Application of beta-hexosaminidase inhibitor in preparation of medicine for treating nerve injury

Abstract

The invention provides an application of a beta-hexosaminidase subunit Beta (Hexb) inhibitor in preparation of a medicine for treating diseases related to proliferation and differentiation of oligodendroglia cells, and particularly provides an application of the beta-hexosaminidase subunit Beta (Hexb) inhibitor in preparation of the medicine for treating the diseases related to proliferation and differentiation of the oligodendroglia cells. Researches find that expression of Hexb is up-regulated after rat spinal cord injury and is closely related to proliferation and differentiation of oligodendroglia precursor cells, and interference on expression of Hexb can obviously promote differentiation of the oligodendroglia precursor cells into mature oligodendroglia cells. Further research results show that in-vivo injection of Hexb siRNA can promote motor function recovery after rat spinal cord hemitomy injury. The invention provides a new drug choice for treatment after spinal nerve injury.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the use of a β-hexosaminidase (Hexosaminidase Subunit Beta, Hexb) inhibitor in the preparation of a drug for treating nerve damage. Background Art

[0002] Spinal cord injury often leads to permanent impairment of patients' motor and sensory functions, seriously affecting the quality of life of patients and their families. Systematic and comprehensive research on the physiological and pathological processes of spinal cord injury and exploration of the cellular and molecular mechanisms involved are essential for developing new and effective treatment strategies. Under normal circumstances, healthy myelin tissue forms a dense multi-layer insulating membrane around the axons, promoting the rapid transmission of electrical signals and metabolism of axons. After spinal cord injury, a large amount of myelin is lost, and the number of oligodendrocytes decreases by more than 90% within a week. The loss of myelin further aggravates functional impairment and axon reduction. Studying the regulation and molecular mechanisms of oligodendrocytes after spinal cord injury will open up new avenues for the treatment of spinal cord injury, which is of great significance and value.

[0003] Hexb (Hexosaminidase Subunit Beta) is a protein-coding gene that encodes the beta subunit of the lysosomal enzyme hexosaminidase, which catalyzes the degradation of gangliosides. Mutations in the Hexb gene lead to the accumulation of GM2 gangliosides in neurons and neurodegenerative diseases, known as GM2 gangliosidosis. There are currently no reports of Hexb in nerve damage. Summary of the invention

[0004] The present invention discloses for the first time that the expression of β-hexosaminidase encoding gene Hexb is upregulated after spinal cord injury in rats and is closely related to the proliferation and differentiation of oligodendrocyte precursor cells, and has the potential to become a new target for the repair of spinal cord nerve injury.

[0005] The specific technical solutions of the present invention are as follows:

[0006] Use of a β-hexosaminidase inhibitor in preparing medicines for diseases related to oligodendrocyte proliferation and differentiation.

[0007] The β-hexosaminidase NCB1 Reference Sequence of the present invention is: NM_001011946.2.

[0008] In the application described in the present invention, the inhibitor is a negative regulator of β-hexosaminidase or its encoding gene, including protein inhibitors targeting β-hexosaminidase, nucleic acid aptamers and / or interfering RNA, gRNA, microRNA, small molecule compound inhibitors of the β-hexosaminidase encoding gene and inhibitors of the above combinations.

[0009] In a specific example of the present invention, the negative regulator is siRNA targeting β-hexosaminidase gene.

[0010] The sequence of the siRNA of the β-hexosaminidase gene is as follows:

[0011] si Hexb-1 positive strand: 5'GATAAGGGAAAGACTGGTC3', SEQ ID NO: 1;

[0012] si Hexb-1 antisense strand: 5'GACCAGTCTTTCCCTTATC3', SEQ ID NO: 2;

[0013] si Hexb-2 positive strand: 5'TGTTGTATTTAGACTTGGG3', SEQ ID NO: 3;

[0014] si Hexb-2 antisense strand: 5'CCCAAGTCTAAATACAACA3', SEQ ID NO: 4;

[0015] si Hexb-3 positive strand: 5'TGTACAAGTAGAGAATAGG3', SEQ ID NO: 5;

[0016] si Hexb-3 antisense strand: 5'CCTATTCTCTACTTGTACA3', SEQ ID NO:6.

[0017] In the application of the present invention, the disease related to oligodendrocyte proliferation and differentiation is nerve injury, neurodegenerative disease or cancer. Preferably, the central nervous system injury is spinal cord injury.

[0018] The present invention uses sequencing technology to find that Hexb is upregulated after spinal cord injury in rats. The results of qRT-PCR showed that compared with 0d, the expression of Hexb increased significantly 1d after injury. Targeting the full-length sequence of Hexb, siRNA was designed and siRNA interference experiments were performed. EdU staining results showed that interfering with the expression of Hexb significantly inhibited the proliferation of oligodendrocyte precursor cells. The results of in vitro differentiation experiments showed that interfering with the expression of Hexb significantly promoted the differentiation of oligodendrocyte precursor cells into mature oligodendrocytes. In vivo injection of Hexb siRNA can promote the recovery of motor function after hemisection of the spinal cord in rats. The research results of the present invention show that Hexb can regulate the proliferation and differentiation of oligodendrocytes in the process of spinal cord injury repair, which not only helps to better understand the important role of Hexb in the repair process of central nervous system injury, but more importantly, it provides new targets for the treatment of spinal cord nerve injury. β-hexosaminidase inhibitors can become a new choice of drugs for the treatment of spinal cord nerve injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is Example 1, the expression changes of Hexb in the spinal cord tissue of rats after spinal cord injury at different time points (GAPDH is used as the internal reference).

[0020] Figure 2 This is the effect of Hexb siRNA1-3 interference on Hexb expression in primary OPC cells after 48 hours of Example 2 (GAPDH was used as the internal reference).

[0021] Figure 3 This is the effect of siRNA3 (si Hexb) interference of Hexb on the proliferation of oligodendrocyte precursor cells in Example 2. The EdU results show that the proliferation of oligodendrocyte precursor cells decreased after si Hexb treatment. Left: EdU representative images; right: statistical analysis chart.

[0022] Figure 4 The effect of siRNA3 (si Hexb) of Hexb in Example 2 on the differentiation and maturation of oligodendrocyte precursor cells. A: The result of differentiation experiment to detect the differentiation of oligodendrocyte precursor cells after si Hexb treatment. B and C: Statistical analysis of Figure A. D and E: qRT-PCR results of differentiation experiment to detect the mRNA expression of mature oligodendrocyte markers Mog and Ndrg1 after si Hexb treatment.

[0023] Figure 5 This is Example 3. Effect of Hexb siRNA3 on the recovery of motor function in rats with hemisection spinal cord injury. The results of hindlimb BBB scores at different time points after SCI in rats showed that the BBB scores of rats in the si Hexb group were higher than those in the NC group starting one week after spinal cord injury. n=6. DETAILED DESCRIPTION

[0024] The specific steps of the present invention are described below by way of examples, but are not limited to the examples.

[0025] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art.

[0026] The present invention is further described in detail below in conjunction with specific examples and with reference to data. It should be understood that this embodiment is only for illustrating the present invention and is not intended to limit the scope of the present invention in any way.

[0027] In the following examples, various processes and methods not described in detail are conventional methods well known in the art.

[0028] The present invention is further described below in conjunction with specific embodiments.

[0029] Example 1 Investigating the expression changes of Hexb after spinal cord injury in adult rats

[0030] 1. Rat spinal cord hemisection injury model

[0031] Forty adult female SPF SD rats were intraperitoneally injected with compound anesthetics (85 mg / kg chloral hydrate, 42 mg / kg magnesium sulfate, 17 mg / kg sodium pentobarbital, Shanghai Lingfeng Chemical Reagent Co., Ltd., Shanghai, China). After the rats were fully anesthetized, a longitudinal incision was made at T9-T10 to separate the muscles and fascia. The T9 lamina was trimmed to expose the spinal cord, and the right spinal cord was transected with an iris knife (Beaver-Visitec International, Waltham, USA). After surgery, the rats were placed on a 37°C constant temperature electric blanket until they were fully awake. After surgery, ibuprofen suspension was used for analgesia, penicillin was used for anti-inflammatory treatment, and clean feeding conditions and sufficient water and feed were provided.

[0032] 2. RNA extraction and qRT-PCR of spinal cord tissue

[0033] A combined anesthetic (85 mg / kg chloral hydrate, 42 mg / kg magnesium sulfate, 17 mg / kg sodium pentobarbital, Shanghai Lingfeng Chemical Reagent Co., Ltd., Shanghai, China) was injected intraperitoneally. The distal spinal cord tissue within 5 mm of the injury site was collected at various time points after spinal cord injury in rats. Total RNA was extracted from spinal cord tissue using TRIzol reagent (Gibco, New York, USA), and then reverse transcribed into complementary DNA by HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China). qRT-PCR was performed using AceQ qPCR SYBR Green Master Mix (Vazyme) in a StepOne Real-Time PCR System (Applied Biosystems, California, USA) (GAPDH was used as an internal reference). PCR instrument reaction program: Stage 1: 95℃5min, Stage 2 (Cycle: 40): 95℃30s, 60℃30s; Stage 3: 95℃15s, 60℃1min, 95℃15s.

[0034] The sequences of Hexb primers are as follows: Hexb-F: 5'AGGCGTTTCGGCGATATTACA3'; Hexb-R: 5'CACACTGCGGTTCGAGGTTA3'. The qRT-PCR results are shown in Figure 1 As shown, the results showed that compared with 0d, Hexb expression in spinal cord nerve tissue continued to upregulate after injury, with the highest expression level at 7d after injury.

[0035] Example 2 Effects of Hexb on the proliferation and differentiation of oligodendrocyte precursor cells

[0036] 1. Culture of primary oligodendrocyte precursor cells

[0037] The spinal cord of red-skinned mice one day after birth was separated and transferred to a culture dish containing separation buffer (DMEM). Under a microscope, the dura mater was peeled off to separate the cerebral cortex and transferred to another culture dish containing separation buffer (DMEM). The tissue was washed with separation buffer (DMEM / F12) and the tissue was cut into pieces with surgical scissors. Add 2 ml of 0.25% trypsin in the digestive solution and digest at 37°C for 30 minutes. Shake several times every 15 minutes and filter the cell suspension through a 30μm filter. Then, according to the manufacturer's instructions, A2B5 MACS magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany) were used to isolate primary oligodendrocyte precursor cells. An appropriate amount of cells was inoculated into a culture flask and placed in a 5% CO2 constant temperature cell culture incubator (37°C) for culture. Fresh culture medium was replaced after 1 day, and the medium was replaced after 2 days and the growth of cells was observed under a microscope. Subsequent experiments were carried out when the oligodendrocyte precursor cells grew to 95% density.

[0038] 2. Transfection of primary oligodendrocyte precursor cells

[0039] The cultured primary oligodendrocyte precursor cells were digested with 0.25% trypsin, and the digestion was terminated with complete medium, and washed twice with PBS; the cells were resuspended in opti-MEM and mixed with Hexb siRNA, and mixed thoroughly to finally reach 10 in every 100 μl of the mixed suspension. 5 The cells and 10 μl of siRNA (concentration: 40 μM) were transfected with 90 μl of cell suspension and 10 μl of siRNA suspension. Cells transfected with siRNA for 24 h were used for further experiments.

[0040] Hexb siRNA and control were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. The Hexb siRNA sequence used was:

[0041] si Hexb-1 positive strand: 5'GATAAGGGAAAGACTGGTC3', SEQ ID NO: 1;

[0042] si Hexb-1 antisense strand: 5'GACCAGTCTTTCCCTTATC3', SEQ ID NO: 2;

[0043] si Hexb-2 positive strand: 5'TGTTGTATTTAGACTTGGG3', SEQ ID NO: 3;

[0044] si Hexb-2 antisense strand: 5'CCCAAGTCTAAATACAACA3', SEQ ID NO: 4;

[0045] si Hexb-3 positive strand: 5'TGTACAAGTAGAGAATAGG3', SEQ ID NO: 5;

[0046] si Hexb-3 antisense strand: 5'CCTATTCTCTACTTGTACA3', SEQ ID NO:6.

[0047] Transfection reagent Lipofectamine TM RNAiMAX was produced by Invitrogen (Invitrogen, Carlsbad, CA, USA), and cell transfection was performed according to the instruction manual.

[0048] 3. RNA extraction, reverse transcription and qRT-PCR of primary oligodendrocyte precursor cells

[0049] Primary oligodendrocyte precursor cells were transfected with Hexb specific siRNA and its control siRNA Negative Control (NC), and the cells were collected 24h or 48h later. RNA of primary oligodendrocyte precursor cells was extracted according to the instructions of Reagent (Invitrogen), reverse transcribed, and qRT-PCR was performed in the same manner as described in Example 1. The results are shown in Figure 2 As shown, after 24 hours of siRNA treatment, Hexb siRNA1-3 can significantly interfere with the expression of Hexb in primary oligodendrocyte precursor cells.

[0050] 4. EdU cell proliferation assay

[0051] Primary oligodendrocyte precursor cells were transfected with si Hexb-3 (si Hexb, SEQ ID No: 5, 6) specific for Hexb and its control (NC) respectively, and the cells were cultured at 1×10 5 The density of each well was inoculated into a 24-well plate pre-coated with poly-L-lysine (Sigma-Aldrich, USA). After culturing for 24 h, the EdU cell proliferation assay was performed according to Cell-Light EdU Apollo567 In VitroKit (100T) (Guangzhou Ruibo Biotechnology Co., Ltd.). The results of the EdU assay are shown in Figure 3 As shown, the bar graph shows the proliferation rate of primary oligodendrocyte precursor cells after siRNA interference with Hexb. Compared with the control group, EdU staining results showed that the expression of the interference gene Hexb significantly inhibited the proliferation of primary oligodendrocyte precursor cells.

[0052] 5. Primary oligodendrocyte precursor cell differentiation experiment

[0053] Primary oligodendrocyte precursor cells were transfected with siHexb-3 specific for Hexb and its control (NC) and inoculated with 1×10 5 Cells were added to 24-well plates and cultured for 24 hours before replacing the differentiation medium: 1×B27, 1×N2, 20 ng / mL CNTF, 40 ng / mL T3, 20 ng / mL bFGF, 10 ng / mL IGF and 1% penicillin / streptomycin. The cells were fixed with 4% paraformaldehyde and stained with MBP (Abcam, ab7349, Cambridge, MA, USA) for fluorescence staining. The cells were photographed and counted. Figure 4 As shown in AC, siHexa and siHexb treated OLs showed more synapses that extended further and had a more robust myelin protein network compared to negative controls. Figure 4 DE qRT-PCR results showed that the mRNA expressions of mature myelin markers Mog and Ndrg1 in oligodendrocytes treated with si Hexb were higher than those in the control group.

[0054] Example 3 Effect of Hexb on the restoration of motor function in hemisection spinal cord injury

[0055] 1. Experiment on functional restoration of rat spinal cord hemisection

[0056] Twelve adult female SPF SD rats were randomly divided into si NC group and si Hexb-3 group, 6 rats in each group, and the right spinal cord hemisection surgery of the rats was performed according to the method in the above Example 1. The rats after the hemisection of the spinal cord were fixed with a stereotaxic instrument, the injury site was observed under a microscope, and 3 symmetrical points were selected at the proximal and distal ends of the injury for injection of siNegative Control (PBS dissolved to 1nmol / μL) or si Hexb-3 (PBS dissolved to 1nmol / μl), and the 3 points were located at 0.2mm, 0.55mm, and 1.75mm depths under the dura mater, respectively. 0.17μl was injected at each depth, and the injection was stopped for 2min at each point after the injection was completed. After the operation, the rats were placed on a 37°C constant temperature electric blanket until they were fully awake. After the operation, ibuprofen suspension was used for analgesia, penicillin was used for anti-inflammatory treatment, and clean feeding conditions and sufficient water and feed were provided.

[0057] 2. BBB scoring of rat hind limb motor function

[0058] One day after the right spinal cord hemisection surgery, the rats were placed on an open platform and allowed to crawl freely. Two people performed BBB scoring under double-blind conditions. A BBB score of 0 on the right hind limb one day after the injury was considered effective. Scoring was performed once a week for a total of 4 weeks, and the scoring results were finally included in the statistics as the average score. Figure 5The results of the hind limb BBB scores at different time points after SCI in rats showed that the BBB scores of rats in the si Hexb group were higher than those in the NC group 1 week after SCI, suggesting that Hexb inhibitors can be used to treat SCI.

Claims

1. The use of β-hexosaminidase inhibitors in the preparation of drugs for diseases related to oligodendrocyte proliferation and differentiation.

2. The use according to claim 1, characterized in that The inhibitor is a negative regulator of β-hexosaminidase or its encoding gene.

3. The use according to claim 2, characterized in that The negative regulators include protein inhibitors targeting β-hexosaminidase, nucleic acid aptamers and / or interfering RNA, gRNA, microRNA, small molecule compound inhibitors of β-hexosaminidase encoding genes, and inhibitors of the above combinations.

4. The use according to claim 3, characterized in that The negative regulator is siRNA and / or vector-based shRNA targeting the β-hexosaminidase gene.

5. The use according to claim 4, characterized in that The siRNA sequence of the β-hexosaminidase gene is as follows: si Hexb-1 positive strand: 5'GATAAGGGAAAGACTGGTC3', SEQ ID NO: 1; si Hexb-1 antisense strand: 5'GACCAGTCTTTCCCTTATC3', SEQ ID NO: 2; si Hexb-2 positive strand: 5'TGTTGTATTTAGACTTGGG3', SEQ ID NO: 3; si Hexb-2 antisense strand: 5'CCCAAGTCTAAATACAACA3', SEQ ID NO: 4; si Hexb-3 positive strand: 5'TGTACAAGTAGAGAATAGG3', SEQ ID NO: 5; si Hexb-3 antisense strand: 5'CCTATTCTCTACTTGTACA3', SEQ ID NO:

6.

6. The use according to claim 1, characterized in that The disease associated with oligodendrocyte proliferation and differentiation is nerve damage, neurodegenerative disease or cancer.

7. The use according to claim 6, characterized in that The nerve damage is central nervous system damage.

8. The use according to claim 7, characterized in that The central nervous system injury is spinal cord injury.

Images