Application of circular RNA (Ribonucleic Acid) in preparation of medicine for treating osteoarthritis

Abstract

The invention provides application of circular RNA in preparation of a medicine for treating osteoarthritis, the circular RNA is cZFP609, and the cZFP609 and BiP synergistically inhibit endoplasmic reticulum stress, promote ERMC complex formation, improve mitochondrial functions and recover lipid homeostasis so as to inhibit cartilage cell ferroptosis and slow down the progress of osteoarthritis; the human umbilical cord mesenchymal stem cell (hUC-MSC) modified by the cZFP609 has stronger cartilage protection and repair capability, and has important significance on the treatment of osteoarthritis.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and in particular to the application of circular RNA in the preparation of a drug for treating osteoarthritis. Background Art

[0002] Osteoarthritis (OA) is a chronic, degenerative disease that primarily affects weight-bearing joints, with typical pathological features of progressive degeneration of articular cartilage and sclerosis of subchondral bone. Data released by the World Health Organization show that the number of people suffering from osteoarthritis worldwide has exceeded 500 million. The total prevalence of osteoarthritis in my country is 15%, and conservative estimates put the number of patients at more than 150 million. The causes of osteoarthritis are relatively complex and are related to aging, obesity, excessive weight-bearing, and trauma, but the exact pathogenic mechanism is unclear. Therefore, there is a lack of strategies to effectively intervene in articular cartilage degeneration in the early stages of disease progression.

[0003] An important cause of osteoarthritis is the poor regeneration of cartilage. After articular cartilage is damaged, its self-healing ability is very limited. If the damage is not treated in time, it is easy to cause osteoarthritis, which will seriously endanger human health. Human umbilical cord mesenchymal stem cell (hUC-MSCs) treatment is a promising articular cartilage repair and regeneration technology, which promotes articular cartilage diseases into the era of cell therapy.

[0004] Circular RNA is a type of single-stranded circular RNA molecule produced by alternative splicing. It is widely expressed in eukaryotic cells and participates in regulating gene transcription, epigenetic modification, protein translation and signal transduction in the form of miRNA molecular sponges, molecular bridges or molecular chaperones. It plays an important role in cell function homeostasis, metabolic regulation and disease occurrence. Circular RNA can also be released through exosomes and paracrine to regulate the function of adjacent tissue cells. It is a new type of regulatory RNA that mediates cell-cell communication. At present, a variety of circular RNAs related to chondrocyte apoptosis and matrix degradation have been discovered, and the latter has shown unique translational application value in the diagnosis and prevention of clinical osteoarthritis.

[0005] Current studies have found that healthy vascular cells can specifically express and secrete a non-coding circular RNA - cZFP609, which has vascular protective function. It can not only inhibit vascular remodeling, but also regulate endothelial cell function through the exosome pathway. Knocking down cZFP609 expression can aggravate vascular stenosis. Importantly, the level of human plasma cZFP609 is significantly negatively correlated with the degree of vascular stenosis and ischemia.

[0006] However, there is no report on whether this circular RNA and its modified human umbilical cord mesenchymal stem cells (hUC-MSC) can be used in the treatment of osteoarthritis. Summary of the invention

[0007] The present application has been verified through research that circular RNA cZFP609 and hUC-MSC modified therewith can be used to treat and / or prevent osteoarthritis. Specifically,

[0008] In a first aspect, the present invention provides a use of a circular RNA in preparing a drug for treating and / or preventing osteoarthritis, wherein the circular RNA is cZFP609.

[0009] Preferably, the cZFP609 is overexpressed.

[0010] Preferably, the drug promotes the expression of cZFP609 and causes cZFP609 to be overexpressed in the diseased individual.

[0011] Preferably, the drug comprises cZFP609, cells expressing or secreting cZFP609 or cell exosomes, further preferably, the cells are stem cells, more preferably, the cells are human umbilical cord mesenchymal stem cells. Wherein, human umbilical cord mesenchymal stem cells expressing or secreting cZFP609 or their exosomes are human umbilical cord mesenchymal stem cells, hUC-MSCs and hUC-MSC-derived exosomes, hUC-MSC-Exo.

[0012] Preferably, the drug further comprises a pharmaceutically acceptable carrier.

[0013] For example, a viral expression vector can be used. The viral expression vector may contain a virally derived DNA or RNA sequence for packaging into a virus (e.g., a retrovirus (such as a lentivirus), a replication-defective retrovirus, an adenovirus, a replication-defective adenovirus, and an adeno-associated virus AAV). The virus and viral expression vector can be used in vitro, ex vivo, and / or in vivo.

[0014] Preferably, the cZFP609 reduces the sensitivity of osteoarthritis cartilage damage and promotes the protection of stem cells against osteoarthritis cartilage damage and degeneration.

[0015] Preferably, the cZFP609 maintains endoplasmic reticulum-mitochondrial homeostasis and regulates chondrocyte growth, metabolism and function.

[0016] Further preferably, the cZFP609 improves mitochondrial dysfunction and enhances chondrocyte viability.

[0017] More preferably, the cZFP609 maintains the mitochondrial morphology of chondrocytes, increases the copy number of mitochondrial DNA (mtDNA), improves ATP level and mitochondrial membrane potential, promotes cell proliferation activity, inhibits inflammatory aging, and promotes collagen synthesis.

[0018] More preferably, the cZFP609 inhibits the expression of aging and matrix degradation markers and promotes the expression of chondroprotective factors.

[0019] Preferably, the aging markers include multiple tumor suppressor 1 (MTS, p16), cyclin-dependent kinase inhibitor 1A (Cation chloride cotransporter-interacting protein 1, p21) and recombinant tumor protein p53 (p53), the matrix decomposition markers include interleukin-1beta (IL1-β) and matrix metallopeptidase 13 (MMP13), and the cartilage protection factors include sex determining region Y box protein 9 (Sex Determining Region Y Box Protein 9, Sox9) and type II collagen alpha 1 chain (Collagen, TypeII, Alpha 1, Col2a1).

[0020] Further preferably, the cZFP609 targets chondrocyte immunoglobulin binding protein (BiP) to inhibit endoplasmic reticulum stress. More preferably, the cZFP609 interacts with BiP, increases its binding to BiP, and regulates endoplasmic reticulum stress-related molecules. Further preferably, the endoplasmic reticulum stress-related molecules include inositol-dependent kinase 1α (Inositol Requiring Enzyme 1α, IRE1α), X-box Binding Protein 1Spliced ​​(XBP1S) and Activating Transcription Factor 4 (Activating Transcription Factor 4, ATF4), further preferably, the cZFP609 inhibits the dissociation of BiP and IRE1α and the phosphorylation activation of IRE1α, thereby promoting the downregulation of XBP1S and ATF4 expression, and the cZFP609 binds to BiP-IRE1α, thereby blocking the activation of the IRE1α-XBP1S pathway, thereby inhibiting inflammation-induced endoplasmic reticulum stress.

[0021] Preferably, the cZFP609 relieves the abnormal localization of BiP in mitochondria induced by inflammation.

[0022] More preferably, cZFP609 improves chondrocyte mitochondrial dysfunction by promoting the formation of endoplasmic reticulum-mitochondria contact (ER-Mito contact, ERMC).

[0023] More preferably, the cZFP609 increases the localization of vesicle-associated membrane protein B (VAPB) in mitochondria, promotes ERMC formation, promotes the increase of mitochondrial membrane potential, inhibits mitochondrial ROS generation, reduces mitochondrial fragmentation, and promotes ATP generation.

[0024] Preferably, cZFP609 inhibits chondrocyte ferroptosis,

[0025] Further preferably, chondrocyte oxidized lipids are reduced, and the expression of ferroptosis-related molecules is regulated.

[0026] More preferably, Fe 2+ The level of glutathione (GSH) was increased, and the lipid peroxide malondialdehyde (MDA) was reduced.

[0027] More preferably, the ferroptosis-related molecules include transferrin receptor (TFRC), long-chain fatty acid acyl-CoA synthetase 4 (Acyl-CoA Synthetase Long-Chain Family Member 4, ACSL4), cyclooxygenase-2 (Cyclooxygenase-2, COX2), ferritin heavy chain (FTH) and glutathione peroxidase 4 (GPX4). Further preferably, the cZFP609 inhibits the expression of TFRC, ACSL4 and COX2, and promotes the expression of FTH and GPX4.

[0028] Preferably, the cZFP609 comprises the nucleotide sequence shown in SEQ ID NO:1.

[0029] In a second aspect of the present invention, a pharmaceutical composition is provided, comprising cZFP609, cells or exosomes expressing or secreting cZFP609, and / or a pharmaceutically acceptable carrier.

[0030] For example, a viral expression vector can be used. The viral expression vector may contain a virally derived DNA or RNA sequence for packaging into a virus (e.g., a retrovirus (such as a lentivirus), a replication-defective retrovirus, an adenovirus, a replication-defective adenovirus, and an adeno-associated virus AAV). The virus and viral expression vector can be used in vitro, ex vivo, and / or in vivo.

[0031] Preferably, the cells are stem cells, and more preferably, the cells are human umbilical cord mesenchymal stem cells.

[0032] Preferably, the pharmaceutical composition has the characteristics of the drug or cZFP609 described in the first aspect.

[0033] The third aspect of the present invention provides a method for preventing and / or treating osteoarthritis, wherein the method comprises administering the above-mentioned pharmaceutical composition to a patient.

[0034] The term "include" or "comprising" in the present invention is an open description containing the specified components or steps described, and other specified components or steps that will not be substantially affected.

[0035] The "drug" of the present invention can be used to treat humans or non-human animals, such as non-human mammals. The drug can contain pharmaceutically acceptable carriers, excipients or salts commonly used in the prior art.

[0036] The drug can be administered by any suitable route, such as enteral administration (e.g. oral) or parenteral administration (e.g. intravenous, intramuscular, subcutaneous, intradermal, intraorgan, intranasal, intraocular, instillation, intracerebral, intrathecal, transdermal, intrarectal, etc.).

[0037] The drug can be in any suitable dosage form, such as a dosage form for gastrointestinal administration or a dosage form for parenteral administration, preferably including but not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, microemulsions, suspensions, injections, sprays, aerosols, powder sprays, lotions, ointments, plasters, pastes, patches, eye drops, nasal drops, sublingual tablets, suppositories, aerosols, effervescent tablets, pills, gels, etc. The various dosage forms of the drug can be prepared according to conventional production methods in the pharmaceutical field.

[0038] The term "pharmaceutically acceptable" as used herein refers to a substance that neither significantly irritates an organism nor inhibits the biological activity and properties of the active substance of the administered product.

[0039] The "method" described in the present invention may be for the purpose of diagnosis, treatment and / or prevention of a disease, or for the purpose of diagnosis, treatment and / or prevention of a non-disease.

[0040] The "individual" described in the present invention can be a human or a non-human mammal, and the non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, an experimental animal, etc. Preferably, the non-human mammal includes but is not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (such as rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0041] As used herein, "treating" means slowing, interrupting, preventing, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0042] The term "prevention" as used herein refers to a method implemented to prevent or delay the occurrence of a disease, disorder or symptom in an organism.

[0043] The present invention provides a new use of cZFP609 in the treatment and / or prevention of osteoarthritis, verifies the role of cZFP609 in chondrocyte degeneration and the occurrence of osteoarthritis; reveals that cZFP609 targets BiP to inhibit endoplasmic reticulum stress, thereby promoting ERMC formation and mitochondrial lipid homeostasis, and reversing the mechanism of inflammation-induced chondrocyte ferroptosis; by knocking down and overexpressing cZFP609, it is confirmed that cZFP609 is necessary for maintaining endoplasmic reticulum-mitochondrial homeostasis of chondrocytes and inhibiting lipid peroxidation-induced ferroptosis; explores the modulation of endoplasmic reticulum-mitochondrial homeostasis by remediating cZFP609, thereby constructing an early intervention strategy to prevent cartilage degeneration and delay the occurrence of OA. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 :The results of validation of the protective effect of cZFP609 on chondrocytes mediated by blood vessels. A is the expression of cZFP609 in chondrocytes (Chon) and vascular smooth muscle cells (VSMC) cultured in vitro, B is the expression of cZFP609 in chondrocytes treated with and untreated (Con) vascular smooth muscle cell exosomes (VSMC-Exo) cultured in vitro, C is VSMC-Exo treated and untreated (-), D is VSMC-Exo treated with knockdown of cZFP609 (sicZFP609) and control group (siCon), E is the expression of genes related to inflammatory senescence and matrix degradation in chondrocytes after VSMC-Exo treated with overexpression of cZFP609 and control group (Vector), and F is the expression level of plasma cZFP609 in normal control (Con) and osteoarthritis (OA) patients.

[0045] Figure 2: Transcriptomic analysis of chondrocytes overexpressing cZFP609. A and B are GO analysis of potential molecular pathways and biological processes, respectively, and C and D are KEGG analysis of potential molecular pathways and biological processes, respectively.

[0046] Figure 3 :The effects of overexpression of cZFP609 on mitochondrial morphology and function in chondrocytes. A is the result of MitoTracker staining, B is the copy number of mitochondrial DNA (mtDNA), C is the ATP level, D is the mitochondrial membrane potential, E is the result of bromodeoxyuridine (BrdU) incorporation (proliferation activity), and F is the electrophoresis result of p53, p21, MMP13, Sox9 and Col2a1.

[0047] Figure 4 : Mass spectrometry analysis results of proteins interacting with cZFP609 enriched by RNA pull-down. A is the protein enrichment integral, B is the conformation-based molecular docking simulation, C is the BiP RNA pull-down electrophoresis result, D is the RIP validation experiment result, and E and F are the in situ hybridization-immunofluorescence analysis (FISH) results (cZFP609 (red) is mainly distributed in the peripheral area (cytoplasmic area) of the cell nucleus (blue)).

[0048] Figure 5 :cZFP609 targets BiP in chondrocytes and inhibits ER stress. A is the BiP binding assay, B is the co-IP analysis result, C and D are the detection of cZFP609 inhibiting ER stress pathway.

[0049] Figure 6 :MitoTracker and VAPB immunofluorescence staining results. A and B are the effects of TNF-α and overexpression of cZFP609 on VAPB localization in mitochondria, C is the mitochondrial membrane potential result, D is the mitochondrial ROS result, E and F are the mitochondrial fragmentation results, and G is the ATP generation result.

[0050] Figure 7 :The effect of overexpression of cZFP609 on the mitochondrial localization of BiP induced by inflammation. A is the control and the control plus TNF-α, B is the vector plus TNF-α and overexpression of cZFP609 plus TNF-α.

[0051] Figure 8 :The effect of overexpression of cZFP609 on chondrocyte ferroptosis. A shows the changes in oxidized lipids in chondrocytes, B shows the status of ferroptosis-related molecules, C shows Fe 2+ The results of level changes, D is the results of GSH level changes, and E is the results of lipid peroxide MDA changes.

[0052] Fig. 9: Schematic diagram of the function of cZFP609.

[0053] Fig.10 : OA mice treated with hUC-MSC alone and Lenti cZFP609 / hUC-MSC. A is the pathological morphological analysis of the lesioned knee joint, B and C are the electron microscopy and electrophoresis images of p53, MMP13, Sox9 and Col2a1, respectively, D is the electrophoresis image of p16, p21, p53, IL-1β, MMP13, Sox9 and Col2a1, and E is the result of BrdU incorporation detection.

[0054] Fig.11 :The effects of Lenti cZFP609 hUC-MSC on chondrocyte ferroptosis. A and B are the results of the change of mechanical claw withdrawal threshold, and C and D are the results of the change of thermal claw withdrawal delay. DETAILED DESCRIPTION

[0055] In order to enable those skilled in the art to better understand the technical solutions in the present invention, the technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0056] Unless otherwise specified, the materials, reagents, instruments, etc. used in the following examples can be obtained from commercial sources. Example 1: Effect of cZFP609 on osteoarthritis

[0057] 1. Materials and methods

[0058] 1. Experimental Materials

[0059] The research techniques, experimental methods and animal models involved in this project have been mastered and possessed in previous work; the recombinant viral expression vectors (AAV-cZFP609, Lenti-cZFP609, etc.) and the recombinant lentiviral expression vectors (Lenti) of specific shRNA can effectively overexpress and knock down cZFP609. The cZFP609 used in this application is mouse circ ZFP609 (human homolog hsa_circ_ZNF609), and the specific sequence is as follows:

[0060] CAATGATGTTGTCCACTGGACATGTTCTGACCAAGGAGGCAGGTCTGAGAACG

[0061] TAGCTGAAGCTGAAAATAGGAAAGCTGGGGCAAGGAAGAGCCTTGAACCTTGAG

[0062] GTGGGACGTTGACTCTAAGATGTCCTTGAGCAGTGGAGCCTGCGGAGGGAAAGGA

[0063] GTGGATGCAAACCCGGTTGAGACATACGACAGTGGGGATGAATGGGACATTGGAG

[0064] TAGGGAACCTCATCATCGGACCTGGACGCCGATCTGGAAAAGGACCAGCAGAAACT

[0065] GGAAATGTCAGGCTCCAAGGAGGTGGGGATACCAGCCCCCAATGCTGTGGCCACA

[0066] CTACCAGACAACATCAAGTTTGTCACCCCAGTGCCAGGTCCTCAAGGGAAGGAAG

[0067] GCAAATCAAAATCCAAAAGGAGTAAGAGTGGCAAAGACGCTAGCAAGCCCACTCC

[0068] AGGGACTTCCTTGTTCTCTCCAAGTGAGGGAGCAGCCAGCAAGAAAGAGGTGCAG

[0069] GGTCGCGCAGGAGATGGTGCCAGTGCGGGAGGCCTGGTTGCTGCTGTTGCTCCCAA

[0070] GGGCTCAGAGAAGGCTGCTAAGGCGTCACGCAGTGTAGCTGGCTCCAAAAAGGAA

[0071] AAGGAGAACAGCTCATCTAAGGGCAAGAAGGAGAGAAGTGAAGGCGTGGGACT

[0072] TGTTCGGAAAAGGATCCTGGGGTCCTCCAGCCAGTTCCCTTGGGAGGACGGGGTAG

[0073] TCAGTATGATGGAAGTGCAGGGATGGACACAGGAACCGTGGAGCCGCTTGGGAGT

[0074] ATAGCTATTGAACCTGGGGCAGCGCTCAATCCTTTGGGAACTAAGCCGGAGCCAGA

[0075] GGAAGGGGAGAATGAGTGCCGGCCACTAAAGAAAGTCAAGTCTGAAAAG (SEQ ID NO: 1)

[0076] 2. Preparation and evaluation of osteoarthritis animal model

[0077] 2.1DMM surgery-induced osteoarthritis model: All operations were approved by the Experimental Animal Welfare Ethics Committee of Hebei Medical University.

[0078] After anesthesia and disinfection, SD rats or mice were anesthetized, and the medial side of the patellar ligament was cut with a surgical blade to expose the joint cavity; the fat pad between the femoral condyles was bluntly separated to expose the intercondylar area, and the medial meniscus tibial ligament was cut with a blade, and the tissue and skin were sutured. The samples were collected for observation after 5-6 weeks.

[0079] 2.2 Gene introduction or knockdown in blood vessels or joints: Inject smooth muscle-specific AAV-cZFP609 expression vector through the tail vein of mice; or inject recombinant lentiviral expression vector (Lenti) carrying target gene or specific shRNA into the hind limb joints of animals, and detect overexpression or knockdown efficiency after 3-4 weeks for use in experiments.

[0080] 2.3 Evaluation of OA model: The basal pain threshold of animals in each group was measured before modeling. After modeling, the mechanical paw withdrawal threshold (PWT) and thermal paw withdrawal latency (PWL) of the OA model were measured by Von Frey fibers and dynamic plantar tactile meter before modeling and on days 7, 14, 21, and 28 after modeling to evaluate mechanical and thermal allodynia.

[0081] 2.4 Knee joint pathological sections, H&E and Safranin O-Fast Green (SOFG) staining: The animals in each group were anesthetized and killed in turn. The right hind knee joints of the animals injected with the corresponding reagents were completely removed in turn by blunt separation using surgical instruments such as ophthalmic scissors and ophthalmic forceps, and placed in 1 mL of bone tissue decalcification solution for decalcification. The completely decalcified knee joint tissue was fixed with 4% paraformaldehyde at room temperature overnight, embedded in paraffin, cut into 10 μm thick slices, and stained with H&E and Safranin O-Fast Green to examine the changes in the tissue structure of the articular cartilage and subchondral bone.

[0082] 2.5 Evans blue staining:

[0083] In rat or mouse osteoarthritis model, EBD (100 mg / kg) was injected intraperitoneally 1 day before sacrifice, and the cartilage was quickly frozen and embedded in OCT; frozen sections (7 mm thick) were fixed in ice methanol for 5 minutes, incubated with Hoechst 33342 for 10 minutes, and observed under a confocal microscope after washing with PBS.

[0084] 3. Articular Chondrocyte Culture and Treatment

[0085] 3.1 Chondrocyte culture and treatment: One-month-old mice or SD rats were selected and the hind limb articular cartilage was isolated under anesthesia. The cartilage tissue was cut into 0.3-0.5 mm 3 The tissue blocks were digested with 0.25% trypsin at 37°C to remove the residual connective tissue; 0.02% type II collagenase was added for digestion, the cells were separated, filtered with a 200-mesh filter, and centrifuged at 1500 r / min; the supernatant was discarded, and the cells were resuspended in DMEM culture medium containing 10% FBS and cultured in a CO2 incubator. Cells of passage 5-8 were used for experiments.

[0086] The cells were grown to 90% confluence, pre-incubated with serum-free medium for 24 h, treated with TNFα (10 ng / mL) for different time periods, and collected for detection; or VSMC exosomes were isolated and treated with cells, and cells cultured in serum-free medium for the corresponding time were used as controls.

[0087] Human articular cartilage tissue removed during surgery was used to isolate, culture and process chondrocytes for verification.

[0088] 3.2 Target gene overexpression or knockdown: Recombinant lentiviral expression vectors expressing cZFP609 or specific shRNA were constructed to infect chondrocytes to achieve target gene overexpression or knockdown. 2x10 9 The pfu / mL virus amount was determined according to standard methods, and the overexpression or knockdown efficiency was detected by RT-PCR, with the empty virus vector as a control.

[0089] 3.3 Primary vascular smooth muscle cell culture and exosome isolation: The thoracic and abdominal aorta of mice were taken to isolate and culture primary vascular smooth muscle cells. After the cells were grown to confluence in low-glucose DMEM containing 10% FBS, the culture medium was collected, and the exosomes were isolated using the CSB-EI0102 exosome extraction kit, resuspended in DMEM, and treated with chondrocytes.

[0090] 3.4 Human umbilical cord mesenchymal stem cell culture and cZFP609 overexpression: Take the umbilical cord of a healthy pregnant woman after full-term delivery and immerse it in 75% alcohol for 20 seconds for surface disinfection. After that, wash it twice with normal saline, separate the two umbilical arteries and the opened umbilical vein and discard them. Further separate the jelly in the middle (Wharton's jelly), cut the jelly into small pieces of 2-3mm3 with ophthalmic scissors, transfer it to a T75 cell culture flask and spread it evenly. Add 5mL of Youkang GMP-grade mesenchymal stem cell culture medium to the other side of the culture flask for primary culture. The cells are passaged after growing to 85% fusion. Take Lenti-cZFP609 (2x10 9 pfu / mL) infected cells, and 48 hours later, the expression level of cZFP609 was detected by RT-PCR. Mesenchymal stem cells or their exosomes modified by cZFP609 at passages 4-5 were taken and injected into the joint cavity of the hind limbs of mice.

[0091] 4. Chondrocyte Behavior Analysis

[0092] 4.1CCK8 analysis: Detect cell viability. Inoculate the cell suspension in a 96-well plate (100 cell wells). Place the culture plate in an incubator for a period of time (37 hours (incubation time); add 10μ0CCK-8 solution to each well; incubate the culture plate in the incubator for 1-4 hours; measure the absorbance at 450nm with an enzyme-labeled instrument.

[0093] 4.2 Cell counting: Use a cell counter to detect proliferation activity.

[0094] 4.3 Cell cycle progression and apoptosis analysis: detected by flow cytometry.

[0095] 4.4 BrdU incorporation: Detect proliferation activity according to the kit instructions.

[0096] 4.5TUNEL staining: Cell apoptosis analysis was performed according to the kit instructions.

[0097] 5. Analysis of protein expression, localization, post-translational modification and aggregation / disaggregation state

[0098] 5.1 Western blot analysis: Detect changes in the expression or phosphorylation levels of the target protein in the cell; non-denaturing PAGE and Western blot analysis are used to determine the polymerization / depolymerization state of the target protein (BiP).

[0099] 5.2 Real-time quantitative RT-PCR: Detect gene transcription activity.

[0100] 5.3 Immunofluorescence-laser confocal analysis: detect the expression and subcellular localization of proteins in cells.

[0101] 5.4 Immunohistochemical staining: Detect the expression of proteins in cartilage tissue.

[0102] 6. Protein-protein interaction analysis

[0103] 6.1 Immunoprecipitation and Western blot analysis: Anti-tag antibodies or target protein-specific antibodies were used to detect the interaction between two target proteins in cells; whole cell lysate was used as a positive control (Input).

[0104] 6.2 Immunofluorescence double staining and laser confocal microscopy observation: Morphological confirmation of the co-localization of interacting proteins in cells.

[0105] 7. Analysis of the interaction between cZFP609 and BiP

[0106] 7.1 RNA pull-down analysis: 10 7 cells, washed with cold PBS, and lysed with 500 μL co-IP buffer; 3 μg of biotinylated DNA oligonucleotide (Oligo) probe targeting cZFP609 was added and incubated at room temperature for 2 hours; 50 μL of washed streptavidin C1 magnetic beads were added to the binding reaction and incubated at room temperature for 1 hour; the magnetic beads were washed 5 times with co-IP buffer; the protein (BiP) bound to the magnetic beads was analyzed by Western blot.

[0107] 7.2 RIP analysis (RNA binding protein immunoprecipitation): cells were grown to a density of 70-80%, washed with cold PBS, and lysed with 500 μL co-IP buffer; 5 μg of primary antibody (anti-BiP antibody) was added and incubated at 4°C for 2 hours; 40 μL of protein A agarose beads were added and incubated at 4°C for 4 hours; the beads were washed 3 times with PBS and resuspended in 0.5 mL Tri Reagent; the co-precipitated RNA was eluted and qRT-PCR was performed with primers to detect the content of cZFP609 bound to BiP.

[0108] 8. Analysis of Mitochondrial Morphology and Function

[0109] 8.1 Mitochondrial morphology observation: MitoTracker staining. Dilute with serum-free culture medium GreenFM probes (Invitrogen, M7514) were added to a final concentration of 20 nM in the staining working solution. The cell culture medium was removed, and an appropriate amount of staining working solution was added. The cells were incubated at 37°C for 20 minutes. The staining working solution was removed, and the cells were washed with PBS. The slides were sealed with DAPI (Invitrogen, P36962) and observed under a Leica SP5 laser confocal microscope. Mitochondrial morphology was analyzed using Image J software.

[0110] 8.2mtDNA copy number: mtDNA copy number was detected by qPCR using nuclear DNA as a reference according to standard methods.

[0111] 8.3 ATP level detection: Use ATP detection kit (Beyotime Biotechnology, S0026) to detect intracellular ATP level.

[0112] 8.4 Analysis of mitochondrial ROS generation: A reactive oxygen species detection kit (Beyotime Biotechnology, S0033S) was used to detect the level of intracellular reactive oxygen species.

[0113] 8.5 Mitochondrial membrane potential detection: Mitochondrial membrane potential was detected using the Mitochondrial Membrane Potential Detection Kit (JC-1) (Beyotime Biotechnology, C2003S).

[0114] 8.6 Mito-FerroGreen staining: detection of mitochondrial Fe 2+ level.

[0115] 8.7C11-BODIPY staining: detection of lipid peroxides.

[0116] (II) Experimental results

[0117] 1. Determination of the source of cZFP609 in cartilage tissue of Sm22α-KO mice and the correlation between aggravated osteoarthritis damage and decreased plasma cZFP609 expression

[0118] Studies have shown that contractile VSMCs and their exosomes highly express cZFP609. To determine the source of cZFP609 in mouse cartilage tissue and whether aggravated OA damage is associated with reduced smooth muscle cZFP609 expression, the expression of cZFP609 in chondrocytes (Chon), vascular smooth muscle cells, and chondrocytes treated with vascular smooth muscle cell exosomes (VSMC-Exo) cultured in vitro was detected. qRT-PCR showed that endogenous expression of cZFP609 was low in chondrocytes, while in primary VSMCs (contractile) ( Figure 1 A) and its exosomes (VSMC-Exo)-treated chondrocytes highly expressed ( Figure 1 B), indicating that cZFP609 expressed in cartilage tissue in vivo is of vascular origin; VSMC-Exo can inhibit inflammation-induced chondrocyte inflammatory senescence and matrix degradation-related gene expression ( Figure 1 C); The anti-inflammatory senescence effect of VSMC-Exo in which cZFP609 was knocked down was abolished ( Figure 1D); while overexpression of cZFP609 can inhibit inflammatory senescence and matrix degradation ( Figure 1 E); Moreover, the plasma cZFP609 level in patients with clinical osteoarthritis was significantly lower than that in healthy people ( Figure 1 F). These results suggest that cZFP609 may play a protective role against cartilage damage and degeneration in osteoarthritis.

[0119] 2. Study on potential molecular pathways and biological processes mediating the chondroprotective effect of cZFP609

[0120] In order to identify the potential molecular pathways and biological processes that mediate the chondroprotective effect of cZFP609, chondrocytes were transduced with lentiviral expression vectors expressing cZFP609 (Lenti-cZFP609) and empty vectors, and transcriptome sequencing was performed after TNF-α treatment. Bioinformatics analysis showed that there were 216 differentially expressed genes in chondrocytes overexpressing cZFP609; GO analysis showed that upregulated genes were mainly enriched in processes such as muscle system, contraction response, mechanical stimulation, and transmembrane transport regulation; while downregulated genes were enriched in processes related to development and inflammation, such as germ cell development, cell hypoxia response, NF-κB signaling positive regulation, and cell cycle progression ( Figure 2 A); Endoplasmic reticulum and mitochondrial metabolism and function are the main biological processes regulated by cZFP609 ( Figure 2 B). KEGG pathway analysis showed that cZFP609 significantly upregulated pathways such as amino acid metabolism, glycolysis / gluconeogenesis, and growth factor synthesis and secretion; whereas pathways such as multiple neurodegenerative diseases, diabetic cardiomyopathy, and oxidative phosphorylation were downregulated ( Figure 2 C); Interestingly, ferroptosis is one of the major pathways regulated by cZFP609 ( Figure 2 D). The above-mentioned omics analysis strongly suggests that cZFP609 may play a positive regulatory role in chondrocyte growth, metabolism and function by maintaining endoplasmic reticulum-mitochondrial homeostasis.

[0121] 3. Effects of overexpression of cZFP609 on mitochondrial morphology and function in chondrocytes

[0122] To further verify the results of transcriptomic analysis, Lenti-cZFP609 was used to infect chondrocytes cultured in vitro to overexpress cZFP609 and examine the effects on chondrocyte mitochondrial morphology and function. MitoTracker staining showed that mitochondrial morphology of TNF-α-treated chondrocytes was significantly abnormal, showing dot-like and fragment-like structures; while overexpression of cZFP609 could reverse the abnormal mitochondrial morphology of TNF-α-induced chondrocytes, showing normal rod-like and network-like structures ( Figure 3 A), increase mtDNA copy number ( Figure 3 B) to increase ATP levels ( Figure 3C) and mitochondrial membrane potential ( Figure 3 D); promote cell proliferation activity ( Figure 3 E); inhibit inflammatory aging and promote collagen synthesis ( Figure 3 F). These results suggest that exogenous cZFP609 can improve mitochondrial dysfunction and enhance chondrocyte viability.

[0123] 4. Confirmation of molecular targets regulated by cZFP609

[0124] In order to further identify the molecular targets regulated by cZFP609, RNA pull-down was used to enrich the proteins interacting with cZFP609 for mass spectrometry analysis. The results showed that endoplasmic reticulum (ER)-bound immunoglobulin (BiP) had the highest score among the enriched proteins ( Figure 4 A); Molecular docking simulation based on conformation ( Figure 4 B) RNA pull-down Figure 4 C) and RIP( Figure 4 D) Analysis and verification consistently confirmed that cZFP609 interacted with BiP; in situ hybridization-immunofluorescence analysis (FISH) showed that overexpressed cZFP609 was mainly distributed in the cytoplasm of chondrocytes ( Figure 4 E) and colocalized with BiP ( Figure 4 F).

[0125] Further studies showed that overexpression of cZFP609 increased its binding to BiP ( Figure 5 A); co-IP analysis confirmed that cZFP609 could inhibit the dissociation of BiP and stress sensor molecule IRE1α induced by TNF-α ( Figure 5 B) and phosphorylation activation of IRE1α ( Figure 5 C. Figure 5 D), accompanied by downregulation of XBP1S and ATF4 expression ( Figure 5 C. Figure 5 D); This suggests that cZFP609 may inhibit inflammation-induced ER stress by binding to BiP-IRE1α and thereby blocking the activation of the IRE1α-XBP1S pathway.

[0126] 5. cZFP609-BiP promotes endoplasmic reticulum-mitochondria contact (ERMC) formation and inhibits chondrocyte ferroptosis

[0127] Given that ERMC is an important structure for communication between the endoplasmic reticulum and mitochondria, in order to reveal the relationship between cZFP609 binding to BiP, inhibiting endoplasmic reticulum stress and improving mitochondrial function, the effect of overexpression of cZFP609 on ERMC formation was examined. VAPB (ER) -PTPIP51 (OMM) is the main pathway for mediating lipid transport from the endoplasmic reticulum to mitochondria. VAPB is an endoplasmic reticulum marker protein for ERMC formation. MitoTracker and VAPB immunofluorescence staining were used to show ERMC formation. The results showed that TNF-α could significantly reduce the localization of VAPB in mitochondria ( Figure 6 A); overexpression of cZFP609 increased the localization of VAPB in mitochondria and promoted the formation of ERMC ( Figure 6 B), accompanied by an increase in mitochondrial membrane potential ( Figure 6 C), decreased mitochondrial ROS production ( Figure 6 D), mitochondrial fragmentation was significantly reduced ( Figure 6 E. Figure 6 F), increased ATP production ( Figure 6 G). Overexpression of cZFP609 can reduce the abnormal localization of BiP in mitochondria induced by inflammation ( Figure 7 The results suggest that cZFP609 may improve inflammation-induced mitochondrial dysfunction and oxidative stress by promoting ERMC formation.

[0128] Mitochondrial dysfunction can lead to the accumulation of oxidized lipids, which is an important mechanism for inducing ferroptosis. According to transcriptomics, cZFP609 regulates ferroptosis-related cellular processes. Preliminary experiments found that TNF-α-treated chondrocytes increased oxidized lipids ( Figure 8 A); the expression of ferroptosis-related molecules TFRC / ACSL4 / COX2 increased, and the expression of FTH / GPX4 decreased ( Figure 8 B);Fe 2+ Increased levels ( Figure 8 C); GSH level decreased ( Figure 8 D); lipid peroxide MDA increased ( Figure 8 E); Overexpression of cZFP609 can eliminate oxidized lipids and Fe 2+ cZFP609 can reverse the decrease of GSH and increase of lipid peroxides caused by inflammation, and inhibit chondrocyte ferroptosis. The results of transcriptomic analysis were verified, suggesting that cZFP609 inhibits chondrocyte ferroptosis by improving mitochondrial function.

[0129] Based on the above preliminary experimental results, it can be speculated that cZFP609 and BiP synergistically inhibit ER stress, promote the formation of the ERMC complex VAPB (ER)-PTPIP51 (OMM), improve mitochondrial function, restore lipid homeostasis, and thus inhibit chondrocyte ferroptosis and slow down OA progression. Related processes such as Fig. 9 shown.

[0130] Example 2c Application of ZFP609 in the treatment of osteoarthritis

[0131] By constructing a lentivirus-cZFP609 (Lenti-cZFP609) expression vector and infecting human umbilical cord mesenchymal stem cells (hUC-MSC), hUC-MSC (cZFP609 / MSC) with stable and high expression of cZFP609 were obtained, and its exosomes contained abundant cZFP609. Subsequently, it was injected into the knee joint cavity of the DMM-induced osteoarthritis mouse model. After 4 weeks, pathological morphological analysis of the diseased knee joints showed that compared with the osteoarthritis lesions of the control (hUC-MSC-treated mice alone), mice treated with cZFP609 / MSC showed significantly reduced cartilage loss, increased cartilage thickness, clear tide lines, smooth cartilage surface, and significantly reduced cartilage destruction and synovitis ( Fig.10 A); The expression of inflammatory senescence-related genes in articular cartilage of mice treated with cZFP609 / MSC was decreased ( Fig.10 BD), increased proliferation activity ( Fig.10 E), indicating that cZFP609 / MSCs have stronger cartilage regeneration and repair capabilities and articular cartilage protection than simple MSCs.

[0132] Compared with control mice (NS and MSC), cZFP609 / MSC-treated mice (cZFP-MSC) in the osteoarthritis model showed increased pain in the pricking and heat pain domains ( Fig.11 A, B); Four weeks after modeling (28 days), the pain threshold of mice in the cZFP609 / MSC group was close to the normal control level ( Fig.11 C, D), suggesting that cZFP609 / MSC can improve the pain symptoms of osteoarthritis.

[0133] Conclusion: Lenti-cZFP609 / hUC-MSC is an effective new cell therapy for OA.

[0134] Although the present invention has been described in detail by way of preferred embodiments, the present invention is not limited thereto. Without departing from the spirit and essence of the present invention, a person of ordinary skill in the art may make various equivalent modifications or substitutions to the embodiments of the present invention, and such modifications or substitutions shall be within the scope of the present invention. Any person of ordinary skill in the art may easily conceive of changes or substitutions within the technical scope disclosed by the present invention, and such changes or substitutions shall be within the scope of protection of the present invention.

Claims

1. Use of a circular RNA in the preparation of a drug for treating and / or preventing osteoarthritis, characterized in that: The circular RNA is cZFP609.

2. The use according to claim 1, characterized in that: The cZFP609 was overexpressed.

3. The use according to any one of claims 1-2, characterized in that: The drug includes cZFP609, cells expressing or secreting cZFP609, or cell exosomes. Preferably, the cells are stem cells. More preferably, the cells are human umbilical cord mesenchymal stem cells.

4. The use according to any one of claims 1 to 3, characterized in that: The cZFP609 reduces the sensitivity of osteoarthritis cartilage damage and promotes the protection of stem cells against osteoarthritis cartilage damage and degeneration.

5. The use according to claim 4, characterized in that: The cZFP609 maintains endoplasmic reticulum-mitochondria homeostasis and regulates chondrocyte growth, metabolism and function.

6. The use according to claim 5, characterized in that: The cZFP609 improves mitochondrial dysfunction and enhances chondrocyte viability; Preferably, the cZFP609 maintains the mitochondrial morphology of chondrocytes, increases the mtDNA copy number, improves the ATP level and mitochondrial membrane potential, promotes cell proliferation activity, inhibits inflammatory aging, and promotes collagen synthesis; Further preferably, the cZFP609 inhibits the expression of aging and matrix degradation markers, and promotes the expression of chondroprotective factors; more preferably, the aging markers include p16, p21 and p53, the matrix degradation markers include IL1-β and MMP13, and the chondroprotective factors include Sox9 and Col2a1.

7. The use according to claim 5, characterized in that: The cZFP609 targets chondrocyte BiP and inhibits endoplasmic reticulum stress; Preferably, the cZFP609 interacts with BiP, increases its binding with BiP, and regulates endoplasmic reticulum stress-related molecules. Further preferably, the endoplasmic reticulum stress-related molecules include IRE1α, XBP1S and ATF4. More preferably, the cZFP609 inhibits the dissociation of BiP and IRE1α and the phosphorylation activation of IRE1α, thereby promoting the downregulation of XBP1S and ATF4 expression.

8. The use according to claim 5, characterized in that: The cZFP609 relieves the inflammation-induced abnormal localization of BiP in mitochondria.

9. The use according to claim 5, characterized in that: cZFP609 improves chondrocyte mitochondrial dysfunction by promoting ERMC formation; Preferably, the cZFP609 increases the localization of VAPB in mitochondria, promotes the formation of ERMC, promotes the increase of mitochondrial membrane potential, inhibits the generation of mitochondrial ROS, reduces mitochondrial fragmentation, and promotes ATP generation.

10. The use according to claim 4, characterized in that: cZFP609 inhibits chondrocyte ferroptosis; Preferably, oxidized lipids in chondrocytes are reduced, and the expression of ferroptosis-related molecules is regulated; More preferably, Fe 2+ levels decreased, GSH levels increased, and lipid peroxide MDA decreased; Further preferably, the ferroptosis-related molecules include TFRC, ACSL4, COX2, FTH and GPX4. More preferably, the cZFP609 inhibits the expression of TFRC, ACSL4 and COX2, and promotes the expression of FTH and GPX4.

Images