0073] In some embodiments, the target molecule binding portion comprises a plurality of tandem VHHs.

[0074] In some embodiments, the target molecule binding moiety is linked to the N-terminus of the activatable transmembrane construct.

[0075] In some embodiments, the antibody or antigen-binding fragment thereof has an Fc domain. In some embodiments, the C-terminus of the Fc domain is connected to the cell-penetrating moiety (CPM) of the activatable transmembrane construct.

[0076] In some embodiments, the C-terminus of the Fc domain is connected to the cell penetrating portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO.58), wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and wherein X is any amino acid, preferably E, K, N, Q, A.

[0077] In the fifth aspect of the present invention, an activatable degrader for degrading PD-L1 is provided, wherein the activatable degrader comprises (1) an antibody or an antigen-binding fragment thereof according to the second aspect of the present invention, or a heavy chain antibody according to the third aspect of the present invention, and (2) an activatable transmembrane construct according to the first aspect of the present invention.

[0078] In some embodiments, the antibody or antigen-binding fragment thereof, or the heavy chain antibody has an Fc domain. In some embodiments, the C-terminus of the Fc domain is connected to the cell-penetrating part (CPM) of the activatable transmembrane construct.

[0079] In some embodiments, the C-terminus of the Fc domain is connected to the cell penetrating portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO.58), wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and wherein X is any amino acid, preferably E, K, N, Q, A.

[0080] In the sixth aspect of the present invention, a nucleic acid molecule is provided, which encodes an activatable transmembrane construct according to the first aspect, an antibody or its antigen-binding fragment according to the second aspect of the present invention, a heavy chain antibody according to the third aspect of the present invention, or an activatable degron according to the fourth aspect or fifth aspect of the present invention.

[0081] In the seventh aspect of the present invention, a vector is provided, which comprises the nucleic acid molecule according to the sixth aspect of the present invention.

[0082] In an eighth aspect of the present invention, a cell is provided, which comprises a nucleic acid molecule according to the sixth aspect of the present invention or a vector according to the seventh aspect of the present invention.

[0083] In the ninth aspect of the present invention, a composition is provided, which comprises an activatable transmembrane construct according to the first aspect of the present invention, an antibody or an antigen-binding fragment thereof according to the second aspect of the present invention, a heavy chain antibody according to the third aspect of the present invention, an activatable degron according to the fourth aspect or the fifth aspect of the present invention, a nucleic acid molecule according to the sixth aspect of the present invention, a vector according to the seventh aspect of the present invention and / or a cell according to the eighth aspect of the present invention, and a pharmaceutically acceptable carrier.

[0084] In the tenth aspect of the present invention, a kit is provided, which comprises an activatable transmembrane construct according to the first aspect of the present invention, an antibody or an antigen-binding fragment thereof according to the second aspect of the present invention, a heavy chain antibody according to the third aspect of the present invention, an activatable degron according to the fourth aspect or the fifth aspect of the present invention, a nucleic acid molecule according to the sixth aspect of the present invention, a vector according to the seventh aspect of the present invention and / or a cell according to the eighth aspect of the present invention.

[0085] In the eleventh aspect of the present invention, a method for treating a disease is provided, the method comprising administering to a subject in need thereof a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to the second aspect of the present invention, a heavy chain antibody according to the third aspect of the present invention, an activatable degron according to the fourth or fifth aspect of the present invention, a nucleic acid molecule according to the sixth aspect of the present invention, a vector according to the seventh aspect of the present invention, or a composition according to the ninth aspect of the present invention.

[0086] In some embodiments, the disease is a disease associated with the expression or overexpression of the membrane protein. In some embodiments, the disease is cancer. In some embodiments, the cancer is selected from squamous cell carcinoma (e.g., epithelial squamous cell carcinoma), lung cancer (including small cell lung cancer, non-small cell lung cancer, adenocarcinoma and squamous cell carcinoma of the lung), peritoneal cancer, hepatocellular carcinoma, gastric cancer (including gastrointestinal cancer and gastrointestinal stromal cancer), bone cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, urethral cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer or cervical cancer, salivary gland cancer, kidney cancer or ureteral cancer, prostate cancer, vaginal cancer, vulvar cancer, thyroid cancer, anal cancer, penis cancer, melanoma, bile duct cancer, central nervous system (CNS) tumors, spinal axis tumors, brain stem gliomas, multiforme glioblastomas, astrocytic tumors, glioma ... The invention relates to melanoma, schwannoma, ependymoma, medulloblastoma, meningioma, squamous cell carcinoma, pituitary adenoma and Ewing's sarcoma, superficial spreading melanoma, lentigo maligna melanoma, acral melanoma, nodular melanoma, multiple myeloma and B-cell lymphoma, chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), hairy cell leukemia, chronic myeloblastic leukemia and post-transplant lymphoproliferative disorder (PTLD), as well as abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors) and Meigs syndrome, brain tumors and brain cancers, and head or neck cancers and related metastatic cancers.

[0087] In a twelfth aspect of the present invention, a method for activating T cells is provided, the method comprising using an anti-PD-L1 antibody or an antigen-binding fragment thereof linked to the activatable transmembrane construct of the first aspect.

[0088] In some embodiments, the antigen binding fragment is selected from Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH and any combination thereof.

[0089] In some embodiments, the antibody is a blocking antibody. In yet other embodiments, the antibody is a non-blocking antibody.

[0090] In some embodiments, the antibody or antigen-binding fragment thereof has an Fc domain. In some embodiments, the C-terminus of the Fc domain is connected to the cell-penetrating moiety (CPM) of the activatable transmembrane construct.

[0091] In some embodiments, the C-terminus of the Fc domain is connected to the cell penetrating portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO.58), wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and wherein X is any amino acid, preferably E, K, N, Q, A.

[0092] In some embodiments, the antibody is selected from the antibody or antigen-binding fragment thereof according to the second aspect of the invention, or the heavy chain antibody according to the third aspect of the invention.

[0093] In the thirteenth aspect of the present invention, a method is provided for preparing an activatable transmembrane construct according to the first aspect, an antibody or antigen-binding fragment thereof according to the second aspect of the present invention, a heavy chain antibody according to the third aspect of the present invention, or an activatable degrader according to the fourth aspect or the fifth aspect of the present invention.

[0094] In some embodiments, the method includes using a transpeptidase to cut and connect the LPXTG sequence (SEQ ID NO.62) (wherein X is any amino acid sequence) at the C-terminus of the first peptide chain and the GGG sequence at the N-terminus of the second peptide chain to form a connection product containing the LPXTGGG sequence (SEQ ID NO.30). The first peptide chain can be, for example, the cell penetrating portion of the activatable transmembrane construct, or the Fc domain of the activatable degrader, and accordingly, the second peptide chain can be, for example, the shielding portion of the activatable transmembrane construct, or the activatable transmembrane construct in the activatable degrader. BRIEF DESCRIPTION OF THE DRAWINGS

[0095] Figure 1 The structure of an activatable degradon according to the present invention is schematically shown.

[0096] Figure 2 The working principle of the activatable degrader according to the present invention is schematically shown.

[0097] Figure 3 The SDS-PAGE electrophoresis diagram of human Fc single domain antibody is shown.

[0098] Figure 4 The binding activity of hPD-L1 heavy chain antibody to cell surface antigen is shown.

[0099] Figure 5 A bar graph showing the blocking efficiency of hPD-L1 antibodies.

[0100] Figure 6 Graph showing blocking efficiency of hPD-L1 antibodies versus log10 (concentration / nM).

[0101] Figure 7 Western blot analysis showing the protein cleavage effect of hPD-L1 heavy chain antibody degrader.

[0102] Figure 8 Shown is the SDS-PAGE analysis of hPD-L1 dual-epitope heavy chain antibody degrader bispecific antibody.

[0103] Fig. 9A and 9B The mass spectra of the highly pure hPD-L1 dual-epitope antibody P69-P43-hFc and the degradation factor P69-P43-hFc TAC based on it are shown respectively.

[0104] Fig.10 A diagram showing the effect of hPD-L1 dual-epitope antibody-based degraders on cleavage of PD-L1.

[0105] Fig.11 Bar graph showing the extent of T cell activation by hPD-L1 bi-epitope antibody-based degraders in PD-1 / PD-L1 Blockade Bioassays.

[0106] Fig.12 It shows that the same dual-epitope antibody linked to different transmembrane peptides forms a degrading agent that degrades cell surface PD-L1.

[0107] Fig.13 A bar graph showing the extent of T cell activation in PD-1 / PD-L1 Blockade Bioassays by degraders formed by the same bi-epitope antibody linked to different membrane-penetrating peptides.

[0108] Fig.14A and 14B The mass spectrometry peaks of the conditionally activated degrader CAMBOTAC and its release of the masked peptide under the action of MMP-9 are shown respectively.

[0109] Fig.15 It shows that conditionally activated degraders release their activity under the action of MMP-9 to degrade PD-L1 on the cell surface.

[0110] Fig.16 A bar graph showing the fold increase in T cell activation by the conditionally activated degrader CAMBOTAC in PD-1 / PD-L1 Blockade Bioassays.

[0111] Figures 17A to 17E In the case of injection of negative control HBSS ( Fig.17A ), positive control Envida ( Fig. 17B )、CAMBOTAC1( Fig. 17C )、CAMBOTAC2( Fig.17D ) and CAMBOTAC3( Fig.17E ) after 4 h. DETAILED DESCRIPTION

[0112] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation of the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0113] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0114] The expression "about" as used herein is understood by one of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If one of ordinary skill in the art is not aware of the use of the term based on the context in which it is used, "about" will mean up to plus or minus 10% of the specified value.

[0115] "Epitope" refers to the part of an antigen that is specifically bound by an antibody. Epitopes are usually composed of chemically active (such as polar, nonpolar or hydrophobic) surface groups of amino acids or polysaccharide side chains, etc., and may have specific three-dimensional structural characteristics as well as specific charge characteristics. Epitopes can be composed of continuous and / or discontinuous amino acids that form conformational space units. For discontinuous epitopes, amino acids in different parts of the linear sequence of the antigen are close to each other in three-dimensional space due to the folding of the protein molecule. The antibody "epitope" depends on the method used to identify the epitope. "

[0116] The terms "peptide", "polypeptide" and "protein" are used interchangeably herein and refer to a polymeric form of amino acids of any length, which may include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones. These terms also include polypeptides with co-translational modifications (e.g., signal peptide cleavage) and post-translational modifications of the polypeptide, such as disulfide bond formation, glycosylation, acetylation, phosphorylation, proteolytic cleavage, etc.

[0117] The term "antibody" generally refers to a polypeptide or polypeptide complex that specifically recognizes and binds to an antigen, including but not limited to polyclonal, monoclonal, monospecific, multispecific, nonspecific, humanized, single-chain, chimeric, synthetic, recombinant, hybrid, mutated and transplanted antibodies. The antibody can be a complete antibody and any antigen-binding fragment or single chain thereof. The basic 4-chain antibody unit can be a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. Each L chain can be connected to the H chain by a covalent disulfide bond, and the two H chains can be connected to each other by one or more disulfide bonds. Each H chain generally includes an N-terminal heavy chain variable region and a subsequent heavy chain constant region, the heavy chain variable region can include a variable domain (VH), and the heavy chain constant region generally includes three to four constant domains (CH). Each L chain also includes a variable region containing a variable domain (VL) and a constant region containing a constant domain (CL). VL corresponds to VH, and CL can correspond to the first constant domain (CH1) of the heavy chain. Antibodies typically include six CDRs; three heavy chain CDRs in VH, and three light chain CDRs in VL.

[0118] The term "heavy chain antibody" or "HCAb" refers to a functional antibody without a light chain, wherein the heavy chain constant region sequence of the heavy chain antibody does not have a CH1 sequence. Heavy chain antibodies with high specificity and affinity for a variety of antigens can be produced by immunization (van der Linden, RH, et al. Biochim. Biophys. Acta. 1431, 37-46 (1999)).

[0119] As used in this application, "VH domain" refers to the variable domain of the H chain of an antibody.

[0120] As used in this application, "VHH domain" refers to the variable domain of the H chain of HCAb. The terms "single domain antibody", "nanobody" and "VHH" have the same meaning.

[0121] The term "antibody fragment" or "antigen binding fragment" is a portion of an antibody, such as Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affibody, dAb, VHH and / or other antibody fragments that retain antigen binding function. Typically, such fragments may include an antigen binding domain.

[0122] The term "heavy chain constant region" includes an amino acid sequence derived from an immunoglobulin heavy chain, the sequence of which is CH1-hinge region-CH2-CH3 in order. According to the EU Index, the hinge region of IgG is generally defined as including Glu216 of human IgG1 and ending at Pro230, but functionally, the flexible portion of the chain can be considered to include additional residues called the upper hinge region and the lower hinge region, such as from Glu216 to Gly237, while the lower hinge region generally refers to residues 233 to 239 of the Fc region, which is generally associated with FcyR binding. The hinge regions of other IgG isotypes can be aligned with the IgG1 sequence by placing the first and last cysteine ​​residues to form an inter-heavy chain SS bond. The CH1 domain is adjacent to the Vn domain and the amino terminus of the hinge region, and includes the first (amino terminal) constant region of the immunoglobulin heavy chain, such as about EU positions 118-215. The Fc domain extends from amino acid 231 to amino acid 447; the CH2 domain extends from Ala231 to Lys340 or Gly341; and the CH3 domain extends from Gly341 or Gln342 to Lys447. The residues of the IgG heavy chain region in the CH1 region end at Lys. A molecule containing an Fc domain comprises at least the CH2 and CH3 domains of the antibody constant region, and thus comprises at least the region from about Ala231 to Eys447 of the IgG heavy chain constant region. A molecule containing an Fc domain may optionally include at least a portion of the hinge region.

[0123] The CH2 domain herein may be a native sequence CH2 domain or a variant CH2 domain. The CH3 domain herein may be a native sequence CH3 domain or a variant CH3 domain. The CH2 domain may comprise one or more mutations that reduce or eliminate the CH2 domain binding to one or more Fcγ receptors (e.g., FcγRI, FcγRIIa, FcγRIIb, FcγRIII) and / or complement. It is speculated that reducing or eliminating binding to Fc receptor γ will reduce or eliminate ADCC mediated by the antibody molecule. Similarly, reducing or eliminating binding to complement is expected to reduce or eliminate CDC mediated by the antibody molecule. Mutations that reduce or eliminate the binding of the CH2 domain to one or more Fcγ receptors and / or complement are known in the art.

[0124] The term "chimeric antibody" generally refers to an antibody in which the variable region is derived from one species and the constant region is derived from another species. Typically, the variable region can be derived from an antibody of an experimental animal such as a rodent ("parent antibody"), and the constant region is derived from a human antibody, so that the resulting chimeric antibody is less likely to induce an adverse immune response in a human individual than the parent (e.g., mouse-derived) antibody.

[0125] The term "humanized antibody" generally refers to an antibody in which some or all of the amino acids outside the CDR region of a non-human antibody (e.g., a mouse antibody) are replaced by corresponding amino acids derived from human immunoglobulins. In the CDR region, small additions, deletions, insertions, substitutions or modifications of amino acids may also be permitted, as long as they still retain the ability of the antibody to bind to a specific antigen. Humanized antibodies may optionally include at least a portion of a human immunoglobulin constant region. "Humanized antibodies" may retain antigenic specificity similar to that of the original antibody. The "humanized" form of a non-human (e.g., mouse) antibody may minimally include a chimeric antibody derived from a sequence of a non-human immunoglobulin. In some cases, CDR region residues in a human immunoglobulin (receptor antibody) may be replaced with CDR region residues of a non-human species (donor antibody) (such as mouse, rat, rabbit or non-human primate) having desired properties, affinity and / or ability. In some cases, FR region residues of a human immunoglobulin may be replaced with corresponding non-human residues. In addition, humanized antibodies may be included in amino acid modifications that are not present in the receptor antibody or in the donor antibody. These modifications may be made to further refine antibody performance, such as binding affinity.

[0126] The terms "polynucleotide," "oligonucleotide," "nucleic acid," and "nucleic acid molecule" are used interchangeably herein to include a polymeric form of nucleotides, either ribonucleotides or deoxyribonucleotides.

[0127] The term "vector" refers to a polynucleotide that can replicate within a biological system or can move between such systems. Vector polynucleotides typically contain elements such as an origin of replication, a polyadenylation signal, or a selectable marker, which function to promote the replication or maintenance of these polynucleotides in biological systems (such as cells, viruses, animals, plants, and recombinant biological systems) using biological components that can replicate the vector. Vector polynucleotides can be single-stranded or double-stranded DNA or RNA molecules, cDNAs, or hybrids thereof.

[0128] The term "expression vector" refers to a vector that can be used to direct the translation of a polypeptide encoded by a polynucleotide sequence present in the expression vector in a biological system or in a recombinant biological system.

[0129] The term "specific binding" refers to the ability of an antibody to bind to a specific antigen with greater affinity than to other antigens. D ) is about 1×10 -8 M or less, an antibody is considered to "specifically bind", for example, about 1 × 10 -9 M or smaller, about 1×10 -10 M or smaller, about 1×10 -11 M or less, or about 1×10 -12 M or smaller, usually KD At least higher than its K for binding to nonspecific antigens (such as BSA, casein) D 100 times smaller. K D Can be measured using standard procedures.

[0130] The term "treatment" refers to obtaining a desired pharmacological and / or physiological effect. If the disease or its symptoms can be completely or partially prevented, the effect is preventive, and if the disease and / or the adverse effects caused by the disease can be partially or completely cured, the effect is therapeutic. As used herein, "treatment" covers any treatment of a disease in a mammal (e.g., a human), and includes (a) preventing the disease from occurring in a subject who may be ill but has not yet been diagnosed with the disease; (b) inhibiting the disease, i.e., preventing its development; (c) relieving the disease, i.e., causing the disease to regress.

[0131] The terms "individual," "subject," "host," and "patient" are used interchangeably herein and refer to mammals, including but not limited to mice (e.g., rats, mice), civets (e.g., rabbits), non-human primates, humans, canines, felines, ungulates (e.g., horses, cattle, sheep, pigs, goats), and the like.

[0132] The three-letter or one-letter abbreviations of amino acids used herein are shown in Table 1 below.

[0133] Table 1

[0134] Amino Acids Three letters Single letter Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Cysteine Cys C Glutamine Gln Q Glutamate Glu E Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V

[0135] Before further describing the present disclosure, it should be understood that the present disclosure is not limited to the particular embodiments described, as it may also vary. It should also be understood that the terminology used herein is for the purpose of describing the embodiments only and is not intended to be limiting.

[0136] Activatable transmembrane construct

[0137] In one aspect of the present invention, an activatable transmembrane construct is provided, which comprises a cell penetrating moiety (CPM), a cleavable moiety (CM) and a blocking moiety (BM).

[0138] In some embodiments, the various parts of the activatable transmembrane construct are connected as follows: CPM-CM-BM. Unless explicitly stated, the connection mode does not limit its direction, that is, it can represent a connection from the N-terminus to the C-terminus or from the C-terminus to the N-terminus.

[0139] In some embodiments, the activatable transmembrane construct further comprises an Fc domain of an antibody, including but not limited to IgG, IgM, IgE, IgA and IgD.

[0140] In some embodiments, the activatable transmembrane construct further comprises a target molecule binding moiety.

[0141] In some embodiments, the target molecule binding moiety or the Fc domain is connected to the N-terminus of the activatable transmembrane construct, and in this case, the activatable transmembrane construct includes the target molecule binding moiety-CPM-CM-BM or Fc-CPM-CM-BM from the N-terminus to the C-terminus.

[0142] In some embodiments, the target molecule binding moiety is linked to the C-terminus of the activatable transmembrane construct, and in this case, the activatable transmembrane construct includes BM-CM-CPM-target molecule binding moiety from N-terminus to C-terminus.

[0143] In some embodiments, the activatable transmembrane construct comprises a target molecule binding moiety only at the N-terminus or the C-terminus, that is, the activatable transmembrane construct does not comprise a target molecule binding moiety at both ends at the same time, for example, when the N-terminus comprises a target molecule binding moiety, then the C-terminus does not comprise an additional target molecule binding moiety. The additional target molecule binding moiety, for example, targets a lysosome or a proteasome or can bind to a receptor on the cell surface that promotes endocytosis, for example, can bind to a 6-phosphomannose receptor (M6PR) or an asialoglycoprotein receptor.

[0144] Cell Penetrating Moiety (CPM)

[0145] In the present application, "penetration" (e.g., membrane penetration, cell penetration) includes the movement of molecules from the extracellular space to the interior of the cell, such as to the cytosol, nucleus or other subcellular compartments, by any means. Cell penetration can also include endosomal uptake (e.g., by macropinocytosis, clathrin-mediated endocytosis, caveolae-mediated endocytosis or other endocytosis), followed by endosomal escape, such that the molecule leaves the endosome and enters the cytosol.

[0146] In some embodiments, the cell penetrating moiety is a cell penetrating peptide (or a membrane-penetrating peptide, both of which can be used interchangeably). The membrane-penetrating peptide includes any peptide that can penetrate a cell layer (e.g., penetrate a cell membrane, a nuclear envelope, an intercellular space, a paracellular space, an endosomal membrane, a lysosomal membrane, or other subcellular compartment membranes). The membrane-penetrating peptide can enter the cytosol or can enter the nucleus. In some embodiments, the cell-penetrating peptide of the present application can penetrate or enter a target cell, such as a diseased cell such as a tumor cell, or a healthy cell such as a liver cell, a lung cell, a breast cell, a pancreatic cell, or a colon cell in an activated state.

[0147] In some embodiments, the cell penetrating peptide of the present application may include one or more positively charged amino acid residues (e.g., lysine or arginine). Positively charged amino acid residues can mediate the interaction between the cell penetrating peptide and the negatively charged cell layer (e.g., cell membrane, nuclear envelope, intercellular space, paracellular space, endosomal membrane, lysosomal membrane or other subcellular compartment membrane). In some embodiments, the cell penetrating peptide used in the present application includes 1 to 30 positively charged amino acid residues, such as 2 to 30, 3 to 30, 4 to 30, 5 to 30, 1 to 20, 2 to 20, 3 to 20, 4 to 20, 5 to 20, 1 to 15, 2 to 15, 3 to 15, 4 to 15, 5 to 15, 6 to 15, 7 to 15 or 8 to 15. In some embodiments, the cell penetrating peptide used in the present application comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 positively charged amino acid residues. In some embodiments, the cell penetrating peptide used in the present application comprises no more than 5, no more than 6, no more than 7, no more than 8, no more than 9, no more than 10, no more than 11, no more than 12, no more than 13, no more than 14, no more than 15, no more than 16, no more than 17, no more than 18, no more than 19, no more than 20, no more than 21, no more than 22, no more than 23, no more than 24, no more than 25, no more than 26, no more than 27, no more than 28, no more than 29 or no more than 30 positively charged amino acid residues.

[0148] In some embodiments, the cell penetrating peptide used in the present application may contain one or more lysine residues, such as 1-30, 2-30, 3-30, 4-30, 5-30, 1-20, 2-20, 3-20, 4-20, 5-20, 1-15, 2-15, 3-15, 4-15, 5-15, 6-15, 7-15 or 8-15 lysine residues. In some embodiments, the cell penetrating peptide used in the present application includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 lysine residues. In some embodiments, the cell penetrating peptide used in the present application contains no more than 5, no more than 6, no more than 7, no more than 8, no more than 9, no more than 10, no more than 11, no more than 12, no more than 13, no more than 14, no more than 15, no more than 16, no more than 17, no more than 18, no more than 19, no more than 20, no more than 21, no more than 22, no more than 23, no more than 24, no more than 25, no more than 26, no more than 27, no more than 28, no more than 29 or no more than 30 lysine residues.

[0149] In some embodiments, the cell penetrating peptide used in the present application may contain one or more arginine residues, such as 1-30, 2-30, 3-30, 4-30, 5-30, 1-20, 2-20, 3-20, 4-20, 5-20, 1-15, 2-15, 3-15, 4-15, 5-15, 6-15, 7-15 or 8-15 arginine residues. In some embodiments, the cell penetrating peptide used in the present application includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 arginine residues. In some embodiments, the cell penetrating peptide used in the present application contains no more than 5, no more than 6, no more than 7, no more than 8, no more than 9, no more than 10, no more than 11, no more than 12, no more than 13, no more than 14, no more than 15, no more than 16, no more than 17, no more than 18, no more than 19, no more than 20, no more than 21, no more than 22, no more than 23, no more than 24, no more than 25, no more than 26, no more than 27, no more than 28, no more than 29 or no more than 30 arginine residues.

[0150] In some embodiments, the cell penetrating peptide of the present application may include at least one negatively charged amino acid residue (e.g., aspartic acid or glutamic acid). In some embodiments, the cell penetrating peptide used in the present application may include no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 negatively charged amino acid residues.

[0151] In some embodiments, the cell penetrating peptides of the present application may include at least one aspartic acid residue. In some embodiments, the cell penetrating peptides used in the present application may include no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 aspartic acid residues.

[0152] In some embodiments, the cell penetrating peptide of the present application may include at least one glutamic acid residue. In some embodiments, the cell penetrating peptide used in the present application may include no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 glutamic acid residues.

[0153] In all embodiments, the cell penetrating peptides of the present application comprise a higher number of positively charged amino acid residues than negatively charged amino acid residues.

[0154] Blocking Moiety (BM)

[0155] The shielding moiety refers to a moiety that, when present, reduces or inhibits the interaction between the cell penetrating moiety and the cell membrane. The shielding moiety may interfere with, inhibit or reduce the interaction between the cell penetrating moiety and the cell membrane through steric hindrance; or it may specifically bind to the cell penetrating moiety through affinity, thereby interfering with, inhibiting or reducing the interaction between the cell penetrating moiety and the cell membrane.

[0156] In some embodiments, the shielding portion is a shielding peptide. In some embodiments, the shielding peptide may include one or more negatively charged amino acid residues (e.g., glutamic acid or aspartic acid). In some embodiments, the shielding peptide used in the present application includes 1 to 30 positively charged amino acid residues, such as 2 to 30, 3 to 30, 4 to 30, 5 to 30, 1 to 20, 2 to 20, 3 to 20, 4 to 20, 5 to 20, 1 to 15, 2 to 15, 3 to 15, 4 to 15, 5 to 15, 6 to 15, 7 to 15 or 8 to 15. In some embodiments, the shielding peptide used in the present application includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 negatively charged amino acid residues. In some embodiments, the shielding peptide used in the present application contains no more than 5, no more than 6, no more than 7, no more than 8, no more than 9, no more than 10, no more than 11, no more than 12, no more than 13, no more than 14, no more than 15, no more than 16, no more than 17, no more than 18, no more than 19, no more than 20, no more than 21, no more than 22, no more than 23, no more than 24, no more than 25, no more than 26, no more than 27, no more than 28, no more than 29 or no more than 30 negatively charged amino acid residues.

[0157] In some embodiments, the shielding peptide used in the present application may contain one or more glutamic acid residues, such as 1-30, 2-30, 3-30, 4-30, 5-30, 1-20, 2-20, 3-20, 4-20, 5-20, 1-15, 2-15, 3-15, 4-15, 5-15, 6-15, 7-15 or 8-15 glutamic acid residues. In some embodiments, the shielding peptide used in the present application includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 glutamic acid residues. In some embodiments, the shielding peptide used in the present application contains no more than 5, no more than 6, no more than 7, no more than 8, no more than 9, no more than 10, no more than 11, no more than 12, no more than 13, no more than 14, no more than 15, no more than 16, no more than 17, no more than 18, no more than 19, no more than 20, no more than 21, no more than 22, no more than 23, no more than 24, no more than 25, no more than 26, no more than 27, no more than 28, no more than 29 or no more than 30 glutamic acid residues.

[0158] In some embodiments, the shielding peptide used in the present application may contain one or more aspartic acid residues, such as 1-30, 2-30, 3-30, 4-30, 5-30, 1-20, 2-20, 3-20, 4-20, 5-20, 1-15, 2-15, 3-15, 4-15, 5-15, 6-15, 7-15 or 8-15 aspartic acid residues. In some embodiments, the shielding peptide used in the present application includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 aspartic acid residues. In some embodiments, the shielding peptide used in the present application contains no more than 5, no more than 6, no more than 7, no more than 8, no more than 9, no more than 10, no more than 11, no more than 12, no more than 13, no more than 14, no more than 15, no more than 16, no more than 17, no more than 18, no more than 19, no more than 20, no more than 21, no more than 22, no more than 23, no more than 24, no more than 25, no more than 26, no more than 27, no more than 28, no more than 29 or no more than 30 aspartic acid residues.

[0159] In some embodiments, the shielding peptide of the present application may include at least one uncharged amino acid residue (e.g., glycine, threonine, or serine). In some embodiments, the shielding peptide used in the present application may include no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 uncharged amino acid residues.

[0160] In some embodiments, the shielding peptide of the present application may include at least one glycine residue. In some embodiments, the shielding peptide used in the present application may include no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 glycine residues.

[0161] In some embodiments, the shielding peptide of the present application may include at least one threonine residue. In some embodiments, the shielding peptide used in the present application may include no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 threonine residues.

[0162] In some embodiments, the shielding peptide of the present application may include at least one serine residue. In some embodiments, the shielding peptide used in the present application may include no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 serine residues.

[0163] In all embodiments, the shielding peptide of the present application comprises a higher number of negatively charged amino acid residues than uncharged amino acid residues.

[0164] Cleavable Moiety (CM)

[0165] A "cleavable moiety" is a peptide substrate that can be cleaved by an enzyme. When used in the present application, a cleavable moiety and a cleavable linker "cleavable linker" are used interchangeably. After being cleaved by the enzyme, the cleavable moiety causes the cell penetrating moiety shielded by the shielding moiety to be activated. Preferably, the cleavable moiety is selected so that activation occurs at the desired site of action, which can be a site in or near a target cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue). For example, the cleavable moiety can be a specific peptide substrate for an enzyme that is specific or highly expressed in the site of action, thereby causing the cleavage rate of the cleavage moiety at the target site to be greater than the cleavage rate at sites outside the target site.

[0166] In the activated state (e.g., when the construct is exposed to a protease capable of cleaving the cleavable portion), the shielding portion can be separated from the cell penetrating portion, thereby producing a product with transmembrane activity. The activatable transmembrane construct can be designed to be selectively activated when exposed to diseased tissues, but not in normal tissues. For example, the activatable transmembrane construct can be designed with one or more CMs. The protease that cleaves one or more CMs may be overexpressed in diseased tissues relative to healthy tissues. The activatable transmembrane construct can be activated after the cleavable portion is cleaved, so that the cell penetrating portion therein can exert its activity in diseased tissues (e.g., in a tumor microenvironment), but not in the environment of healthy tissues.

[0167] Preferably, the enzyme is present in the extracellular environment of the diseased tissue or organ. Examples of such proteases include aspartic proteases (e.g., renin), fibroblast activation protein (FAP), aspartic cathepsins (e.g., cathepsin D, caspase 1, caspase 2, etc.), cysteine ​​cathepsins (e.g., cathepsin B), cysteine ​​proteases (e.g., legumain), disintegrin / metalloproteinases (ADAMS, e.g., ADAM8, ADAM9), disintegrin / metalloproteinases with thrombospondin motifs (ADAMTS, e.g., ADAMTS1), integral membrane serine proteases (e.g., matrix proteinase 2, MT-SPL / matrix proteinase, TMPRSS2, TMPRSS3, TMPRSS4), kallikrein-related peptidases (KLKs, e.g., KLK4, KLK5), matrix metalloproteinases (e.g., MMP-1, MMP-2, MMP-9), and serine proteases (e.g., cathepsin A, coagulation factor proteases such as elastase, plasmin, thrombin, PSA, uPA, factor Vila, factor Xa, and HCV NS3 / 4).

[0168] Preferably, the enzyme is fibroblast activation protein (FAP), urokinase-type plasminogen activator (UPA, urokinase), MT-SPL / matrix protease, Legumain or matrix metalloproteinase (especially MMP-1, MMP-2 and MMP-9). Those skilled in the art will appreciate that the choice of enzyme and corresponding cleavable moiety will depend on the disease to be treated and the protease(s) expressed by the affected tissue or organ.

[0169] The cleavable linkers suitable for use in the present invention are shown in Table 2.

[0170] Table 2

[0171]

[0172]

[0173] Target Binding Moiety (TBM)

[0174] The target molecule binding portion suitable for use in the present invention is preferably an antibody or an antigen-binding fragment thereof, such as a heavy chain antibody or an antigen-binding portion thereof.

[0175] The target molecule is selected from the group consisting of polypeptides, nucleic acids, small molecules, polysaccharides, lipids, nanoparticles, and any combination thereof.

[0176] In some embodiments, the target molecule is a membrane protein, especially a membrane-bound membrane protein. In some embodiments, the membrane protein is selected from B7 family members, tumor necrosis factor receptor superfamily members, TNF receptor superfamily members, CD28 family members, ATP binding cassette transporter (ABC) members, serine / threonine kinase receptor family members, receptor tyrosine kinase family members, CD38 ectoenzyme.

[0177] In some embodiments, the membrane protein is a B7 family member, preferably PD-1, PD-L1 or PD-L2, preferably PD-L1.

[0178] In some embodiments, the membrane protein is a member of the EGF receptor family; VEGF receptor family; FGF receptor family; IGF receptor family; HGF receptor family; or AXL receptor family. In some embodiments, the membrane protein is a member of the EGF receptor family, preferably EGFR; ErbB-2 or ErbB-3, preferably ErbB-2.

[0179] In some embodiments, the membrane protein is a member of the TNF receptor superfamily, preferably CD137, OX40, CD40 or CD30.

[0180] In some embodiments, the target molecule binding portion of the present invention is an antibody or antigen binding fragment thereof that specifically binds to PD-L1 or a fragment thereof but does not activate T cells. In some embodiments, the antibody or antigen binding fragment thereof is a heavy chain antibody or antigen binding fragment thereof.

[0181] In some embodiments, the antibody is a dimer comprising two peptide chains, and may be a homodimer or a heterodimer. In some embodiments, a single heavy chain of the antibody comprises only one heavy chain variable region VH, such as VHH. In some embodiments, a single heavy chain of the antibody comprises 2 or more heavy chain variable regions VH, such as VHH, preferably, the 2 or more heavy chain variable regions are directed to different antigenic determinants, i.e., corresponding to different epitope regions of the same or different molecules. Different antigenic determinants may correspond to independent or different amino acid sequences, or may have partial overlap in the amino acid sequence.

[0182] Activable Degrader

[0183] The activatable degradon of the present invention can be obtained by connecting the activatable transmembrane construct of the present invention to a target molecule binding portion, especially to an antibody or its antigen binding fragment (especially a heavy chain antibody or its antigen binding fragment) according to the present invention. In some embodiments, the C-terminus of the activatable transmembrane construct is connected to the N-terminus of the antibody. In some embodiments, the N-terminus of the activatable transmembrane construct is connected to the C-terminus of the Fc domain of the antibody. The connection can be achieved by any conventional connection peptide segment in the art, such as chemical connection or enzyme catalysis connection.

[0184] In some embodiments, click chemistry is used to connect the activatable membrane-penetrating construct to the Fc domain of the corresponding antibody. For example, the activatable membrane-penetrating construct and the antibody coupled to the first click chemistry handle and the second click chemistry handle can be contacted under suitable conditions to carry out the connection. Exemplary click chemistry handles include azide coupling reagents, including 3-azidopropionic acid sulfo-NHS ester, azidoacetic acid-NHS ester, azido-PEG-NHS ester, azidopropylamine, azido-PEG-amine, azido-PEG-maleimide, bissulfone-PEG-azide or its derivatives. In some embodiments, the azide coupling reagent includes an azidoalkyl moiety, an azidoaryl moiety or an azidoheteroaryl moiety. Other click chemistry handles are described in McKay and Finn (2014) Chem. Biol. 21(9): 1075–101, and in Lahann, J. (ed.) Click Chemistry for Biotechnology and Materials Science, John Wiley & Sons, West Sussex, 2009, which are incorporated herein by reference in their entireties.

[0185] In some embodiments, the activatable transmembrane construct is linked to the Fc domain of the corresponding antibody using a bifunctional cross-linker (eg, NHS ester-maleimide heterobifunctional cross-linker).

[0186] In some embodiments, the activatable transmembrane construct is linked to the Fc domain of the corresponding antibody using a transpeptidase, an isopeptidase, a transglutaminase (see, e.g., Steffen et al. (2017) J. Biol. Chem. 292(38):15622-35), a sortase (e.g., sortase A or sortase B), or a cyclase (e.g., cyclase 1).

[0187] In one embodiment, the connection is achieved by a transpeptidase. Transpeptidase (SrtA) is a polypeptide ligase that can recognize the LPXTG sequence (SEQ ID NO.62) or LPXT sequence (SEQ ID NO.63) (wherein X is any amino acid sequence, preferably E, K, N, Q, A) (e.g., LPETG (SEQ ID NO.64) or LPET (SEQ ID NO.65)) at the C-terminus of a protein and the GGG sequence at the N-terminus of another protein or polypeptide, and perform cutting and connection to finally form a connection product containing the LPXTGGG sequence (SEQ ID NO.30). Therefore, in some embodiments, the C-terminus of the Fc domain of the antibody is connected to the cell penetrating portion (CPM) of the activatable transmembrane construct through the sequence LPXT (G) n (SEQ ID NO.58), wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and wherein X is any amino acid, preferably E, K, N, Q, A.

[0188] Figure 1 An activatable degrader according to one embodiment of the present invention is shown, which is a dimer comprising two peptide chains, wherein each peptide chain comprises, from N-terminus to C-terminus, a first heavy chain antigen-binding domain (VHH1)-L1-a second heavy chain antigen-binding domain (VHH2)-CH2-CH3-a cell penetrating peptide-a cleavable linker L2-a shielding peptide.

[0189] Figure 2 The action principle of the activatable degrader according to the present invention is shown, wherein the target molecule binding part binds to the target antigen, such as a membrane protein on the surface of a cancer cell, and at the same time, for example, in a tumor microenvironment, the cleavable linker L2 is cut off, releasing the shielding peptide, thereby activating the activatable membrane-penetrating construct of the present invention. In the absence of the shielding peptide, the cell-penetrating peptide plays a role, promoting the endocytosis and degradation of the target antigen by interacting with the cell membrane.

[0190] Therefore, compared with traditional therapies, the activatable degraders provided by the present invention can provide reduced toxicity and reduce on target / off tumor situations.

[0191] Heavy chain variable region linker L1

[0192] In the antibody or antigen-binding fragment thereof of the present invention, or an activatable degradon containing the antibody or antigen-binding fragment, when it contains multiple heavy chain variable regions VH or VHH, the multiple heavy chain variable regions can be connected by conventional peptide linkers or connecting peptides or linkers. The linker is usually a peptide containing 2 to 20 amino acids. Preferably, the linker used to connect different heavy chain variable regions is a stable linker, i.e., a linker that does not contain an enzyme cleavage site.

[0193] A person skilled in the art can easily select a suitable linker, exemplary linkers include, but are not limited to, polyglycine (G)y, poly(glycine-serine) (including, for example, (GS)y, (GSGGS)y (SEQ ID NO.66), (GGGS)y (SEQ ID NO.67), (GGGGS)y (SEQ ID NO.68), wherein y is an integer selected from 1 to 20, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20), poly(glycine-alanine), poly(alanine-serine), poly(alanine-proline).

[0194] In some embodiments, the linker is poly(glycine-serine), such as (GSGGS)7 (SEQ ID NO. 69), (GGGS)7 (SEQ ID NO. 70), (GGGGS)7 (SEQ ID NO. 71).

[0195] In some embodiments, the linker is a glycine polymer. Exemplary linkers may include amino acid sequences, including but not limited to: GGS; GGSG (SEQ ID NO.72); GGSGG (SEQ ID NO.73); GGGGS (SEQ ID NO.74); GSGSG (SEQ ID NO.75); GSGGG (SEQ ID NO.76); GGGSG (SEQ ID NO.77); GSSSG (SEQ ID NO.78), etc.

[0196] In some embodiments, the linker is an alanine-proline polymer. Exemplary linkers can comprise an amino acid sequence, including but not limited to (AP)n, wherein n is an integer selected from 1 to 20, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20.

[0197] Nucleic Acids

[0198] The present invention also provides nucleic acids encoding the activatable transmembrane construct, or antibody or antigen-binding fragment thereof, or heavy chain antibody, or activatable degradon of the present invention. The present invention also provides vectors comprising the nucleic acid, and cells comprising the nucleic acid or the vector.

[0199] As used herein, the term "vector" generally refers to a nucleic acid molecule that can self-replicate in a suitable host, which transfers the inserted nucleic acid molecule into and / or between host cells. The vector may include a vector that is primarily used to insert DNA or RNA into a cell, a vector that is primarily used to replicate DNA or RNA, and a vector that is primarily used to express the transcription and / or translation of DNA or RNA. The vector also includes a vector with a variety of the above-mentioned functions. The vector may be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, the vector can produce a desired expression product by cultivating a suitable host cell that contains the vector.

[0200] Methods for constructing suitable vectors comprising any of the nucleic acids described herein and suitable for transforming cells (e.g., mammalian cells) are well known in the art and can be found, for example, in Sambrook et al., ed., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Press, 1989, and Ausubel et al., ed., Current Protocols in Molecular Biology, Current Protocols, 1993. Non-limiting examples of vectors include plasmids, transposons, cosmids, and viral vectors (e.g., any adenoviral vector (e.g., pSV or pCMV vector), adeno-associated virus (AAV) vector, lentiviral vector, and retroviral vector) and any carrier.

[0201] Any method known in the art can be used to introduce nucleic acids and vectors into suitable hosts, and to culture and select transformed host cells in vitro, such as calcium chloride-mediated transformation, transduction, conjugation, triparental mating, DEAE, dextran-mediated transfection, infection, liposome membrane fusion, gene gun technique, direct microinjection into single cells, and electroporation, etc. After the nucleic acid or vector of the present invention is introduced into the cells, the cells are cultured under conditions suitable for expressing the encoded sequence, and then the antibody or antigen-binding fragment or portion thereof can be isolated from the cells.

[0202] Pharmaceutical composition or kit

[0203] The present invention provides a pharmaceutical composition comprising the activatable transmembrane construct, or the antibody or its antigen-binding fragment, or the heavy chain antibody, or the activatable degradon, or the nucleic acid, or the vector, or the cell of the present invention.

[0204] The pharmaceutical composition usually contains a therapeutically or preventively effective amount of the active ingredient as described above, which is usually formulated into the desired composition together with a pharmaceutically acceptable carrier after sufficient purification. Pharmaceutically acceptable carriers include excipients, diluents, antioxidants, preservatives, colorants, flavoring agents, diluents, emulsifiers, suspending agents, solvents, fillers, buffers, delivery vehicles, tonicity agents, cosolvents, wetting agents, complexing agents, antimicrobial agents and surfactants, etc.

[0205] The composition can be in liquid or powder or lyophilized form, and can include one or more lyoprotectants, excipients, surfactants, or fillers. The composition of the present invention can be suitable for parenteral administration, such as injection or infusion into an animal by any of the following routes: intraarticular, subcutaneous, intravenous, intramuscular, intraperitoneal, intracerebral (intracerebral parenchyma), intraventricular, intramuscular, intraocular, intraarterial, intralesional, rectal, percutaneous, oral and inhalation routes.

[0206] In some embodiments, the activatable transmembrane construct, or antibody or antigen-binding fragment thereof, or heavy chain antibody, or activatable degrader, or nucleic acid, or vector, or cell of the present invention can also be formulated in the form of a kit.

[0207] Treatment methods and applications

[0208] The present invention provides a method for treating a disease, comprising administering a therapeutically effective amount of an antibody or antigen-binding fragment thereof, a heavy chain antibody, an activatable degron, a nucleic acid molecule, a vector or a pharmaceutical composition according to the present invention to a subject in need thereof.

[0209] In some embodiments, the disease is a disease associated with the expression or overexpression of the membrane protein. In some embodiments, the disease is cancer. In some embodiments, the cancer is selected from squamous cell carcinoma (e.g., epithelial squamous cell carcinoma), lung cancer (including small cell lung cancer, non-small cell lung cancer, adenocarcinoma and squamous cell carcinoma of the lung), peritoneal cancer, hepatocellular carcinoma, gastric cancer (including gastrointestinal cancer and gastrointestinal stromal cancer), bone cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, urethral cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer or cervical cancer, salivary gland cancer, kidney cancer or ureteral cancer, prostate cancer, vaginal cancer, vulvar cancer, thyroid cancer, anal cancer, penis cancer, melanoma, bile duct cancer, central nervous system (CNS) tumors, spinal axis tumors, brain stem gliomas, multiforme glioblastomas, astrocytic tumors, glioma ... The invention relates to melanoma, schwannoma, ependymoma, medulloblastoma, meningioma, squamous cell carcinoma, pituitary adenoma and Ewing's sarcoma, superficial spreading melanoma, lentigo maligna melanoma, acral melanoma, nodular melanoma, multiple myeloma and B-cell lymphoma, chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), hairy cell leukemia, chronic myeloblastic leukemia and post-transplant lymphoproliferative disorder (PTLD), as well as abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors) and Meigs syndrome, brain tumors and brain cancers, and head or neck cancers and related metastatic cancers.

[0210] The present invention also provides a method for activating T cells, comprising using an anti-PD-L1 antibody or an antigen-binding fragment thereof, such as Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH and any combination thereof, linked to an activatable transmembrane construct of the present invention.

[0211] The antibodies applicable to the present invention may be blocking antibodies or non-blocking antibodies.

[0212] Traditional anti-PD-L1 antibodies need to be strictly screened for specific binding epitopes and are usually difficult to obtain. Such antibodies can block the binding of PD-1 and PD-L1 and activate T cells after binding to the target, so they are also called blocking antibodies. In contrast, non-blocking antibodies themselves cannot block the binding of PD-1 and PD-L1 or activate T cells after binding to the target, so they are usually candidates that need to be screened out in the screening of therapeutic anti-PD-L1 antibodies.

[0213] The present invention connects the anti-PD-L1 antibody or its antigen-binding fragment with the conditionally activatable transmembrane construct, so that both blocking antibodies and non-blocking antibodies can achieve the effect of activating T cells and killing tumor cells, which has additional benefits.

[0214] Example

[0215] Examples and drawings are provided below to help understand the present invention. However, it should be understood that these examples and drawings are only used to illustrate the present invention, but do not constitute any limitation. The actual protection scope of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.

[0216] Example 1: Obtaining anti-hPD-L1 single domain antibody:

[0217] 1.1 Alpaca Immunity

[0218] A new Chilean alpaca (Lama alpacos) was selected, and 0.8 mg of antigen protein was fully mixed with adjuvant and then immunized at multiple points once a week. The first and second immunizations used PD-L1 (ECD) fused with human Fc antigen, and the third, fourth and fifth immunizations used PD-L1 (ECD) fused with 6×His tag antigen to stimulate B lymphocytes to produce single-domain antibodies specifically targeting PD-L1 (ECD).

[0219] One week after each immunization, the blood of the alpaca was collected and the titer of the antibody in the serum was determined by enzyme-linked immunosorbent assay (ELISA). The coating protein was PD-L1 (ECD) fused with 6×His tag antigen, and the detection antibody was Goat anti-llama IgG (HRP) (Abcam, Cat#ab112786). It was monitored that the titer of the antibody in the serum was significantly improved after 5 rounds of immunization, which was used for the subsequent library construction and screening experiments.

[0220] 1.2 Construction of phage display library

[0221] After five immunizations, 50 ml of peripheral blood lymphocytes were extracted from the alpaca and total mRNA was extracted using the RNA extraction kit provided by Thermo Fisher Scientific. The extracted mRNA was reverse transcribed into cDNA using the Vazyme HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Cat#R312-02). Nested PCR was used to amplify the variable region nucleic acid fragments of the heavy chain antibody:

[0222] First round of PCR:

[0223] Primer F1: CTTGGTGGTCCTGGCTGC (SEQ ID NO: 1);

[0224] Primer R1: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO: 2);

[0225] The second round of PCR was performed using the first round PCR product as a template:

[0226] Primer F2: ACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC (SEQ ID NO: 3);

[0227] Primer R2-1: CTCGCGGCCGGCCTGGCCATGGGGGTCTTCGCTGTGGTGCG (SEQ ID NO: 4);

[0228] Primer R2-2: CTCGCGGCCGGCCTGGCCGTCTTGTGGTTTTGGTGTCTTGGG (SEQ ID NO: 5);

[0229] The variable region fragment of the target heavy chain antibody was recovered by gel, and the VHH fragment and the phage display vector pComb3XSS were digested with restriction endonuclease Sfi I. Then, the digested VHH fragment and the vector were connected at a molar ratio of 1:3 at 16°C for 16 hours; the connection product was electroporated into E. coli TG1 competent cells to construct a PD-L1 single domain antibody phage display library, and the library was evaluated for quality. The library capacity was tested to be 6.72×10 8 In order to detect the insertion rate of the library, 20 colony clones were randomly selected for sequencing and identification. The results showed that the correct insertion rate was 100%, indicating that the constructed phage display library was of high quality and could be used for the screening of single-domain antibodies against PD-L1.

[0230] 1.3 Screening of PD-L1 single domain antibodies:

[0231] 100 μg of PD-L1 (ECD)-LPETG-6His fusion protein was labeled with GGGK (biotin) (customized synthesis by Hangzhou Peptide Biological) using Sortase-mediated labeling reaction, and further combined with 100 μl SA magnetic beads (Beaver, Cat#22307-1). 10 μl of magnetic beads loaded with antigen protein were combined with 100 μl of phage (1x10 11pfu) were co-incubated at room temperature for 1 hour. Then, the cells were washed 5 times with PBST (PBS pH 7.4, 0.05% Tween 20) to remove the phage-displayed single-domain antibodies that did not bind to the antigen PD-L1 (ECD). The phages specifically targeting the PD-L1 single-domain antibody were then eluted with 100mM triethylamine and infected with Escherichia coli TG1 cells in the logarithmic growth phase. The cells were infected at 37°C for 1 hour, cultured overnight, and the phages were collected for the next round of screening. The same screening process was repeated 4 rounds, so that the phages specifically targeting the PD-L1 single-domain antibody were gradually enriched.

[0232] 1.4 Phage enzyme-linked immunosorbent assay to screen positive clones that specifically bind to PD-L1:

[0233] After 4 rounds of bio-panning, PD-L1-6HIS fusion protein was plated, combined with phage to infect Escherichia coli, and 128 single colonies were picked and cultured separately to purify the M13 phage corresponding to the single-domain antibody. Add it to the ELISA plate wells coated with PD-L1 (ECD) hFc overnight and incubate at 37°C for 1h. Wash 5 times with PBST to wash off the non-specifically bound single-domain antibody, add Mouse Anti-M13 Antibody (HRP) (Sino Biological, Cat#11973-MM05T-H)), and incubate at 37°C for 1h. Wash 5 times with PBST to wash off the unbound primary antibody, add the luminescent substrate, read the luminescence value on the microplate reader, and judge it as a positive clone when the experimental well value is 3 times or more than 3 times that of the control well. The bacteria corresponding to the positive clone wells were shaken in LB liquid culture medium for sequencing, and three sequence-specific single-domain antibodies were obtained after amino acid sequence alignment analysis of the sequencing results. The amino acid sequences are shown in Table 3.

[0234] Table 3 Sequence-specific single domain antibody amino acid sequences

[0235]

[0236] 1.5 Expression and purification of heavy chain antibody variable regions in E. coli

[0237] Seven single-domain antibody encoding nucleic acid sequences were obtained by synthetic sequencing analysis, cloned into the expression vector pET-21a (+) (Novagen, Cat# 69740) and added with a His tag, transformed into the Escherichia coli expression strain BL21 (DE3), and spread on LB solid medium containing 100 μg / mL kanamycin, and cultured overnight at 37°C in a constant temperature incubator. A single clone was selected and inoculated into 2 mL of LB liquid medium containing kanamycin, and cultured at 37°C in a constant temperature shaker for 8-12 hours to the stationary phase. 1:100 was transferred to fresh culture medium, cultured at 37°C in a constant temperature shaker until the OD value reached 0.6-0.9, and IPTG inducer with a final concentration of 0.1mM was added, and expression was induced at 28°C for 12-16 hours. The cells were collected by centrifugation, the cells were ultrasonically broken to obtain the lysate, the supernatant was collected by high-speed centrifugation, and the single-domain antibody with a His tag was purified using a nickel column.

[0238] 1.6 Fortebio determines the affinity of single domain antibodies for PD-L1

[0239] The Fortebio Octet Red 96 instrument and the matching streptavidin probe (Fortebio, CAT#18-5020) were used in this assay. The single domain antibody purified from Escherichia coli was diluted to 500nM, 125nM, 31nM, 7.8nM, and 1.95nM in equilibration buffer (PBS, 0.05% Tween-20, 0.5% BSA). The BLI assay was performed as follows: (1) Sensor inspection: The sensor was immersed in equilibration buffer for 60s. (2) PD-L1 immobilization: The sensor was immersed in 5μg / ml Biotylated-PD-L1 (Sino biological, CAT#50010-M08H-B) solution for 200s. (3) Baseline: The sensor was immersed in equilibration buffer for 60s. (4) Association: The sensor was immersed in different concentrations of the test sample for 200s. (5) Dissociation: The sensor was immersed in equilibration buffer for 200s. (6) Washing: The sensor was immersed in wash buffer 1 (0.1 M glycine-HCl, pH 2.2) for 5 s, and then immersed in wash buffer 2 (PBS, 0.05% Tween-20-20, 0.5% BSA) for 5 s, and the cycle was repeated for 3 cycles. Curve fitting was performed by Fortebio Octet data analysis software, and the measured binding forces are shown in Table 2.

[0240] Table 4. Binding ability of antibody strains

[0241] Serial number Antibody strain KD(nM) 1 P43 6.71 2 P15 9.97 3 P28 NA 4 P24 NA 5 P69 16.92 6 P60 18.74 7 P14 28.71

[0242] Example 2: Identification of non-blocking hPD-L1 heavy chain antibodies

[0243] 2.1 Preparation of hPD-L1 heavy chain antibody

[0244] The PD-L1 antibody nucleic acid sequence was codon optimized, and the human IgG1 constant region Fc and LPETGGGHHHHHH sequence (SEQ ID NO: 29) were added to its C-terminus, and then cloned into the pEF vector and handed over to Anshengda Gene for synthesis. The obtained plasmid glycerol bacteria were first picked into 2 mL of LB liquid culture medium with ampicillin resistance. When the bacteria grew to the stationary phase, they were amplified at 1:100, cultured at 37°C for 12-18 hours, and the bacteria were collected by centrifuge for endotoxin-free plasmid extraction.

[0245] After the plasmid was extracted, it was transferred into HEK293 cells for expression as follows: HEK 293 cells were cultured to 2.0×10 6 The density of cells / mL was 95% for survival rate determination using trypan blue staining. Prepare 100mL of cells, dissolve 100ug of endotoxin-free plasmid in 1.5mL of serum-free medium (Yonglian Biotechnology (Shanghai) Co., Ltd.), take 1.5mL of serum-free medium, add 400μL of 1mg / mL PEI transfection reagent (Ploysciences, Inc, cat#23966-2) to it and let stand for 5 minutes. Add the PEI mixture to the plasmid mixture, incubate at room temperature for 10 minutes, then add it to HEK 293 cells and culture in a shaking incubator at 37°C and 8% CO2 for 4 days. Collect the cell culture supernatant, centrifuge at 4000g for 10min, and then centrifuge the supernatant at high speed to remove impurities. Protein A pre-packed column purifies hPD-L1 heavy chain antibody, ultrafiltration and concentration replaces the buffer in PBS solution with 10% glycerol and stores at -30°C for aliquoting. The single-domain antibody with human Fc was obtained by SDS-PAGE electrophoresis. Figure 3 shown.

[0246] 2.2 FACS characterization of the binding activity of hPD-L1 heavy chain antibody to cell surface antigens

[0247] For each sample, 1×10 6 MDA-MB-231PD-L1 EGFP (a stable cell line established by transferring PD-L1 / EGFP gene into MDA-MB-231 cells by lentivirus) cells were resuspended in HBSS buffer, and the above hPD-L1 heavy chain antibody with Fc fragment and anti-human Fc fluorescent secondary antibody were added at a final concentration of 100 nM, incubated at 4°C in the dark for 1 h, washed 3 times with HBBS and then tested on an instrument (Invitrogen, Attune NXT). The results are as follows Figure 4 shown.

[0248] The results showed that the hPD-L1 heavy chain antibodies P43-Fc and P69-Fc described in the present application were able to bind to MDA-MB-231PD-L1 EGFP cells overexpressing hPD-L1.

[0249] 2.3hPD-L1 heavy chain antibody on T cell activation in PD-1 / PD-L1 Blockade Bioassays

[0250] PD-1NFAT-Luc / Jurkat cells (Promega) were cultured in RPMI 1640 medium with 10% FBS, 1% Penn-strep, 1% Penn-strep and 200 μg / mL hygromycin B (growth medium). PD-L1 aAPC / CHO-K1 cells were cultured in F12 medium supplemented with 10% FBS, 1% Penn-Strep, 1 mg / mL neomycin and 500 μg / mL hygromycin (growth medium). PD-L1 aAPC / CHO-K1 cells were inoculated in a white 96-well microplate (Corning, cat#3917) with 100 μL per well, a total of 1.5w cells. After overnight (16-18h) culture, the cells were attached, the culture supernatant was aspirated, 50 μL of hPD-L1 antibody 100nM was added, KN035-Fc (Corning Jeol, Envida) was set as a positive control, and incubated in the incubator for 30min, 50 μL, 1.8w PD-1NFAT-Luc / Jurkat cells were added and incubated for 6 hours, and then the incubator was taken out and cooled to room temperature for 10min, and 100 μL of luciferase reporter gene assay reagent (Yeasen, CAT#11404ES80) was added to the reaction well for luminescence measurement. The luminescence intensity was measured using a TECAN microplate reader, and the bioluminescence intensity of the sample group was divided by the luminescence intensity of the blank control as the multiple of T cell activation.

[0251] Results Figure 5 and Figure 6 Through the analysis of 4 hPD-L1 antibodies, it was found that P43-Fc, P69-Fc, and P14-Fc did not show obvious blocking effects. Although P60-Fc showed a certain degree of blocking effect, its IC50 was more than 50 times that of the positive control KN035-Fc.

[0252] Example 3: Construction of hPD-L1 heavy chain antibody degrader

[0253] 3.1 Transpeptidase connects the cell-penetrating peptide to the C-terminus of hPD-L1 single domain antibody Fc

[0254] Transpeptidase (SrtA) is a polypeptide ligase that can recognize the LPXTG sequence (SEQ ID NO.62) or LPXT sequence (SEQ ID NO.63) (where X is any amino acid sequence) (e.g., LPETG (SEQ ID NO.64) or LPET (SEQ ID NO.65)) at the C-terminus of a protein and the GGG sequence at the N-terminus of another protein or polypeptide, and perform cutting and connection to finally form a connection product containing the LPXTGGG sequence (SEQ ID NO:30). In this embodiment, the target antibody is a monoclonal antibody specifically binding to hPD-L1, and the transmembrane peptide sequence is GGG-(D-Arg)9-NH2 (SEQ ID NO:31) (where Arg is all in D configuration, synthesized by Hangzhou Peptide Biology). The molar concentration ratio of each component in this connection reaction system is hPD-L1 antibody: GGG-(D-Arg)9-NH2: SrtA = 1:20:0.2, and finally the reaction system is supplemented with a final concentration of 5mM CaCl 2， The reaction system was maintained at pH 8.0, incubated at 37°C in a water bath for 2 h, and the SrtA termination reagent MTSET (Bioldi, cat# BN15003) was added to terminate the reaction at room temperature for 5-10 min. The unreacted small molecules were removed by desalting column treatment to obtain high-purity anti-hPD-L1 degraders.

[0255] 3.2 Characterization of PD-L1 degradation on the surface of MDA-MB-231PD-L1 / EGFP cells by hPD-L1 heavy chain antibody degradation

[0256] In the evaluation experiment of the degradation effect of PD-L1 in this embodiment, the cell line used is MDA-MB-231PD-L1 / EGFP (a stable cell line established by transferring the PD-L1 / EGFP gene using lentivirus on the basis of MDA-MB-231 cells). The growth medium of MDA-MB-231PD-L1 / EGFP is high-glucose DMEM+10% FBS+1% PS. The cells are plated in a 24-well plate with about 10w cells per well, and 100nM anti-hPD-L1 heavy chain antibody degradation agent is added, and incubated at 37°C, 5% carbon dioxide incubator for 12h. After the incubation, the cell culture supernatant is aspirated and discarded, and Western and IP lysis buffer (Biyuntian, cat#P0013) are added to the lysis reaction on ice for 10min, and the lysate is collected. The total protein of the lysate is quantitatively analyzed by the BCA kit (Yamei Biological, cat#ZJ102). The total protein amount in each well is controlled to be consistent, and Western blot analysis is performed:

[0257] Results Figure 7, HBSS was the blank control group. The anti-hPD-L1 degraders showed different degrees of degradation effects, and the degradation levels needed to be improved.

[0258] Example 4: Construction of hPD-L1 dual-epitope heavy chain antibody degrader

[0259] 4.1 Preparation of Fc fusion protein of hPD-L1 dual-epitope antibody

[0260] The construction of the hPD-L1-targeted dual-epitope antibody is to connect two nanoantibody sequences that specifically bind to hPD-L1 by 7 repeated GGGGS sequences (SEQ ID NO: 32), and connect them to the Fc fragment and the LPETGGGHHHHHH sequence (SEQ ID NO: 29), and design the N297A mutation in the Fc fragment. The designed sequence was handed over to Anshengda Gene Company for synthesis. The expression and purification process of the dual-epitope hPD-L1 antibody was performed indiscriminately according to the steps of 2.1 in Example 2. The purified bispecific antibody was analyzed by SDS-PAGE as shown in the following figure. Figure 8 shown.

[0261] 4.2 Transpeptidase connects the membrane-penetrating peptide to the C-terminus of the hPD-L1 bi-epitope antibody Fc

[0262] According to step 3.1 in Example 3, an indiscriminate operation was performed to obtain a high-purity degradon based on the hPD-L1 dual-epitope antibody.

[0263] 4.3 Mass spectrometry confirms successful connection of cell-penetrating peptide

[0264] High-purity degraders based on hPD-L1 dual-epitope antibodies were prepared by replacing the buffer with a 50 mM ammonium acetate solution using an ultrafiltration tube, and then centrifuged at 12,000 rpm for 5 min. The molecular weight was analyzed using deconvolution software, such as Fig. 9A and 9B As shown, the connection efficiency reached 100%.

[0265] 4.4 Characterization of cell surface PD-L1 degradation by hPD-L1 bi-epitope antibody-based degraders

[0266] According to step 3.2 of Example 3, an indiscriminate operation was performed to obtain the degradation of hPD-L1 on the surface of MDA-MB-231PD-L1 / EGFP cells by the hPD-L1 dual-epitope antibody-based degrader.

[0267] like Fig.10 As shown, the degradation ability of PD-L1 by the degraders based on the hPD-L1 dual-epitope antibody was significantly improved compared with that by the degraders based on the hPD-L1 single-epitope antibody.

[0268] 4.5hPD-L1 bi-epitope antibody-based degraders on T cell activation in PD-1 / PD-L1 Blockade Bioassays

[0269] PD-1NFAT-Luc / Jurkat cells (Promega) were cultured in RPMI 1640 medium with 10% FBS, 1% Penn-strep, 1% Penn-strep and 200 μg / mL hygromycin B (growth medium). PD-L1 aAPC / CHO-K1 cells were cultured in F12 medium supplemented with 10% FBS, 1% Penn-Strep, 1 mg / mL neomycin and 500 μg / mL hygromycin (growth medium). PD-L1 aAPC / CHO-K1 cells were inoculated in a white 96-well microplate (Corning, cat#3917) with 50 μL per well, a total of 1.5w cells, and then supplemented with 50 μL of degradation sub-diluent 100nM, and KN035-Fc (Corning Jereh, Envida) was set as a positive control. After overnight (16-18h) culture, the cells were attached and the culture supernatant was discarded. PBS or DPBS buffer was added for washing 3 times. 100 μL of 1.8w PD-1NFAT-Luc / Jurkat cells were added and incubated for 6 hours. After cooling to room temperature for 10 minutes, 100 μL of luciferase reporter gene assay reagent (Yeasen, CAT#11404ES80) was added to the reaction well for luminescence measurement. The luminescence intensity was measured using a TECAN microplate reader. The results are shown in Figure 2. Fig.11 shown.

[0270] The results showed that the degrader prepared with a bi-epitope antibody based on P69-P43-Fc showed the highest activation effect. In subsequent studies, P69-P43-Fc was selected as the bi-epitope antibody for hPD-L1 binding.

[0271] Example 5: Comparison of the degradation ability of the degraders of the bi-epitope heavy chain antibody with the L-type cell-penetrating peptide and the degraders with the D-type cell-penetrating peptide connected to the C-terminus of the antibody on the target antigen hPD-L1

[0272] 5.1 Preparation of Fc fusion protein of hPD-L1 dual-epitope antibody

[0273] The construction of the hPD-L1-targeted dual-epitope antibody was to connect two nanoantibody sequences that specifically bind to hPD-L1 by 7 repeated GGGGS sequences (SEQ ID NO: 32), and to connect the Fc fragment and the LPETGGGHHHHHH sequence (SEQ ID NO: 29), and to design the N297A mutation in the Fc fragment. The designed sequence was synthesized by Anshengda Gene Company. The expression and purification process of the P43-P69-Fc antibody was performed indiscriminately according to the steps in 2.1 of Example 2.

[0274] 5.2 Transpeptidase connects L- and D-transpeptides to the C-terminus of the P43-P69-Fc antibody Fc

[0275] Referring to the steps of 3.1 in Example 3, the same operation was used to connect the L-configuration penetrating peptide and the D-configuration penetrating peptide (GGG-(Arg)9-NH2 (SEQ ID NO: 31), wherein Arg is all L-configuration or D-configuration (synthesized by Hangzhou Peptide Biology)) to the C-terminus of the P43-P69-Fc antibody Fc using a transpeptidase. The molar concentration ratio of each component in this connection reaction system is hPD-L1 antibody: penetrating peptide: SrtA = 1:20:0.2. Finally, the reaction system is supplemented with CaCl2 at a final concentration of 5mM, the reaction system is maintained at ~pH8.0, and the reaction is incubated at 37°C for 2h. The SrtA termination reagent MTSET (Bai Erdi, cat#BN15003) is added to incubate at room temperature for 5-10min to terminate the reaction. The desalting column is treated to remove unreacted small molecules to obtain a high-purity anti-hPD-L1 degrader.

[0276] 5.3 Characterization of cell surface PD-L1 degradation by P43-P69-Fc antibody-based degraders

[0277] According to the steps of 3.2 in Example 3, an indiscriminate operation was performed to obtain the degradation of hPD-L1 on the surface of MDA-MB-231PD-L1 / EGFP cells by a degrader based on hPD-L1 dual-epitope antibody linked to L-configuration transmembrane peptide and D-configuration transmembrane peptide.

[0278] like Fig.12 As shown in the figure, the degradation agent based on hPD-L1 dual-epitope antibody connected to L-configuration transmembrane peptide has limited degradation ability on PD-L1. Therefore, in the subsequent research process, the degradation agent based on hPD-L1 dual-epitope antibody connected to D-configuration transmembrane peptide was selected.

[0279] 5.4 P43-P69-Fc antibody linked to L-transmembrane peptide-based degraders on T cell activation in PD-1 / PD-L1 Blockade Bioassays

[0280] PD-1NFAT-Luc / Jurkat cells (Promega) were cultured in RPMI 1640 medium with 10% FBS, 1% Penn-strep, 1% Penn-strep and 200 μg / mL hygromycin B (growth medium). PD-L1 aAPC / CHO-K1 cells were cultured in F12 medium supplemented with 10% FBS, 1% Penn-Strep, 1 mg / mL neomycin and 500 μg / mL hygromycin (growth medium). PD-L1 aAPC / CHO-K1 cells were inoculated in a white 96-well microplate (Corning, cat#3917) with 50 μL per well, a total of 1.5w cells, and then supplemented with 50 μL of degradation sub-diluent 100nM and 10nM, and KN035-Fc (Corning Jereh, Envida) was set as a positive control. After overnight (16-18h) culture, the cells were attached and the culture supernatant was discarded. PBS or DPBS buffer was added for washing 3 times. 100 μL of 1.8w PD-1NFAT-Luc / Jurkat cells were added and incubated for 6 hours. After cooling to room temperature for 10 minutes, 100 μL of luciferase reporter gene assay reagent (Yeasen, CAT#11404ES80) was added to the reaction well for luminescence measurement. The luminescence intensity was measured using a TECAN microplate reader. The results are shown in Figure 2. Fig.13 shown.

[0281] The results showed that the degrader prepared by the P43-P69-Fc-based dual-epitope antibody connected to the D-configuration transmembrane peptide exhibited an excellent activation effect. In subsequent studies, the dual-epitope PD-L1 heavy chain antibody connected to the D-configuration transmembrane peptide was selected as the degrader.

[0282] Example 6: Construction of hPD-L1 binding dual-epitope antibody tumor in situ activated degrader

[0283] 6.1 Transpeptidase connects the conditionally activated degrader peptide to the C-terminus of the hPD-L1 dual-epitope antibody Fc

[0284] Based on the fact that the C-terminus of the dual-epitope hPD-L1 antibody ends with the sequence LPETGGGHHHHHH (SEQ ID NO: 29), the transpeptidase attached the activatable degron to the C-terminus of the dual-epitope antibody. In this embodiment, the antibody of interest is a dual-epitope antibody P69-P43-Fc that specifically binds to hPD-L1 (wherein the C-terminus of Fc ends with the LPETGGGHHHHHH sequence (SEQ ID NO: 29)), which is respectively connected to activatable transmembrane construct 1: NH2-GGG-(D-Arg)9-PLGLAG-(D-Glu)9-COOH (SEQ ID NO: 59), activatable transmembrane construct 2: NH2-GGG-(D-Arg)9-SGGISSGLLSGRSDNHGGS-(D-Glu)9-COOH (SEQ ID NO: 60) and activatable transmembrane construct 3: NH2-GGG-(D-Arg)9-GGSGRSAGGGGSPLGLAGSGGS-(D-Glu)9-COOH (SEQ ID NO: 61) (synthesized by Hangzhou Peptide Biology). The activatable membrane-penetrating construct is composed of three parts, namely, a membrane-penetrating peptide, a cleavable linker that can be cleaved by enzymes in the tumor microenvironment, and a shielding peptide that blocks the function of the membrane-penetrating peptide. The reaction system and conditions are implemented indiscriminately according to the steps of 3.1 in Example 3 to obtain a high-purity activatable degradon.

[0285] 6.2 Mass spectrometry confirms that conditionally activated degraders release shielding peptides under the action of MMP-9

[0286] The activatable degrader COMBOTAC: P69-P43-Fc-LPET-activatable transmembrane construct 1 was replaced into the test buffer (250 mM Tris, 50 mM CaCl2, 750 mM NaCl, 0.25% Brij-35 (w / v), pH 7.5 (TCNB)), and rhMMP-9 (Sino Biological, cat#10327-H08H matrix metalloproteinase 9, working final concentration of 1 ng / μL) was added thereto, mixed evenly, and placed at 37°C for reaction for 30 min. Sample processing was performed according to step 4.3 of Example 4, and MS analysis was performed as shown in FIG. Fig.14A and 14B As shown, under the action of MMP-9, the cleavage efficiency of conditionally activated degraders reached 100%.

[0287] 6.3 Conditionally activated degraders release their activity under the action of MMP-9 to degrade cell surface PD-L1

[0288] According to the steps of 3.1 in Example 3, an indiscriminate operation was performed, and the sample groups were P69-P43-Fc, bi-epitope heavy chain antibody degrader BiparaNbTAC, bi-epitope heavy chain antibody conditional activation degrader CAMBOTAC, and MMP-9 was added to the conditional activation degrader, wherein the working final concentration of MMP-9 was maintained at 1 ng / μL, and the degradation of hPD-L1 on the surface of MDA-MB-231PD-L1 / EGFP cells was obtained, as shown in FIG. Fig.15 shown.

[0289] Adding matrix metalloproteinase MMP-9 in the tumor microenvironment to the sample culture medium of the dual-epitope heavy chain antibody conditionally activated degrader can release its degradation ability to achieve the same degradation level as the dual-epitope heavy chain antibody degrader.

[0290] 6.4 Effects of Conditionally Activated Degraders on T Cell Activation in PD-1 / PD-L1 Blockade Bioassays

[0291] PD-1NFAT-Luc / Jurkat cells (Promega) were cultured in RPMI 1640 medium with 10% FBS, 1% Penn-strep, 1% Penn-strep, and 200 μg / mL hygromycin B (growth medium). PD-L1 aAPC / CHO-K1 cells were cultured in F12 medium supplemented with 10% FBS, 1% Penn-Strep, 1 mg / mL neomycin, and 500 μg / mL hygromycin (growth medium). APC / CHO-K1 cells were seeded in a white 96-well microplate (Corning, cat#3917) at 100 μL per well, for a total of 1.5w cells. After overnight (16-18 h) culture, the cells were attached, and the culture supernatant was discarded. 50 μL of P69-P43-Fc (100 nM), bi-epitope heavy chain antibody degrader BiparaNbTAC (100 nM), bi-epitope heavy chain antibody conditional activation degrader CAMBOTAC (100 nM) and conditional activation degrader (100 nM) were added. nM) was added with MMP-9, wherein the working final concentration of MMP-9 was maintained at 1ng / μL, KN035-Fc (Corning Jeol, Envida) was set as a positive control, incubated in an incubator for 30min, 50μL was added, 1.8w PD-1NFAT-Luc / Jurkat cells were co-incubated for 6 hours, the incubator was taken out and cooled to room temperature for 10min, and 100μL luciferase reporter gene assay reagent (Yeasen, CAT#11404ES80) was added to the reaction well for luminescence determination. The luminescence intensity was measured using a TECAN microplate reader, and the bioluminescence intensity of the sample group was divided by the luminescence intensity of the blank control as the multiple of T cell activation.

[0292] like Fig.16 As shown, adding MMP-9 to the sample culture medium of the conditionally activated degrader of the dual-epitope heavy chain antibody can release its degradation ability to achieve the same T cell activation level as the dual-epitope heavy chain antibody degrader, and the same T cell activation level as the positive blocking antibody Envida.

[0293] 6.5 Inhibitory activity of conditionally activated degraders on tumor growth

[0294] Inject 2x10 in the axilla of hPD-L1 / C57 mice 5 hPD-L1 / MC38 cells, one week later, the tumor volume reached ~50mm 3 (Measured by vernier caliper, tumor volume = length × width × width / 2). The drug was administered via the tail vein of mice at a dose of 5 mg / kg, once every three days. The HBSS group was used as a negative control, and the Envida antibody was used as a positive control. The formation of tumors was observed each time the drug was administered, and the length and width of the tumors were measured with a vernier caliper, the tumor volume was calculated, and the tumor growth curve was drawn. The results are shown in Fig.15 In the tumor inhibition experiment, three conditionally activated degraders with different sequences were screened. The difference between them is that the cleavable linker connecting the cell-penetrating peptide and the shielding peptide is different. The sequence of cleavable linker 1 is: PLGLAG (SEQ ID NO: 35); the sequence of cleavable linker 2 is: SGGISSGLLSGRSDNHGGS (SEQ ID NO: 44); the sequence of cleavable linker 3 is: GGSGRSAGGGGSPLGLAGSGGS (SEQ ID NO: 45).

[0295] The results are as follows FIG. 17A to FIG. 17E As shown, the cell-penetrating peptide and the shielding peptide are connected with the sequence of the cleavable linker 3, wherein two enzyme cleavage sites uPA and MMP-9 that respond to enzymes specific to the tumor microenvironment show tumor inhibitory activity comparable to that of the commercial antibody Envida.

[0296] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0297] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0298] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. An activatable membrane-penetrating construct comprising a cell-penetrating portion (CPM), a cleavable portion (CM) and a shielding portion (BM), wherein the cell-penetrating portion is selected from: a membrane-penetrating peptide (CPP), an oligosaccharide peptide and any combination thereof, and / or the shielding portion is selected from: a shielding peptide.

2. The activatable membrane-penetrating construct of claim 1, wherein the cell-penetrating portion comprises 1 to 30 positively charged amino acid residues, preferably arginine and / or lysine residues, and further preferably, the arginine residues are selected from arginine residues in D configuration and / or L configuration, or the lysine residues are selected from lysine residues in D configuration and / or L configuration; And / or, the shielding portion comprises 1 to 30 negatively charged amino acid residues, preferably glutamic acid and / or aspartic acid residues, and further preferably, the glutamic acid residues are selected from glutamic acid residues in D configuration and / or L configuration, or the aspartic acid residues are selected from aspartic acid residues in D configuration and / or L configuration.

3. The activatable transmembrane construct of claim 1 or 2, wherein the cleavable portion is a protease substrate peptide, preferably, the protease is selected from fibroblast activation protein, urokinase-type plasminogen activator, matrix proteinase, legumin and matrix metalloproteinase (MMP), preferably MMP2, MMP3 or MMP9 or uPA.

4. The activatable membrane-penetrating construct of claim 1 or 2, wherein the cleavable portion has an amino acid sequence selected from the group consisting of SEQ ID NOs. 33-57.

5. The activatable transmembrane construct of claim 1 or 2, wherein the various parts in the activatable transmembrane construct are connected as follows: CPM-CM-BM.

6. The activatable transmembrane construct of claim 1 or 2, wherein the activatable transmembrane construct further comprises an Fc domain, wherein the Fc domain is selected from the Fc domain of IgG, IgM, IgE, IgA or IgD, and preferably, the Fc domain is from human.

7. The activatable transmembrane construct of claim 1 or 2, wherein the activatable transmembrane construct comprises Fc-CPM-CM-BM from N-terminus to C-terminus, Preferably, the activatable transmembrane construct comprises Fc-LPXT(G)n-CPM-CM-BM from N-terminus to C-terminus, wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5; wherein X is any amino acid, preferably E, K, N, Q, A.

8. The activatable transmembrane construct of claim 1 or 2, wherein the activatable transmembrane construct further comprises a target molecule binding portion (TBM), preferably, the target molecule binding portion specifically binds to a membrane protein, such as PD-L1, EGFR, HER-2 or a functional fragment thereof.

9. The activatable transmembrane construct of claim 8, wherein the target molecule binding portion comprises an antibody or an antigen binding fragment thereof, preferably, the antigen binding fragment is selected from Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH and any combination thereof.

10. The activatable transmembrane construct of claim 8, wherein the target molecule binding portion comprises a plurality of tandemly connected VHHs, preferably, each of the plurality of tandemly connected VHHs is directed against a different binding epitope.

11. The activatable transmembrane construct of claim 8, wherein the target molecule binding moiety is linked to the N-terminus of the activatable transmembrane construct.

12. An antibody or antigen-binding fragment thereof that specifically binds to PD-L1 or a fragment thereof, wherein the antibody or antigen-binding fragment thereof contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, wherein the amino acid sequence of CDR1 is as shown in SEQ ID NO.6, 12, 15, or 18, and / or the amino acid sequence of CDR2 is as shown in SEQ ID NO.7, 13, 16, or 19, and / or the amino acid sequence of CDR3 is as shown in SEQ ID NO.8, 9, 10, 11, 14, 17, or 20.

13. The antibody or antigen-binding fragment thereof of claim 12, wherein the amino acid sequences of CDR1, CDR2 and CDR3 are respectively as shown in SEQ ID NOs. 6, 7, 8; or as shown in SEQ ID NOs. 6, 7, 9; or as shown in SEQ ID NOs. 6, 7, 10; or as shown in SEQ ID NOs. 6, 7, 11; or as shown in SEQ ID NOs. 12, 13, 14; or as shown in SEQ ID NOs. 15, 16, 17; or as shown in SEQ ID NOs. 18, 19, 20.

14. The antibody or antigen-binding fragment thereof according to claim 12 or 13, wherein the amino acid sequence of the CDR1, CDR2 and / or CDR3 comprises an amino acid mutation and can maintain the function of the antibody to specifically bind to PD-L1, preferably, the amino acid mutation is an amino acid substitution, and the number of the amino acid substitutions can be 1-3.

15. The antibody or antigen-binding fragment thereof of claim 12 or 13, wherein the VH comprises an amino acid sequence as shown in any one of SEQ ID NOs. 21-27 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto, preferably, the VH has an amino acid sequence as shown in any one of SEQ ID NOs. 21-27.

16. The antibody or antigen-binding fragment thereof of claim 12 or 13, wherein the antibody or antigen-binding fragment thereof further comprises an Fc domain, such as an Fc domain derived from IgG, IgM, IgE, IgA or IgD, preferably, the Fc domain is an Fc domain of IgG, such as an Fc domain of at least one of IgG1, IgG2, IgG3 or IgG4, also preferably, the Fc is an Fc of human IgG, preferably, the Fc comprises N297A and / or N297G mutations.

17. The antibody or antigen-binding fragment thereof according to claim 16, wherein the C-terminus of the Fc domain has or is linked to the amino acid sequence LPXTGGGHHHHHH as shown in SEQ ID NO.28, wherein X is any amino acid, preferably E, K, N, Q, or A.

18. A heavy chain antibody that specifically binds to PD-L1 or a fragment thereof, the heavy chain antibody comprising at least two heavy chain antigen binding domains selected from cluster 1 (VHH 1 ), cluster 2 heavy chain antigen binding domain (VHH 2 ), cluster 3 heavy chain antigen binding domain (VHH 3 ), and cluster 4 heavy chain antigen binding domain (VHH 4 ), wherein: The cluster 1 heavy chain antigen binding domain (VHH 1 ) comprises a first CDR1, a first CDR2 and a first CDR3, whose amino acid sequences are shown in SEQ ID NOs. 6, 7, 8, respectively; or as shown in SEQ ID NOs. 6, 7, 9; or as shown in SEQ ID NOs. 6, 7, 10; or as shown in SEQ ID NOs. 6, 7, 11; The cluster 2 heavy chain antigen binding domain (VHH 2 ) comprises a second CDR1, a second CDR2 and a second CDR3, whose amino acid sequences are shown in SEQ ID NOs. 12, 13 and 14, respectively; The cluster 3 heavy chain antigen binding domain (VHH 3 ) comprises a third CDR1, a third CDR2 and a third CDR3, whose amino acid sequences are shown in SEQ ID NOs. 15, 16 and 17, respectively; and The cluster 4 heavy chain antigen binding domain (VHH 4 ) comprises a fourth CDR1, a fourth CDR2 and a fourth CDR3, and their amino acid sequences are shown in SEQ ID NOs. 18, 19 and 20, respectively.

19. The heavy chain antibody of claim 18, wherein VHH 1 comprising an amino acid sequence as shown in any one of SEQ ID NOs. 21-24 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto; and / or VHH 2 comprising the amino acid sequence as shown in SEQ ID NO.25 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto; and / or VHH 3 comprising the amino acid sequence as shown in SEQ ID NO.26 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto; and / or VHH 4 The invention relates to a polypeptide comprising an amino acid sequence as shown in SEQ ID NO. 27 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto.

20. The heavy chain antibody of claim 18 or 19, wherein the heavy chain antibody comprises (1) cluster 1 and cluster 2 heavy chain antigen binding domains; (2) cluster 1 and cluster 3 heavy chain antigen binding domains; (3) cluster 1 and cluster 4 heavy chain antigen binding domains; (4) cluster 2 and cluster 3 heavy chain antigen binding domains; (5) cluster 2 and cluster 4 heavy chain antigen binding domains; or (6) cluster 3 and cluster 4 heavy chain antigen binding domains; or any combination thereof.

21. The heavy chain antibody of claim 18 or 19, wherein the heavy chain antibody is a dimer comprising two peptide chains, wherein at least one peptide chain comprises, from N-terminus to C-terminus, a first heavy chain antigen binding domain (VHH1)-L1-a second heavy chain antigen binding domain (VHH2)-Fc, wherein the first heavy chain antigen binding domain (VHH1) and the second heavy chain antigen binding domain (VHH2) are each independently selected from: a cluster 1 heavy chain antigen binding domain (VHH1); 1 ), cluster 2 heavy chain antigen binding domain (VHH 2 ), cluster 3 heavy chain antigen binding domain (VHH 3 ), and cluster 4 heavy chain antigen binding domain (VHH 4 ), wherein L1 represents a linker; preferably, VHH1 and VHH2 are selected from different clusters.

22. The heavy chain antibody of claim 21, wherein the at least one peptide chain may further comprise a third heavy chain antigen binding domain (VHH3), wherein the third heavy chain antigen binding domain (VHH3) is selected from: Cluster 1 heavy chain antigen binding domain (VHH 1 ), cluster 2 heavy chain antigen binding domain (VHH 2 ), cluster 3 heavy chain antigen binding domain (VHH 3 ), and cluster 4 heavy chain antigen binding domain (VHH 4 ); Preferably, VHH3 is selected from a different cluster than VHH1 and VHH2.

23. The heavy chain antibody of claim 21, wherein the heavy chain antibody is a homodimer or a heterodimer.

24. The heavy chain antibody of claim 23, wherein the VHH in the two peptide chains of the heterodimer are each independently selected from the cluster 1 heavy chain antigen binding domain and the cluster 2 heavy chain antigen binding domain.

25. The heavy chain antibody of claim 18 or 19, wherein the antibody or antigen-binding fragment thereof further comprises an Fc domain, such as an Fc domain derived from IgG, IgM, IgE, IgA or IgD, preferably, the Fc domain is an Fc domain of IgG, such as an Fc domain of at least one of IgG1, IgG2, IgG3 or IgG4, also preferably, the Fc is an Fc of human IgG, preferably, the Fc comprises N297A and / or N297G mutations.

26. The heavy chain antibody of claim 25, wherein the C-terminus of the Fc domain has or is linked to the amino acid sequence LPXTGGGHHHHHH as shown in SEQ ID NO.28, wherein X is any amino acid, preferably E, K, N, Q, A.

27. An activatable degrader for degrading membrane proteins, the activatable degrader comprising (1) a target molecule binding portion (TBM), the target molecule binding portion specifically binding to the membrane protein, and (2) the activatable transmembrane construct of any one of claims 1 to 11.

28. The activatable degrader of claim 27, wherein the target molecule binding portion comprises an antibody or an antigen binding fragment thereof, preferably, the antigen binding fragment is selected from Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH and any combination thereof.

29. The activatable degrader of claim 27 or 28, wherein the membrane protein is selected from PD-L1, PD-1, EGFR, HER-2 or a functional fragment thereof.

30. The activatable degrader of claim 27 or 28, wherein the target molecule binding portion comprises a plurality of tandem VHHs.

31. The activatable degrader of claim 27 or 28, wherein the target molecule binding portion is linked to the N-terminus of the activatable membrane-penetrating construct.

32. The activatable degrader of claim 28, wherein the antibody or antigen-binding fragment thereof has an Fc domain, preferably, the C-terminus of the Fc domain is connected to the cell-penetrating portion (CPM) of the activatable transmembrane construct, preferably, the C-terminus of the Fc domain is connected to the cell-penetrating portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO.58), wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and wherein X is any amino acid, preferably E, K, N, Q, A.

33. An activatable degrader for degrading PD-L1, the activatable degrader comprising (1) an antibody or antigen-binding fragment thereof according to any one of claims 12 to 17, or a heavy chain antibody according to any one of claims 18 to 26, and (2) an activatable transmembrane construct according to any one of claims 1 to 11.

34. The activatable degrader of claim 33, wherein the antibody or antigen-binding fragment thereof, or the heavy chain antibody has an Fc domain, preferably, the C-terminus of the Fc domain is connected to the cell-penetrating portion (CPM) of the activatable transmembrane construct, preferably, the C-terminus of the Fc domain is connected to the cell-penetrating portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO.58), wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and wherein X is any amino acid, preferably E, K, N, Q, A.

35. A nucleic acid molecule encoding the activatable transmembrane construct of any one of claims 1 to 11, the antibody or antigen-binding fragment thereof of any one of claims 12 to 17, the heavy chain antibody of any one of claims 18 to 26, or the activatable degradon of any one of claims 27 to 34.

36. A vector comprising the nucleic acid molecule of claim 35.

37. A cell comprising the nucleic acid molecule of claim 35 or the vector of claim 36.

38. A composition comprising the activatable transmembrane construct of any one of claims 1 to 11, the antibody or antigen-binding fragment thereof of any one of claims 12 to 17, the heavy chain antibody of any one of claims 18 to 26, the activatable degrader of any one of claims 27 to 34, the nucleic acid molecule of claim 35, the vector of claim 36 and / or the cell of claim 37, and a pharmaceutically acceptable carrier.

39. A method for treating a disease, the method comprising administering to a subject in need thereof a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to any one of claims 12 to 17, a heavy chain antibody according to any one of claims 18 to 26, an activatable degrader according to any one of claims 27 to 34, a nucleic acid molecule according to claim 35, a vector according to claim 36, or a pharmaceutical composition according to claim 38.

40. The method of claim 39, wherein the disease is a disease associated with the expression or overexpression of the membrane protein, preferably, the disease is cancer, and further preferably, the cancer is selected from squamous cell carcinoma (e.g., epithelial squamous cell carcinoma), lung cancer (including small cell lung cancer, non-small cell lung cancer, adenocarcinoma and squamous cell carcinoma of the lung), peritoneal cancer, hepatocellular carcinoma, gastric cancer (including gastrointestinal cancer and gastrointestinal stromal cancer), bone cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, urethral cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer or cervical cancer, salivary gland cancer, kidney cancer or ureteral cancer, prostate cancer, vaginal cancer, vulvar cancer, thyroid cancer, anal cancer, penile cancer, melanoma, bile duct cancer, central nervous system (CNS) tumors, spinal cord cancer, cervical cancer, uterine stenosis ... Axial tumors, brain stem gliomas, glioblastoma multiforme, astrocytomas, schwannomas, ependymomas, medulloblastomas, meningiomas, squamous cell carcinomas, pituitary adenomas and Ewing's sarcoma, superficial spreading melanoma, lentigo maligna melanoma, acral melanoma, nodular melanoma, multiple myeloma and B-cell lymphomas, chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), hairy cell leukemia, chronic myeloblastic leukemia and post-transplant lymphoproliferative disorder (PTLD), as well as abnormal vascular proliferation associated with phakomatoses, edema (such as associated with brain tumors) and Meigs syndrome, brain tumors and brain cancers, and head or neck cancers and related metastatic cancers.

41. A method for activating T cells, the method comprising using an anti-PD-L1 antibody or an antigen-binding fragment thereof linked to the activatable transmembrane construct of any one of claims 1 to 11.

42. The method of claim 41, wherein the antibody is a blocking antibody or a non-blocking antibody, and / or the antigen binding fragment is selected from Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH and any combination thereof.

43. The method of claim 41 or 42, wherein the antibody or antigen-binding fragment thereof has an Fc domain, preferably, the C-terminus of the Fc domain is connected to the cell-penetrating portion (CPM) of the activatable transmembrane construct, preferably, the C-terminus of the Fc domain is connected to the cell-penetrating portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO.58), wherein n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and wherein X is any amino acid, preferably E, K, N, Q, A.

44. The method of claim 41 or 42, wherein the antibody is selected from the antibody or antigen-binding fragment thereof of any one of claims 12 to 17, or the heavy chain antibody of any one of claims 18 to 26.

Images