Nucleic acid aptamer specifically combined with imatinib as well as screening and application of nucleic acid aptamer

Abstract

Imatinib is a common anti-cancer drug for clinically treating leukemia and gastrointestinal stromal tumor, the treatment window of imatinib is narrow (1-5 mu M), and different patients have different sensitivity and drug resistance to Ima, so that the plasma concentration of the patients needs to be monitored in time to ensure the curative effect, reduce complications and realize precise medical treatment. However, the traditional detection method is slow and tedious, so that it is necessary to improve and innovate a platform for clinically monitoring the Ima blood concentration. The invention designs a sensor based on a nano-porous electrochemical aptamer (E-AB), which is used for detecting the concentration of Ima in blood. The aptamer Apt-37 with high affinity and large conformation is screened out through molecular docking simulation calculation and circular dichroism and is used for constructing an E-AB sensor. The sensor can be used for detecting the Ima in a range of 0.1 mu M-1 mM. The results show that the developed E-AB sensor is an effective tool for rapidly monitoring the Ima blood concentration.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection and analysis, and particularly relates to a nucleic acid aptamer specifically binding to an anticancer drug imatinib and an application thereof. Background Art

[0002] Imatinib (Ima) is a small molecule protein tyrosinase inhibitor and is currently a targeted drug used to treat chronic myeloid leukemia and acute lymphoblastic leukemia and advanced gastrointestinal stromal tumors. Imatinib and its salts (Ima-S), such as imatinib mesylate or imatinib hydrochloride, are oral drugs in tablets or capsules that block multiple protein kinases and are used to treat patients with chronic myeloid leukemia or malignant gastrointestinal stromal tumors; the current standard clinical dose of Ima-S is 400-600 mg / d, but some clinical trials have shown that blood concentrations of Ima-S ≤ 1000 ng / mL (1.7 μM) are at risk of insufficient drug exposure, which can lead to delayed treatment and inhibit disease progression in patients; if used for a few years, when the blood concentration of Ima-S ≥ 3180 ng / mL (5.4 µM) may increase the risk of drug toxicity and increase the risk of adverse blood events in patients, so it is crucial to reasonably control the patient's blood drug Ima-S exposure concentration. In addition, due to the large individual differences among patients and the large differences in their tolerance to Ima-S, detecting the patient's blood drug concentration and providing the patient with a suitable drug concentration window are of great significance for achieving clinical individualized and precise treatment.

[0003] The existing methods for detecting Ima-S blood concentration usually include liquid chromatography-mass spectrometry (LC-MS), high performance liquid chromatography (HPLC), and gas chromatography-mass spectrometry (GC-MS). However, these methods have certain limitations, such as complex sample pretreatment, long detection time, high instrument cost, and high requirements for detection personnel. In recent years, researchers have also developed some other alternative detection methods, such as surface-enhanced Raman scattering (SERS) sensing platforms and electrochemical sensors based on material bases, but the material preparation steps of these sensors are cumbersome, and the stability and selectivity are poor. Therefore, developing a new detection method that is cheap to operate, selective, sensitive and stable is a huge challenge currently faced.

[0004] In the field of biosensors, the selection of target recognition elements is crucial. Antibodies and aptamers, as indispensable molecular recognition elements of biosensors, have the advantages of good specificity and high sensitivity. Compared with aptamers, antibodies have many limitations, such as high production cost, large batch-to-batch variation, susceptibility to temperature and irreversibility. In contrast, aptamers have the characteristics of high stability, low environmental interference, long storage time, and easy modification; further, as a single-stranded oligonucleotide, aptamers can bind to various targets, such as small molecules, proteins, cells and even tissues, and have a wider range of applications. In view of the above advantages of aptamers, they have been widely used by researchers in the fields of bioanalysis and biomedicine, and have become an excellent substitute for antibodies. At the same time, electrochemical aptamer (E-AB) sensors that combine aptamers and electrochemistry not only have the advantages of aptamers, but also have the advantages of electrochemistry, such as short analysis time, no need for expensive and complex instruments, and easy operation. Summary of the invention

[0005] The purpose of the present invention is to provide a nucleic acid aptamer specifically binding to imatinib and the screening and application thereof.

[0006] To achieve the above object, the present invention adopts the following technical solution: A nucleic acid aptamer that specifically binds to imatinib, wherein the nucleic acid aptamer is one of Apt-51, Apt-37, Apt-35, Apt-33, and Apt-27; The nucleotide sequence of Apt-51 is: CTATGTGAGGCTCGATCGTTCGGTGTGTTTTTAAAGGGTACAGATCCTGGG; The nucleotide sequence of Apt-37 is: ATCCACGCTCTTTTTCTCGCATTGAGGGTGACATAGG; The nucleotide sequence of Apt-35 is: TCCACGCTCTTTTTCTCGCATTGAGGGTGACATAG; The nucleotide sequence of Apt-33 is: CCACGCTCTT TTTCTCGCATTGAGGGTGACATA; The nucleotide sequence of Apt-27 is: CTTTTTCTCCCCCCGCGGGGGGGCATTG.

[0007] The above-mentioned method for screening nucleic acid aptamers comprises the following steps: (1) Shortening design: Apt-100 is subjected to a two-dimensional structure shortening design to destroy the original double-stranded stem structure and increase its free energy; the nucleotide sequence of Apt-100 is ATCCACGCTCTTTTTCTCCCCCCGCTATGTGAGGCTCGATCGTTCGGTGTGTTTTTAAAGGGTACAGATCCTGGGCGGGGGGCATTGAGGGTGACATAGG; (2) Molecular docking simulation: A nucleotide sequence having a binding energy with imatinib less than that of the nucleic acid aptamer Apt-100 is screened out from step (1) by molecular docking simulation calculation, wherein the nucleotide sequence is any one of the nucleic acid aptamers Apt-51, Apt-37, Apt-35, Apt-33, and Apt-27; (3) Circular dichroism test: The nucleic acid aptamer obtained in step (2) is combined with imatinib and its salts, and the nucleic acid aptamer having the maximum change value of the positive characteristic peak at 280 nm before and after the combination is screened out by circular dichroism test; the nucleic acid aptamer includes the nucleotide sequence of Apt-37.

[0008] Application of the above nucleic acid aptamer in detecting imatinib and its salts.

[0009] An electrochemical nucleic acid aptamer sensor comprises nucleic acid aptamer Apt-37.

[0010] Furthermore, the 3' end of the nucleic acid aptamer is modified with a disulfide bond, and the 5' end is modified with methylene blue.

[0011] The preparation method of the electrochemical nucleic acid aptamer sensor comprises the following steps: (1) Preparation of nanoporous gold electrode: 1.5 M ZnCl 2 The benzyl alcohol solution was heated to 125 ℃, and a three-electrode system was constructed, in which the working electrode was a gold electrode, the reference electrode was Ag / AgCl, and the counter electrode was a platinum wire. The three-electrode system was placed in the benzyl alcohol solution and CV scanning was performed. The obtained gold electrode was then placed in acetone, ethanol, and deionized water for ultrasonic cleaning in sequence, and then immersed in 0.5 M HCl solution for dealloying treatment. Finally, the gold electrode was electrochemically cleaned and activated to obtain a nanoporous gold electrode.

[0012] (2) Assembly of electrochemical nucleic acid aptamer sensor: The thiolated nucleic acid aptamer is assembled on the surface of the nanoporous gold electrode, and a blocking agent is added to occupy the excess sites. The sensor is then rinsed and stored in a phosphate buffer solution.

[0013] Furthermore, the blocking agent in step (2) is any one of 6-mercapto-1-hexanol, 2-mercaptoethanol, cysteamine hydrochloride, sodium diethyldithiocarbamate, and bovine serum albumin.

[0014] An application of the above-mentioned nucleic acid aptamer and the above-mentioned electrochemical nucleic acid aptamer sensor in detecting imatinib and its salts.

[0015] The above application specifically includes the following steps: (1) Basic sample test: The electrochemical nucleic acid aptamer sensor was placed in the biological sample solution to be tested together with the reference electrode Ag / AgCl and the counter electrode platinum wire as the working electrode, and the square wave voltammetric current signal I was tested under low frequency and high frequency conditions without imatinib and its salts. blank ; (2) Establishing a concentration-response curve: adding different concentrations of imatinib and its salts to the biological sample solution to be tested in step (1), and testing the square wave voltammetric current signal I of the biological sample solution containing different concentrations of imatinib and its salts under low frequency and high frequency conditions respectively. target , by calculating the gain signal S = (I target –I blank ) / I blank ×100%; or by kinetic difference KDM signal (D) = S 高频 –S 低频 , calculating the KDM signal (D) at different concentrations; establishing a concentration-response curve of the electrochemical nucleic acid aptamer sensor according to the relationship between the signal gain S or the KDM (D) and the concentration; (3) Determination of calibration parameters: The concentration-response curve obtained in step (2) is fitted using the Hill equation to determine the calibration parameter K of the electrochemical nucleic acid aptamer sensor. 1 / 2 , Y start , Y end , n; the Hill equation is:

[0016] Wherein, Y is S or D; (4) Unknown sample concentration test: The calibration parameter K obtained in step (3) is 1 / 2 , Y start , Y end , n is substituted into the Hill equation again to quantitatively detect the concentration of the unknown sample.

[0017] 10. The application according to claim 6, characterized in that the low frequency condition is 5 Hz and the high frequency condition is 100 Hz.

[0018] The beneficial effects of the present invention are: (1) The present invention performs a two-dimensional structural shortening design on Apt-100 to screen nucleic acid aptamers Apt-51, Apt-37, Apt-35, Apt-33 and Apt-27 whose binding energy with Ima is lower than that of Apt-100. Among them, Apt-37 has the advantages of high affinity and large conformation. The electrochemical aptamer sensor prepared using the nucleic acid aptamer has good selectivity and low sensitivity, with a detection range of 0.1 μM-1000 μM and a detection limit of 0.1 μM, which meets the narrow effective blood drug concentration window (1-5 μM) for clinical detection of Ima.

[0019] (2) Compared with detection technologies based on large instruments, the sensor preparation method is simple and easy to operate. It can directly detect Ima in the blood and quickly obtain results, making it suitable for on-site testing. This provides a method for clinical monitoring of Ima blood concentrations in different patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : Schematic diagram of docking simulation of different aptamers before and after binding to Ima.

[0021] Figure 2 : CD graphs of the screened aptamers Apt-51 (A), Apt-37 (B), Apt-35 (C), Apt-33 (D) and Apt-27 (E) before and after binding with different concentrations of Ima; a is 0 μM Ima + aptamer, b is 50 μM Ima + aptamer; c is 100 μM Ima + aptamer; d is 200 μM Ima + aptamer, e: 200 μM Ima).

[0022] Figure 3 : (A) Aptamer tailoring design process and (B) aptamer Apt-37 was used to construct the Ima-S electrochemical aptasensor.

[0023] Figure 4 : Signal gain with and without target Ima at frequencies 5-500 Hz.

[0024] Figure 5 :(A) SWV curves at 5 Hz after adding different concentrations of Ima into serum; (B) SWV curves at 100 Hz after adding different concentrations of Ima into serum; (C) Concentration-gain signal response curves of different concentrations of Ima in serum; (D) Recovery curve of Ima in serum measured by E-AB sensor.

[0025] Figure 6: Selectivity test of E-AB sensor in serum, the concentrations of Ima and interferents were 500 µM and 10 mM, respectively (interferents included: kanamycin, oxaliplatin, cisplatin, daunorubicin).

[0026] Figure 7 :(A) SWV curves at 5 Hz after adding different concentrations of Ima into the blood; (B) SWV curves at 100 Hz after adding different concentrations of Ima into the blood; (C) Concentration-gain signal response curves of different concentrations of Ima in the blood; (D) Recovery curve of Ima in blood measured by E-AB sensor.

[0027] Figure 8 : Selectivity test of E-AB sensor in blood, the concentrations of Ima and interferents were 500 µM and 10 mM, respectively (interferents included: kanamycin, oxaliplatin, cisplatin, daunorubicin). DETAILED DESCRIPTION

[0028] The following examples are further elaborations of the present invention. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0029] Screening of imatinib aptamers: The original chain of the existing imatinib aptamer Apt-100 has 100 bases, and its secondary structure free energy is -12.67 kcal / mol (Table 1). The structure is relatively stable, which does not meet the experimental principle requirements of the E-AB sensor based on conformational changes. Therefore, the sequence of the nucleic acid aptamer Apt-100 is re-shortened and designed, and the bases are sheared to destroy the double-stranded stem structure of the nucleic acid aptamer, reduce its stability, and facilitate the formation of the unfolded state of the nucleic acid aptamer, and increase the conformational changes of the nucleic acid aptamer when it binds to Ima. Therefore, the original chain of Apt-100 is shortened and designed into Apt-51, Apt-37, Apt-35, Apt-33 and Apt-27 (Table 1); as the nucleic acid aptamer is truncated, the free energy of its secondary structure increases, thereby destroying the structure of Apt-100 and making it easy to undergo conformational changes. However, this may increase the binding energy between the aptamer and the target, leading to thermodynamic instability and reduced affinity. Molecular docking simulations were performed on the binding of six aptamers to Ima ( Figure 1), the results showed that the binding energies of aptamers Apt-100, Apt-51, Apt-37, Apt-35, Apt-33 and Apt-27 were -9.5 kcal / mol, -8.0 kcal / mol, -10.7 kcal / mol, -8.6 kcal / mol, -6.2 kcal / mol and -9.8 kcal / mol, respectively. Among them, the binding energy of aptamer Apt-37 with Ima was the lowest, which ensured its high affinity, and the high free energy also provided the possibility of large conformational changes.

[0030] Table 1 Predicted secondary structures and free energies of different nucleic acid aptamers

[0031] To determine the rationality of the aptamer design, circular dichroism (CD) was used to further study the conformational changes of different aptamers after binding to Ima. Unmodified aptamers (Apt-51, Apt-37, Apt-35, Apt-33, and Apt-27) were first diluted to 6 μM with phosphate buffer solution (pH 7.4), heated in a 95 °C incubator for 5 minutes, and then rapidly cooled at room temperature. Finally, different concentrations of Ima were added to make the final Ima concentrations of 50 μM, 100 μM, and 200 μM, respectively. The group without Ima was used as the control group, and the solution was used for CD testing (parameters were 5 mdeg sensitivity, 50 nm / min scanning speed, 2 nm bandwidth, and 1 nm data spacing). Figure 2 The CD experimental results in the results show that the nucleic acid aptamer Apt-37 has positive and negative characteristic peaks near 280 nm and 245 nm, respectively, indicating that the nucleic acid aptamer is a typical B-type DNA. The DNA base stacking forms a positive cotton effect peak, and its helical structure forms a negative cotton effect peak. In the presence of the target Ima, the positive characteristic cotton effect peak at a wavelength of 280 nm changed significantly, indicating that the binding of the nucleic acid aptamer Apt-37 to Ima caused a significant conformational change. Compared with the nucleic acid aptamer Apt-37, the positive and negative characteristic peaks of Apt-51, Apt-35, Apt-33 and Apt-27 after binding to Ima changed less at 280 nm and 245 nm.

[0032] The detection principle of the present invention: Figure 3Schematic diagram of the screening process for aptamer tailoring and the use of aptamer Apt-37 to construct an E-AB sensor. The best aptamer Apt-37 was modified with disulfide bonds and methylene blue (MB) at both ends (modified by Sangon Biotech (Shanghai) Co., Ltd.), and then fixed on the surface of a nanoporous gold electrode to construct an electrochemical aptamer (E-AB) sensor. After the addition of Ima, the aptamer undergoes a significant conformational transition, the distance between the redox reporter molecule MB and the electrode surface becomes smaller, the electron transfer rate is accelerated, the square wave voltammetry (SWV) signal is enhanced, and the SWV signal increases with the increase of Ima concentration, so that the relationship curve between the signal gain (S) and the Ima concentration can be obtained. Based on this, the aptamer sensor can be used to detect Ima in different biological samples (serum and blood).

[0033] Calculate the signal gain (S) using the following equation: (Formula 1) Among them I target and I blank is the square wave voltammetric peak current with and without Ima at a frequency of 5 Hz-500 Hz. The signal gain is calculated as follows: Figure 4 .

[0034] Alternatively, kinetic difference analysis (KDM) can be used to correct for baseline drift in complex biological samples.

[0035] (Formula 2) Shigh and Slow represent the signal gains obtained at high frequencies (15-500 Hz) and low frequencies (5-15 Hz), respectively.

[0036] Establishing a concentration-response curve of the electrochemical aptamer sensor according to the relationship between the signal gain (S) or KDM signal (D) and the concentration obtained above; The obtained concentration-signal response curve is fitted by the Hill equation to obtain the relevant parameters of the sensor. The Hill equation is as follows: (Formula 3) (Formula 4) Wherein, Y is S or D; Where n represents the Hill coefficient; D start and D end Respectively represent the minimum and maximum values ​​of KDM (D) signal. 1 / 2is the midpoint of the concentration-response curve. Substituting the KDM signal into the rearranged form of Equation 3 (Equation 4), the target concentration can be calculated.

[0037] Example 1 Based on the nucleic acid aptamer Apt-37, an electrochemical method is used to detect imatinib (Ima) in serum. The steps are as follows: (1) Preparation of nucleic acid aptamer sensors First, nanoporous gold electrodes were prepared by electrochemical alloying / dealloying technology. 2 The benzyl alcohol solution (1.5 M) was heated to 125 °C, and a three-electrode system (working electrode: gold electrode, reference electrode: Ag / AgCl, counter electrode: platinum wire) was placed in it, and 50 CV scans were performed (scanning range was -0.72-1.88 V, and the scanning rate was 0.01 V / s). The gold electrode was then ultrasonically cleaned in acetone, ethanol, and deionized water in sequence, and the gold electrode was immersed in 0.5 M HCl solution for dealloying. Finally, the gold electrode was electrochemically cleaned (0.5 M NaOH, CV scan, potential -0.35 V to -1.35 V, scanning rates were 4 V / s and 2 V / s, respectively, and the number of cycles was 200 and 1000, respectively) and activated (0.5 MH 2 SO 4 , CV scan, potential 0.2 V to 1.6 V, scan rates 2 V / s and 0.1 V / s, cycle 20 times), to obtain a nanoporous gold electrode for subsequent use.

[0038] Tris(2-carboxyethyl)phosphine (9 μL, 10 mM) was added to the nucleic acid aptamer Apt-37 (1 μL, 100 μM) and incubated at room temperature in the dark for 1 hour to reduce the disulfide bond modified by the aptamer, and then 90 μL of phosphate buffer solution (pH 7.4) was added to dilute the aptamer to 1 μM, and then diluted to 50 nM with phosphate buffer (pH 7.4). The nanoporous gold electrode was placed in the 50 nM aptamer solution and incubated at room temperature in the dark for 1 hour to fix the aptamer on the electrode surface through the Au-S bond self-assembled monolayer, and then placed in 3 mM blocking agent mercaptohexanol and incubated at room temperature in the dark for one hour to occupy the excess sites on the electrode surface. Finally, it was rinsed with deionized water to obtain the nucleic acid aptamer electrochemical sensor, which was stored in phosphate buffer solution (pH 7.4).

[0039] (2) Electrochemical detection of imatinib in serum Constructing a three-electrode system: using the nucleic acid aptamer electrochemical sensor obtained in step (1) as the working electrode, Ag / AgCl as the reference electrode, and platinum wire as the counter electrode to form a three-electrode system; S1: Test of basic samples: The three-electrode system was placed in serum without imatinib (purchased from Merck), and square wave voltammetry (SWV) scanning was performed at frequencies of 100 Hz and 5 Hz (scan range 0-0.45 V). The SWV response signal of serum without imatinib was obtained as blank I blank ; S2: Establishment of concentration-response curve: Different concentrations of Ima (final concentrations of 0, 0.1, 0.5, 1, 5, 10, 50, 100, 500 and 1000 μM) were added to the serum, and square wave voltammetry (SWV) scanning was performed at 100 Hz and 5 Hz (scanning range 0-0.45 V), respectively. Figure 5 A and 5B, obtain I target The signal gain (S) at different concentrations was calculated using Formula 1, and the concentration-response curves at frequencies of 100 Hz and 5 Hz were obtained by fitting the Hill equation (Formula 3). Figure 5 C), the experimental parameter K of the calibration curve was determined 1 / 2 , D start , D end , n (respectively: 35 μM, 3.87 %, 213.62 %, 0.95).

[0040] S3: Determination of calibration parameters: In order to further increase the E-AB sensor signal gain and reduce K 1 / 2 , and further calculate KDM (D) at different concentrations by kinetic difference. The concentration-response curve is obtained by fitting it with the Hill equation (Formula 3), and the parameter K of the calibration curve is determined at the same time. 1 / 2 , D start , D end, n (respectively: 29 μM, 5.41 %, 291.71 %, 0.70).

[0041] S4: Test of unknown sample concentration: Use the sensor to detect a serum sample with unknown Ima concentration. Place the electrode in the sample to be tested and test to obtain a KDM (D) of 50%. 1 / 2 , D start , D end , n (respectively: 29 μM, 5.41%, 291.71%, 0.70), by substituting into equation (4), Ima and [C Target ] was 2.59 μM.

[0042] S5: Recovery test: Add different concentrations of Ima to undiluted serum, and then perform the same experimental steps as S1 and S2 to obtain Ima. blank and I targetBy calculating the signal gain and KDM value of different concentrations of Ima, the known parameter K 1 / 2 , D start , D end , n (respectively: 29 μM, 5.41%, 291.71%, 0.70), by substituting into equation (4), Ima and [C Target ] concentration, the recovery curve can be obtained by linear fitting the Ima concentration calculated according to the calibration curve and the Ima concentration actually tested.

[0043] S6: Selectivity test: Kanamycin, oxaliplatin, cisplatin, and daunorubicin were selected as interfering substances, and the same experimental steps as S1 and S2 were performed to obtain the signal gain and KDM values ​​of Ima (500 μM) and interfering substances (10 mM).

[0044] Figure 5 The detection range of imatinib in serum was 0.1 μM-1000 μM, the detection limit was 0.1 μM, and the recovery rate was 78.7%-109.6%.

[0045] Figure 6 In order to test the selectivity of the E-AB sensor, the signal gain of the sensor in 500 μM Ima serum solution was high, while the signal gain of the interferent was very low, which proved that the E-AB sensor had good selectivity.

[0046] Example 2 Detection of Imatinib in Blood by Electrochemical Aptamer Sensor (1) Preparation process of nucleic acid aptamer electrochemical sensor The synthesis steps of the nanoporous gold electrode are the same as those in Example 1.

[0047] The aptamer Apt-37 (1 μL, 100 μM) was added to tri(2-carboxyethyl)phosphine (9 μL, 10 mM) and incubated at room temperature in the dark for 1 hour to reduce the disulfide bond modified by the aptamer. Then 90 μL of phosphate buffer solution (pH 7.4) was added to dilute the above aptamer to 1 μM, and then phosphate buffer (pH 7.4) was added to dilute to 50 nM. The nanoporous gold electrode was placed in the 50nM aptamer solution and incubated at room temperature in the dark for 1 hour to fix the aptamer on the electrode surface through the Au-S bond self-assembled monolayer; then placed in 3 mM blocking agent mercaptohexanol and incubated at room temperature in the dark for one hour to occupy the excess sites on the electrode surface. Finally, it was rinsed with deionized water to obtain the nucleic acid aptamer electrochemical sensor, which was stored in a buffer solution (pH7.4).

[0048] (2) Electrochemical detection of imatinib in blood Constructing a three-electrode system: using the nucleic acid aptamer electrochemical sensor obtained in step (1) as the working electrode, Ag / AgCl as the reference electrode, and platinum wire as the counter electrode to form a three-electrode system; S1: Test of basic samples: The three-electrode system was placed in blood without imatinib (purchased from Zhengzhou Pingrui Biology), and square wave voltammetry (SWV) scanning was performed at frequencies of 100 Hz and 5 Hz (scanning range 0-0.45 V). The SWV response signal of blood without imatinib (Ima) was obtained as blank I blank ; S2: Establishment of concentration-response curve: Different concentrations of imatinib (Ima) (final concentrations 0, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 1500 μM) were added to blood (bovine blood, Zhengzhou Pingrui Biological), and square wave voltammetry (SWV) scanning was performed at 100 Hz and 5 Hz (scanning range 0-0.45 V), respectively. Figure 7 A and 7B, obtain I target The gain (S) at different concentrations was calculated using Formula 1, and the concentration-response curves ( Figure 7 C), the experimental parameter K of the calibration curve was determined 1 / 2 , D start , D end , n (respectively: 59 μM, 8.82 %, 161.72 %, 0.88).

[0049] S3: Determination of calibration parameters: In order to further increase the E-AB sensor signal gain and reduce K 1 / 2 . KDM (D) at different concentrations was calculated by kinetic difference. The concentration-response curve was obtained by fitting it with the Hill equation (Formula 3) and the parameter K of the calibration curve was determined. 1 / 2 , D star t, D end , n (respectively: 40 μM, 20.40 %, 233.05 %, 0.81).

[0050] S4: Testing of unknown sample concentration: Use the sensor to detect a blood sample with unknown imatinib (Ima) concentration. Place the electrode in the sample to be tested and test to obtain a KDM (D) of 50%. 1 / 2 , D start , D end , n (respectively: 40 μM, 20.40%, 233.05%, 0.81), by substituting into equation (4), we can calculate imatinib (Ima) and [CTarget ] was 4.22 μM.

[0051] S5: Recovery test: Add different concentrations of Ima to undiluted blood, and then perform the same experimental steps as S1 and S2 to obtain Ima. blank and I target By calculating the signal gain and KDM value of different concentrations of Ima, the known parameter K 1 / 2 , D start , D end , n (respectively: 40 μM, 20.40%, 233.05%, 0.81), by substituting into equation (4), Ima and [C Target ] concentration, the recovery curve can be obtained by linear fitting the Ima concentration calculated according to the calibration curve and the Ima concentration actually tested.

[0052] S6: Selectivity test: Kanamycin, oxaliplatin, cisplatin, and daunorubicin were selected as interfering substances, and the same experimental steps as S1 and S2 were performed to obtain the signal gain and KDM values ​​of Ima (500 μM) and interfering substances (10 mM).

[0053] Figure 7 The results of Ima test in blood are as follows: the detection range is 0.1 μM-1000 μM, the detection limit is 0.1 μM, and the recovery rate is 74.8%-113.9%.

[0054] Figure 8 In order to test the selectivity of the E-AB sensor, the signal gain of the sensor in 500 μM Ima blood solution was high, while the signal gain of the interferent was very low, which proved that the E-AB sensor had good selectivity.

[0055] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A nucleic acid aptamer that specifically binds to imatinib, characterized in that: The nucleic acid aptamer is one of Apt-51, Apt-37, Apt-35, Apt-33, and Apt-27; The nucleotide sequence of Apt-51 is: CTATGTGAGGCTCGATCGTTCGGTGTGTTTTTAAAGGGTACAGATCCTGGG; The nucleotide sequence of Apt-37 is: ATCCACGCTCTTTTTCTCGCATTGAGGGTGACATAGG; The nucleotide sequence of Apt-35 is: TCCACGCTCTTTTTCTCGCATTGAGGGTGACATAG; The nucleotide sequence of Apt-33 is: CCACGCTCTT TTTCTCGCATTGAGGGTGACATA; The nucleotide sequence of Apt-27 is: CTTTTTCTCCCCCCGCGGGGGGGCATTG.

2. The method for screening nucleic acid aptamers according to claim 1, characterized in that: The steps include: (1) Shortening design: Apt-100 is subjected to a two-dimensional structure shortening design to destroy the original double-stranded stem structure and increase its free energy; the nucleotide sequence of Apt-100 is ATCCACGCTCTTTTTCTCCCCCCGCTATGTGAGGCTCGATCGTTCGGTGTGTTTTTAAAGGGTACAGATCCTGGGCGGGGGGCATTGAGGGTGACATAGG; (2) Molecular docking simulation: A nucleotide sequence having a binding energy with imatinib less than that of the nucleic acid aptamer Apt-100 is screened out from step (1) by molecular docking simulation calculation, wherein the nucleotide sequence is any one of the nucleic acid aptamers Apt-51, Apt-37, Apt-35, Apt-33, and Apt-27; (3) Circular dichroism test: The nucleic acid aptamer obtained in step (2) is combined with imatinib, and the nucleic acid aptamer having the maximum change value of the positive characteristic peak at 280 nm before and after the combination is screened out by circular dichroism test; the nucleic acid aptamer comprises the nucleotide sequence of Apt-37.

3. The use of the nucleic acid aptamer according to claim 1, characterized in that: The nucleic acid aptamer is used for detecting imatinib and its salts.

4. An electrochemical nucleic acid aptamer sensor, characterized in that: The electrochemical nucleic acid aptamer sensor includes nucleic acid aptamer Apt-37.

5. The electrochemical nucleic acid aptamer sensor according to claim 4, characterized in that: The 3' end of the nucleic acid aptamer Apt-37 is modified with a disulfide bond, and the 5' end is modified with methylene blue.

6. The method for preparing the electrochemical nucleic acid aptamer sensor according to claim 4, characterized in that: The steps include: (1) Preparation of nanoporous gold electrode: A 1.5 M ZnCl2 benzyl alcohol solution was heated to 125 °C to construct a three-electrode system, in which the working electrode was a gold electrode, the reference electrode was Ag / AgCl, and the counter electrode was a platinum wire. The three-electrode system was placed in a benzyl alcohol solution and subjected to CV scanning. The obtained gold electrode was then ultrasonically cleaned in acetone, ethanol, and deionized water in sequence, and then immersed in a 0.5 M HCl solution for dealloying. Finally, the gold electrode was electrochemically cleaned and activated to obtain a nanoporous gold electrode. (2) Assembly of electrochemical aptamer sensors: The thiolated aptamers were assembled on the surface of the nanoporous gold electrode, and after adding blocking agents to occupy the excess sites, they were rinsed and stored in a phosphate buffer solution.

7. The preparation method according to claim 5, characterized in that: The blocking agent in step (2) is any one of 6-mercapto-1-hexanol, 2-mercaptoethanol, cysteamine hydrochloride, sodium diethyldithiocarbamate, and bovine serum albumin.

8. Use of the electrochemical nucleic acid aptamer sensor as claimed in claim 4 in detecting imatinib and its salts.

9. The use according to claim 8, characterized in that: The steps include: (1) Basic sample test: The electrochemical nucleic acid aptamer sensor was placed in the biological sample solution to be tested together with the reference electrode Ag / AgCl and the counter electrode platinum wire as the working electrode, and the square wave voltammetric current signal I was tested under low frequency and high frequency conditions without imatinib and its salts. blank ; (2) Establishing a concentration-response curve: adding different concentrations of imatinib and its salts to the biological sample solution to be tested in step (1), and testing the square wave voltammetric current signal I of the biological sample solution containing different concentrations of imatinib and its salts under low frequency and high frequency conditions respectively. target , by calculating the gain signal S = (I target –I blank ) / I blank ×100%; or by kinetic difference KDM signal (D) = S 高频 –S 低频 , calculating the KDM signal at different concentrations, i.e., D; establishing a concentration-response curve of the electrochemical nucleic acid aptamer sensor according to the relationship between the signal gain S or the KDM (D) and the concentration; (3) Determination of calibration parameters: The concentration-response curve obtained in step (2) is fitted using the Hill equation to determine the calibration parameter K of the electrochemical nucleic acid aptamer sensor. 1 / 2 , Y start , Y end , n; the Hill equation is: Wherein, Y is S or D; (4) Unknown sample concentration test: The calibration parameter K obtained in step (3) is 1 / 2 , Y start , Y end , n is substituted into the Hill equation again to complete the quantitative detection of the unknown sample concentration.

10. The use according to claim 9, characterized in that: The low frequency condition is 5 Hz, and the high frequency condition is 100 Hz.

Images