Application of novel circRNA in diagnosis and treatment of hepatocellular carcinoma

Abstract

The invention belongs to the field of biological medicine, and particularly relates to application of novel circRNA to diagnosis and treatment of hepatocellular carcinoma, a DNA nucleotide sequence corresponding to the novel circRNA is shown as SEQ ID NO.1, the novel circRNA can be stably looped in liver cancer and can be remarkably and highly expressed, and by detecting the expression level of the circRNA in a clinical hepatocellular carcinoma tissue sample, compared with para-carcinoma normal liver tissue, the novel circRNA has the advantages that the novel circRNA can be applied to diagnosis and treatment of hepatocellular carcinoma; the circRNA in a hepatocellular carcinoma tissue sample is obviously highly expressed, so that the circRNA can be used as a basis for early clinical diagnosis of hepatocellular carcinoma. The invention also discloses application of the circRNA in hepatocellular carcinoma diagnosis, including preparation of a detection reagent for diagnosing hepatocellular carcinoma and preparation of a drug for targeted therapy of hepatocellular carcinoma, and inhibition of expression of the circRNA can significantly inhibit growth of hepatocellular carcinoma. The invention provides a novel target for clinical treatment of liver cancer, and has important clinical significance and social benefits.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of a novel circRNA in the diagnosis and treatment of hepatocellular carcinoma. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Hepatocellular carcinoma (hereinafter referred to as HCC) is one of the most common malignant tumors in the world and the third leading cause of death from malignant tumors. In recent years, clinical treatment methods for HCC have been continuously enriched. Early HCC is expected to be cured through surgery and radiofrequency ablation, but there is still a lack of ideal treatment measures for patients with advanced HCC. The overall prognosis of HCC patients is still unsatisfactory, and recurrence and metastasis are still the most serious problems affecting the prognosis of HCC patients. With the deepening of research, molecular targeted therapy and immunotherapy for HCC have made breakthrough progress. Targeted drugs represented by lenvatinib and sorafenib, and immune checkpoint inhibitors represented by atezolizumab and sintilimab combined with bevacizumab have been approved as first-line treatment options for patients with advanced HCC. However, the objective response rate of HCC to the above drugs is low, and monotherapy prolongs the survival time of patients by only a few months. At the same time, the economic burden of accompanying adverse drug reactions also limits clinical application. Therefore, finding new molecular markers and potential therapeutic targets for HCC is of great significance to reduce tumor resistance and improve patient prognosis. Summary of the invention

[0004] In view of the above-mentioned prior art, the present invention aims to provide a novel application of circRNA in the diagnosis and treatment of hepatocellular carcinoma. Specifically, the present invention screens out a novel circRNA, which is highly expressed in liver cancer cells and has good sensitivity and specificity. Further studies have found that the expression of circRNA can promote the proliferation, migration, invasion, and cloning ability of hepatocellular carcinoma, which can provide a potential target for the clinical treatment of liver cancer and improve the therapeutic effect of liver cancer.

[0005] The biomarker is a circRNA, and the nucleotide sequence of the DNA corresponding to the circRNA is: GCACCAGTTAGAAGACAAATGAAAGCTAAGCAACTCAGTGCACAATCTTACGGTGTGACCAGTTCAACAGCTCGGCGAATATTGCAGTCTTTAGAGAAGATGTCAAGCCCTTTAGCGGATGCAAAAAGAATTCCATCCATTGTTTCTTCTCCTCTGAATTCTCCTCTTGATAGGAGTGGGATAGATATCACAGATTTTCAGGCCAAAAGAGAAAAG (SEQ ID NO.1).

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] The first aspect of the present invention provides the use of a reagent for detecting circRNA in the preparation of any one or more of the following products:

[0008] a1) Hepatocellular carcinoma diagnosis or auxiliary diagnosis products;

[0009] a2) Products for prognosis assessment or auxiliary prognosis assessment of hepatocellular carcinoma.

[0010] The present invention has found through research that circRNA is stably circularized in liver cancer and is significantly highly expressed in liver cancer.

[0011] The second aspect of the present invention provides a product, which comprises the above-mentioned substance for detecting circRNA, and the product has any one or more of the following uses:

[0012] b1) Diagnosis or auxiliary diagnosis of hepatocellular carcinoma;

[0013] b2) Prognostic assessment or auxiliary prognostic assessment for hepatocellular carcinoma.

[0014] The third aspect of the present invention provides a use of a substance that inhibits circRNA expression in the preparation of a product for treating liver cancer, wherein the function of the product for treating liver cancer is any one or more of the following:

[0015] c1) Inhibit the proliferation of liver cancer cells;

[0016] c2) Inhibit the malignant invasion of liver cancer cells;

[0017] c3) Promote apoptosis of liver cancer cells;

[0018] c4) inhibit liver cancer growth;

[0019] c5) Inhibit liver cancer metastasis.

[0020] A fourth aspect of the present invention provides a product for treating liver cancer, wherein the active ingredient includes a substance for inhibiting the expression level of circRNA.

[0021] The functions of the product are any one or more of the following:

[0022] c1) Inhibit the proliferation of liver cancer cells;

[0023] c2) Inhibit the malignant invasion of liver cancer cells;

[0024] c3) Promote apoptosis of liver cancer cells;

[0025] c4) inhibit liver cancer growth;

[0026] c5) Inhibit liver cancer metastasis;

[0027] The product described is a drug.

[0028] The present invention has found through experimental research that circRNA is stably circularized in liver cancer and is significantly highly expressed in liver cancer. The present invention has constructed a lentivirus that targets and interferes with circRNA and transfects liver cancer cells. It has been confirmed that the lentivirus carrying a specific interference sequence can stably knock down the expression of the circRNA in liver cancer cells. Further experimental results show that interfering with the circRNA can significantly inhibit the proliferation, migration, invasion, and cloning ability of liver cancer cells.

[0029] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0030] The present invention discloses an application of a novel circRNA in the diagnosis and treatment of hepatocellular carcinoma. The biomarker is a novel circRNA, and its corresponding DNA nucleotide sequence is shown in SEQ ID NO.1. The novel circRNA is stably circularized in liver cancer and is significantly highly expressed in liver cancer. By detecting the expression level of circRNA in clinical hepatocellular carcinoma tissue samples, compared with adjacent normal liver tissue, the circRNA in the hepatocellular carcinoma tissue samples is significantly highly expressed. Through a positive rate verification experiment, the AUC value is 0.85, which has high accuracy. Therefore, circRNA can be used as a basis for early clinical diagnosis of hepatocellular carcinoma. The present invention discloses the application of circRNA, a diagnostic biomarker for hepatocellular carcinoma, including the application in preparing a detection reagent for diagnosing hepatocellular carcinoma and preparing a drug for targeted treatment of hepatocellular carcinoma. By constructing a lentivirus for targeted interference with a novel circRNA and transfecting liver cancer cells, it is confirmed that the lentivirus carrying a specific interference sequence can stably knock down the expression of the circRNA in liver cancer cells. At the same time, interference with the novel circRNA can significantly inhibit the proliferation, migration, invasion and clone formation ability of liver cancer cells, indicating that the implementation of the present invention will provide a novel target for the clinical treatment of liver cancer, which has important clinical significance and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0032] Figure 1 is the chromosomal genomic location of the novel circRNA in Example 1;

[0033] Figure 2 This is a schematic diagram of the new circRNA ring in Example 1;

[0034] Figure 3 The sequencing result of the novel circRNA linker sequence in Example 1;

[0035] Figure 4 For the detection of the new circRNA ring in Example 1;

[0036] Figure 5 Stability test of the novel circRNA and its parent gene mRNA in Example 1;

[0037] Figure 6The expression level detection and verification of the novel circRNA in Example 1, wherein A is the expression level detection of the novel circRNA in liver cancer tissue and adjacent liver tissue, B is the expression level detection of the novel circRNA in liver cancer patients and normal subjects, and C is the ROC curve verification of the novel circRNA;

[0038] Figure 7 The expression level of circRNA in liver cancer cells (Huh7 and Hep3B) was detected by constructing a novel circRNA interference lentiviral vector transfected with the vector in Example 1;

[0039] Figure 8 The proliferation ability test of the liver cancer cells (Huh7, Hep3B) with knockdown of novel circRNA and the control group in Example 1;

[0040] Fig. 9 The clone formation ability test of the novel circRNA knockdown in liver cancer cells (Huh7, Hep3B) and the control group in Example 1;

[0041] Fig.10 The detection of the migration and invasion ability of the novel circRNA knocked down in liver cancer cells (Huh7, Hep3B) and the control group in Example 1, wherein A is the detection of the migration and invasion ability of the novel circRNA knocked down in liver cancer cells Huh7 and the control group, B is the detection of the migration and invasion ability of the novel circRNA knocked down in liver cancer cells Hep3B and the control group, C is the cell count of the novel circRNA knocked down in liver cancer cells Huh7 and the control group, and D is the cell count of the novel circRNA knocked down in liver cancer cells Hep3B and the control group;

[0042] Fig.11 The healing ability test of the novel circRNA knockdown and the control group in liver cancer cells (Huh7, Hep3B) in Example 1, wherein A is the wound healing graph of the novel circRNA knockdown and the control group in liver cancer cells Huh7 at 0h and 48h, B is the wound healing graph of the novel circRNA knockdown and the control group in liver cancer cells Hep3B at 0h and 48h, C is the healing rate of the novel circRNA knockdown and the control group in liver cancer cells Huh7, and D is the healing rate of the novel circRNA knockdown and the control group in liver cancer cells Hep3B. DETAILED DESCRIPTION

[0043] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0044] It should be noted that the terms used here are only for describing specific embodiments, and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should also be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof. If the experimental methods of specific conditions are not indicated in the following specific embodiments, the conventional methods and conditions of molecular biology in the art are usually followed, and such techniques and conditions are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al. "Molecular Cloning: Experimental Manual", or according to the conditions recommended by the manufacturer.

[0045] The present invention is further described in conjunction with specific examples. The following examples are only for explaining the present invention and are not intended to limit the content thereof. If the specific experimental conditions are not specified in the examples, they are usually carried out under conventional conditions or under conditions recommended by the sales company; the materials and reagents used in the examples, unless otherwise specified, can be purchased through commercial channels.

[0046] Technicians should understand that the term "expression level" refers to the amount of gene products present in vivo or in a sample at a specific time point. Expression levels can be measured / quantified / detected, for example, by protein or mRNA expressed by the gene. Expression levels can be quantified, for example, as follows: the amount of the target gene product present in the normalized sample with the total amount (total protein or mRNA) of the same type of gene product in the same sample or reference sample (for example, a sample obtained from the same individual at the same time or a portion of the same size (weight, volume) of the same sample), or the sample size (weight, volume, etc.) of the amount / limitation of the target gene product is determined. Expression levels can be measured or detected by any method known in the art, such as a method (such as mass spectrometry) for direct detection and quantification of the target gene product, or a method for indirect detection and measurement of the target gene product that is usually combined with one or more different molecules or detection devices (such as primers, probes, antibodies, protein scaffolds) that are specific to the target gene product. It is also known to the skilled person to determine the level of gene copies, which also includes determining the absence or presence of one or more fragments (e.g., by nucleic acid probes or primers, such as quantitative PCR, Multiplex ligation-dependent probe amplification (MLPA) PCR).

[0047] The terms "indicator" and "marker" are used interchangeably in the present invention and refer to a sign or signal of a disease or are used to monitor a disease. Such a "disease" refers to a biological state of a cell, tissue or organ, or refers to the health and / or disease state of an individual. An indicator can be the presence or absence of a molecule including but not limited to peptides, proteins and nucleic acids, or can be a change in the expression level or pattern of such a molecule in a cell, or tissue, organ or individual. An indicator can be a sign of the occurrence, development or presence of a disease in an individual or the further progression of such a disease. An indicator can also be a sign of the risk of developing a disease in an individual.

[0048] The terms "up-regulated", "increased" or "increased" in the level of an indicator refer to a decrease in the level of such indicator in a sample compared to a reference or reference sample.

[0049] The terms "down-regulated", "reduced" or "decreased" in the level of an indicator refer to a decrease in the level of such indicator in a sample compared to a reference or reference sample.

[0050] The term “divergent primers” refers to primers designed for the reverse splicing junction sequence of circRNA, which can specifically amplify circRNA but not linear RNA.

[0051] The term “convergent primers” refers to primers designed for linear DNA and cannot amplify circRNA.

[0052] The inventors previously screened circRNA members specifically expressed in liver cancer using gene sequencing technology, and discovered a new type of circRNA, whose corresponding DNA nucleotide sequence is shown in SEQ ID NO.1. The expression of this new type of circRNA is very different in liver cancer tissues and has not been reported in liver cancer, suggesting that it may be used as a new molecular biomarker for the diagnosis and treatment of liver cancer.

[0053] In view of this, in one embodiment of the present invention, there is provided the use of a substance for detecting the novel circRNA in the preparation of any one or more of the following products:

[0054] a1) Hepatocellular carcinoma diagnosis or auxiliary diagnosis products;

[0055] a2) Products for prognosis assessment or auxiliary prognosis assessment of hepatocellular carcinoma.

[0056] Wherein, the biomarker is circRNA, and the DNA nucleotide sequence corresponding to the circRNA is shown as SEQ ID NO.1.

[0057] The present invention found through experimental research that circRNA is stably circularized in liver cancer and is significantly highly expressed in liver cancer. Through the positive rate verification experiment, the AUC value is 0.85, which has a high accuracy. Therefore, circRNA can be used as a basis for early clinical diagnosis of hepatocellular carcinoma.

[0058] In another specific embodiment of the present invention, a product is provided, the product comprising the above-mentioned substance for detecting circRNA, and the product has any one or more of the following uses:

[0059] b1) Diagnosis or auxiliary diagnosis of hepatocellular carcinoma;

[0060] b2) Prognostic assessment or auxiliary prognostic assessment for hepatocellular carcinoma.

[0061] In another specific embodiment of the present invention, the substances for detecting circRNA include, but are not limited to, substances for detecting the expression level of circRNA by RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip and gene sequencing.

[0062] In another specific embodiment of the present invention, the product includes but is not limited to primers, probes, chips, nucleic acid membrane strips, preparations or kits for detecting the expression level of the circRNA in the sample to be tested.

[0063] In another specific embodiment of the present invention, the sample to be tested may be a human sample, and more specifically, the sample to be tested includes liver tissue of a subject.

[0064] In another specific embodiment of the present invention, there is provided a use of a substance for inhibiting circRNA expression in the preparation of a product for treating liver cancer, wherein the function of the product for treating liver cancer is any one or more of the following:

[0065] c1) Inhibit the proliferation of liver cancer cells;

[0066] c2) Inhibit the malignant invasion of liver cancer cells;

[0067] c3) Promote apoptosis of liver cancer cells;

[0068] c4) inhibit liver cancer growth;

[0069] c5) Inhibit liver cancer metastasis.

[0070] Among them, substances that inhibit the expression level of circRNA include RNA interference molecules or antisense oligonucleotides targeting circRNA, small molecule inhibitors, and substances for implementing lentiviral infection or gene knockout.

[0071] In another specific embodiment of the present invention, the lentiviral vector construction process includes constructing shRNA into the vector, and the DNA nucleotide sequence corresponding to the shRNA is shown in SEQ ID NO.2, GAAAAGGCACCAGTTAGAA (SEQ ID NO.2).

[0072] The product may be a medicine.

[0073] In another specific embodiment of the present invention, the use of the novel circRNA as a target in the treatment of liver cancer and / or screening of liver cancer drugs is provided.

[0074] In another specific embodiment of the present invention, the liver cancer drug is a drug for preventing and / or treating liver cancer.

[0075] In another specific embodiment of the present invention, a product for treating liver cancer is provided, wherein the active ingredient includes a substance for inhibiting the expression level of circRNA, and the DNA nucleotide sequence corresponding to the substance is shown in SEQ ID NO.2.

[0076] The functions of the product are any one or more of the following:

[0077] c1) Inhibit the proliferation of liver cancer cells;

[0078] c2) Inhibit the malignant invasion of liver cancer cells;

[0079] c3) Promote apoptosis of liver cancer cells;

[0080] c4) inhibit liver cancer growth;

[0081] c5) Inhibit liver cancer metastasis;

[0082] The product may be a medicine.

[0083] According to the present invention, the above-mentioned medicine further comprises at least one inactive pharmaceutical ingredient.

[0084] The inactive ingredients of the drug can be carriers, excipients and diluents commonly used in pharmacy. Moreover, according to the usual methods, the drug can be made into oral preparations, external preparations, suppositories and sterile injection solutions in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, sprays, etc.

[0085] The non-drug active ingredients such as carriers, excipients and diluents that may be included are well known in the art, and those skilled in the art can determine whether they meet clinical standards.

[0086] In another specific embodiment of the present invention, the carrier, excipient and diluent include but are not limited to lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil.

[0087] In another specific embodiment of the present invention, the medicine of the present invention can be applied to the body by known means. For example, it can be delivered to the tissue of interest by intravenous systemic delivery or local injection. It can be applied via intravenous, percutaneous, intranasal, mucosal or other delivery methods. Such application can be carried out via single dose or multiple doses. It will be appreciated by those skilled in the art that the actual dose to be applied in the present invention can vary depending on various factors to a great extent, such as target cells, biological types or their tissues, the general condition of the subject to be treated, the route of administration, the mode of administration, etc.

[0088] In another specific embodiment of the present invention, the drug administration subjects can be humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, gorillas, etc.

[0089] The present invention is further explained by the following examples, but they are not intended to limit the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0090] Example 1

[0091] 1. Materials and Methods

[0092] 1. Experimental Materials

[0093] The experimental cell lines used were human liver cancer cell lines Huh7 and Hep3B.

[0094] 2. Main Reagents

[0095] 2.1 Purchase of reagents

[0096] DMEM and MEM complete medium were purchased from Yuanpei Biotechnology Co., Ltd.

[0097] Serum was purchased from Thermo Fisher Scientific Inc.

[0098] RNA extraction kit: Fijet Biotechnology Co., Ltd., reverse transcription kit: Novazon Biotech Co., Ltd., fluorescence quantitative kit: Novazon Biotech Co., Ltd.

[0099] Interference sequence synthesis: GeneCare gene design synthesis

[0100] Transwell chamber was purchased from Jiete Biotechnology Co., Ltd.

[0101] 2.2 Cell culture

[0102] The human liver cancer cell line Huh7 was cultured in DMEM medium containing 5% fetal bovine serum and 1% penicillin-streptomycin, and the human liver cancer cell line Hep3B was cultured in MEM medium containing 5% fetal bovine serum and 1% penicillin-streptomycin. The cells were cultured in a 37°C constant temperature incubator containing 5% CO2, and were periodically digested and passaged with trypsin.

[0103] 2. Experimental methods and conclusions

[0104] 1. Divergent and convergent primers

[0105] name Sequence (5'-3') Convergence Primer F TCAGGGTCCTGTGGGCATA(SEQ ID NO.3) Convergence Primer R GGAGCAGTTTACTCCGCACT(SEQ ID NO.4) Divergent Primer F CTCCTCTTGATAGGAGTGGGATAG(SEQ ID NO.5) Divergent Primer R GGAGAAGAAACAATGGATGGAA(SEQ ID NO.6)

[0106] 2. Divergent and convergent primers verify circRNA ring formation

[0107] According to the instructions of the kit, total RNA and gDNA were extracted from human cells or tissues using an RNA extraction kit and a whole genome DNA extraction kit, respectively, and cDNA was obtained from the total RNA using a reverse transcription kit.

[0108] Design of divergent primers for circRNA ( Figure 4 Annotation ) and convergent primers ( Figure 4 Annotation ) PCR amplification was performed on the cDNA and human gDNA obtained above. Agarose gel electrophoresis was performed on the amplified products. The results are shown in Figure 4 The results showed that circRNA and the internal reference gene (GAPDH) mRNA used as a control could be amplified in both cDNA and gDNA using convergent primers, while divergent primers could specifically amplify circRNA from cDNA, confirming that the target DNA fragment sequence could be transcribed to form the circRNA described in the present invention.

[0109] 3. Stability detection of circRNA and its parent gene mRNA

[0110] circRNA has a stable circular structure, while mRNA does not have this feature. Treatment with the exonuclease RNase R can degrade most mRNAs, but it is difficult to degrade circRNA. The above principle was used to detect the stability of circRNA and its parent gene mRNA. The specific method is as follows: refer to the kit instructions, use the RNA extraction kit to extract total RNA from human cells or tissues, add RNase R (4U / uL, GSPure RNase R Kit, GISA Biotechnology) to the total RNA, digest it at 37°C for 15min, purify the digested product using a purification kit, obtain cDNA from the purified product using a reverse transcription kit, and detect the expression level of the target RNA fragment by real-time quantitative PCR.

[0111] Compared with the control group (Mock), circRNA can be stably present and is not digested by RNase R ( Figure 5 ).

[0112] 4. Expression and analysis of the novel circRNA in liver cancer tissues and adjacent tissues

[0113] Tissue sample extraction and preservation: The present invention collected liver cancer tissue and adjacent normal liver tissue from 48 HCC patients who underwent liver cancer resection in the Department of General Surgery, Qilu Hospital of Shandong University, and collected normal liver tissue from 24 patients with hepatic hemangioma who underwent partial liver tissue resection. Each patient was informed of the use of the sample and signed an informed consent form, and the tissue samples were stored in liquid nitrogen. The study was approved by the Ethics Committee of Qilu Hospital of Shandong University.

[0114] Extraction of tissue RNA: The tissue samples to be tested were collected, tissue lysis solution and grinding beads were added, and tissue suspension was obtained using a tissue grinder (Wuhan Sevier Biotechnology), and then total RNA was extracted by column centrifugation (Fijet Biotechnology);

[0115] Tissue RNA detection and ROC curve drawing: The samples of 48 patients were randomly divided into two groups, and the expression level difference of circRNA in cancer and adjacent tissues of one group of patients (24 cases) was detected by reverse transcription PCR and fluorescence real-time quantitative PCR (Novozyme Biotechnology). Figure 6 A); Detect the difference in circRNA expression levels in liver cancer tissues of another group of HCC patients (24 cases) and liver tissues of 24 patients with hepatic hemangioma ( Figure 6 B), and draw the ROC working curve ( Figure 6 C);

[0116] pass Figure 6It can be seen that the expression level of the circRNA of the present invention in liver cancer is significantly higher than that in adjacent liver tissues, which can better distinguish liver cancer tissues from normal liver tissues and can be used as an early diagnostic marker for liver cancer.

[0117] 5. Construction of circRNA interference lentiviral vector to transfect liver cancer cells

[0118] (1) The present invention uses the lentiviral vector GV493 (element sequence: hU6-MCS-CBh-gcGFP-IRES-puromycin) for interference test. The DNA nucleotide sequence corresponding to shRNA is: GAAAGGCACCAGTTAGAA (SEQ ID NO.2). According to the following table, 50 μl of enzyme digestion system is prepared. Incubate at 37°C for 3 hours. Perform agarose gel electrophoresis on the vector digestion product to recover the target band;

[0119] Reagents Volume (μL) <![CDATA[ddH2O]]> 41 10×CutSmart Buffer 5 Purified plasmid DNA (1 μg / μL) 2 AgeI (10U / μL) 1 EcoRI (10U / μL) 1

[0120] (2) Obtain the base sequence of the circRNA according to the present invention from the genebank database, and then design primers with EcoRI and AgeI restriction sites at both ends to obtain the target gene fragment (primer sequences used in the present invention: p1: CCGG GAAAAGGCACCAGTTAGAA CTCGAG TTCTAACTGGTGCCTTTTC TTTTTG; p2: AATTCAAAAAGAAAAGGCACCAGTTAGAA CTCGAG TTCTAACTGGTGCCTTTTC); dissolve the synthesized primer powder in annealing buffer (Biyuntian Annealing Buffer for DNA Oligos Kit), incubate in a 90°C water bath for 15 min, and cool naturally to room temperature to obtain annealed double-stranded DNA;

[0121] (3) Connect the linearized vector and annealed double-stranded DNA using DNA ligase and incubate at 16°C overnight. Reaction system:

[0122] Reagents Volume (μL) <![CDATA[ddH2O]]> 15 Linearized vector (100ng / μL) 1 Double-stranded DNA (100ng / μL) 1 10×T4 DNAligase buffer 2 T4 DNA ligase 1

[0123] (4) Add 10 μL of the exchange reaction product to 100 μL of competent cells and place on ice for 30 min. Heat shock at 42°C for 90 s and incubate in an ice-water bath for 2 min. Add 500 μL of LB medium and place on a shaker at 37°C for 1 h. Take an appropriate amount of bacterial solution and evenly spread it on a plate containing ampicillin and incubate it upside down in a constant temperature incubator for 12-16 h.

[0124] (5) Pick a single colony and place it in 200 μL LB culture medium containing ampicillin, and send it to the company for sequencing verification. The verification primer is the vector universal primer (GGAAAGAATAGTAGACATAATAGC).

[0125] (6) The correctly sequenced bacterial suspension was transferred to 10 mL of LB medium containing the corresponding antibiotics, cultured at 37°C overnight, and the plasmid was extracted using the Tiangen endotoxin-free plasmid mini-preparation kit for lentiviral packaging.

[0126] (7) Using lentivirus to infect liver cancer cell lines Huh7 and Hep3B, respectively, 48 hours later, using drug pressure to screen stable transfected cell lines, extracting RNA and detecting circRNA knockdown efficiency, the detection primers are the sequences shown in SEQ ID NO.3 and 4;

[0127] Real-time quantitative PCR confirmed that the interfering lentivirus designed in the present invention can effectively inhibit the expression level of circRNA in human liver cancer cells ( Figure 7 ).

[0128] 6. Cell proliferation ability detection

[0129] 1) Collect liver cancer cells (Huh7, Hep3B) in the circRNA knockdown group and liver cancer cells (Huh7, Hep3B) in the control group, prepare cell suspensions and count;

[0130] 2) Inoculate the cell suspension in 96-well plates, approximately 1500 cells / 100 μL;

[0131] 3) Place the culture plate in an incubator for pre-culture for a period of time (37°C, 5% CO2). It takes about 4 hours for the cells to adhere to the wall.

[0132] 4) Add 10 μL of CCK-8 solution to each well and shake gently to mix;

[0133] 5) Place the culture plate in an incubator and incubate for 1 hour;

[0134] 6) Measure the absorbance (OD) at 450 nm using an enzyme-labeled instrument;

[0135] 7) Taking the current detection value as the data of the first day, continue to culture the cells, and then detect the OD values ​​of each group on the second, third, fourth and fifth days in turn, and draw a cell growth curve;

[0136] Conclusion: Knockdown of circRNA expression in human hepatoma cells significantly inhibits the proliferation rate of hepatoma cells ( Figure 8 ).

[0137] 7. Cell clone formation ability detection

[0138] 1) Digest and resuspend the liver cancer cells (Huh7, Hep3B) in the logarithmic growth phase of the circRNA knockdown group and the control group into a cell suspension and count them;

[0139] 2) Inoculate each group of cells in a 6-well culture plate, 1000 cells / well;

[0140] 3) Continue culturing until 14 days or until the number of cells in most single clones is greater than 50, changing the medium every 3 days for observation;

[0141] 4) After cloning is completed, add 1 mL of 4% paraformaldehyde to each well for 15 minutes and wash once with PBS;

[0142] 5) Add 1 mL of crystal violet stain to each well and stain for 20 minutes; 6) Wash several times with PBS, dry, and take pictures with a camera;

[0143] Conclusion: Knockdown of circRNA expression in human hepatoma cells significantly inhibits the cloning ability of hepatoma cells ( Fig. 9 ).

[0144] 8. Transwell migration and invasion ability detection

[0145] 1) For cell invasion experiments, dilute Matrigel at 1:8 and add it to the upper chamber of the Transwell chamber. Incubate at 37°C for 1 hour to allow Matrigel to polymerize into a gel. For cell migration experiments, cells can be directly collected and plated.

[0146] 2) Digest and collect cells from each group, resuspend in serum-free medium after centrifugation and count;

[0147] 3) Add 50,000 / 200 μL of cell suspension to the upper chamber surface of the Transwell chamber;

[0148] 4) Add 800 μL of culture medium containing 15% fetal bovine serum to the lower chamber of the 24-well plate;

[0149] 5) Routine culture for 24 hours;

[0150] 6) Take out the Transwell chamber, discard the culture medium in the well, wash twice with PBS, stain with 0.5% crystal violet for 30 minutes, and wash three times with PBS;

[0151] 7) Gently wipe off the moisture and non-migrated cells in the upper chamber with a cotton swab, take pictures under a microscope and count them;

[0152] Conclusion: Knockdown of circRNA expression in human hepatoma cells significantly inhibits the migration and invasion ability of hepatoma cells ( Fig.10 ).

[0153] 9. Wound healing ability test

[0154] 1) Inoculate 300,000 cells per well of a 6-well culture plate. The total volume of each well is 2 mL. The cells can be fully confluent after about 24 hours.

[0155] 2) Use the gun tip to draw a horizontal line on the bottom of the culture well. The gun tip should be vertical and not tilted as much as possible.

[0156] 3) Aspirate the culture supernatant, wash three times with PBS, remove the scratched cells, and add 2 ml of blank culture medium to each well;

[0157] 4) Place the cells in a cell culture incubator and take pictures at 0h, 6h, 12h, and 24h to observe changes in cell wound healing;

[0158] Conclusion: Knockdown of circRNA expression in human hepatoma cells significantly inhibits the wound healing (migration) ability of hepatoma cells ( Fig.11 ).

[0159] In summary:

[0160] 1. This novel circRNA is highly expressed in liver cancer tissues and can be used as a molecular marker for the diagnosis and treatment of liver cancer;

[0161] 2. Cell function experiments showed that interfering with the expression of this novel circRNA can inhibit the proliferation, migration, invasion and cloning ability of liver cancer cells.

[0162] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of reagents for detecting biomarkers in the preparation of any one or more of the following products: a1) Hepatocellular carcinoma diagnosis or auxiliary diagnosis products; a2) Products for prognosis assessment or auxiliary prognosis assessment of hepatocellular carcinoma; in, The biomarker is circRNA, and the DNA nucleotide sequence corresponding to the circRNA is shown in SEQ ID NO.

1.

2. A product, characterized in that: The product comprises a substance for detecting the circRNA according to claim 1, and the product has any one or more of the following uses: b1) Diagnosis or auxiliary diagnosis of hepatocellular carcinoma; b2) Prognostic assessment or auxiliary prognostic assessment for hepatocellular carcinoma.

3. The product according to claim 2, characterized in that The material for detecting the circRNA of claim 1 includes a material for detecting the expression level of the circRNA of claim 1 based on RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip and gene sequencing.

4. The product according to claim 3, characterized in that The product includes primers, probes, chips, nucleic acid membrane strips, preparations or kits for detecting the expression level of the circRNA in the sample to be tested.

5. Application of substances that inhibit circRNA expression in the preparation of products for the treatment of liver cancer; in, Substances that inhibit the expression level of circRNA include RNA interference molecules or antisense oligonucleotides targeting circRNA, small molecule inhibitors, and substances that implement lentiviral vector infection or gene knockout; The DNA nucleotide sequence corresponding to the circRNA is shown in SEQ ID NO.

1.

6. The use according to claim 5, characterized in that The functions of the product for treating liver cancer are any one or more of the following: c1) Inhibit the proliferation of liver cancer cells; c2) Inhibit the malignant invasion of liver cancer cells; c3) Promote apoptosis of liver cancer cells; c4) inhibit liver cancer growth; c5) Inhibit liver cancer metastasis.

7. The use according to claim 5, characterized in that The lentiviral vector construction process includes constructing shRNA into the vector, and the DNA nucleotide sequence corresponding to the shRNA is shown in SEQ ID NO.

2.

8. A product for treating liver cancer, characterized in that: The active ingredient is a substance used to inhibit the expression level of circRNA, and the DNA nucleotide sequence corresponding to the substance is shown in SEQ ID NO.

2.

9. The product according to claim 8, characterized in that The functions of the product are any one or more of the following: c1) Inhibit the proliferation of liver cancer cells; c2) Inhibit the malignant invasion of liver cancer cells; c3) Promote apoptosis of liver cancer cells; c4) inhibit liver cancer growth; c5) Inhibit liver cancer metastasis; The product described is a drug.

10. The product according to claim 9, characterized in that The medicament further comprises at least one pharmaceutically inactive ingredient.

Images