Medicago sativa MsRCAR1 gene and application thereof in drought resistance of plants

Abstract

The invention discloses a medicago sativa MsRCAR1 gene and application thereof in plant drought resistance, and relates to the technical field of transgenosis, amino acid of MsRCAR1 protein has at least 80% identity with a sequence shown in SEQ ID NO: 1, the expression quantity of the protein and a coding gene MsRCAR1 is increased under induction of drought stress, after the MsRCAR1 gene is transferred into a target plant, the expression quantity of the MsRCAR1 gene is increased, and the expression quantity of the MsRCAR1 gene is increased. According to the invention, the stress resistance of the target plant can be effectively improved, the plant variety can be optimized and the tolerance of the plant to drought stress can be improved on the premise of not changing the basic physiological structure and nutritional value of the plant, and a new way is provided for cultivating the variety with enhanced drought tolerance and expanding the production and planting scale of the plant.

Description

Technical Field

[0001] The invention relates to the technical field of transgenic technology, in particular to an alfalfa MsRCAR1 gene and an application thereof in plant drought resistance. Background Art

[0002] Alfalfa (Medicago sativa L.) is a perennial herb of the genus Medicago in the Leguminosae family. It originated in West Asia. Due to its strong adaptability and fast growth, it has now been widely introduced and cultivated in temperate regions of Europe, Asia and North America, and is known as the "king of forage grasses."

[0003] Alfalfa is a source of high-quality protein, containing a variety of essential amino acids for animal growth and development, and its crude protein content can be as high as 20%. Alfalfa is not only a high-quality feed crop, but also has important significance in the ecosystem. Its roots can fix nitrogen through symbiosis with rhizobia, converting nitrogen into a form that can be used by plants, which enables alfalfa to grow in nitrogen-poor soils and provide additional nitrogen to surrounding plants, promoting the nitrogen cycle of the ecosystem.

[0004] Under drought conditions, soil moisture deficiency causes alfalfa to be unable to maintain its normal growth and metabolic activities. Long-term water deficiency causes a significant increase in cell membrane permeability and electrolyte exudation, affecting the stability of the membrane system. In addition, water shortage can cause plant dehydration, thereby affecting photosynthesis, reducing the absorption and transportation of nutrients and water, and limiting plant growth. The water and nutrient restrictions caused by drought lead to a significant reduction in alfalfa yield. Plants that cannot grow and develop normally will show a decrease in the number and size of inflorescences, which in turn affects seed yield and quality.

[0005] Screening and breeding more drought-tolerant alfalfa varieties can increase the stability and sustainability of forage production. Breeding drought-tolerant alfalfa can also reduce the demand for water resources. This helps save water resources, especially in arid areas or places where water resources are scarce, and can more effectively use limited water resources for agricultural and animal husbandry production. Therefore, the use of molecular breeding methods to breed drought-tolerant alfalfa is of great significance, which can improve productivity, save resources, protect the environment and adapt to climate change, and contribute to the sustainable development of agriculture and animal husbandry.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The purpose of the present invention is to provide an alfalfa MsRCAR1 gene and its application in plant drought resistance.

[0008] The present invention is achieved in that:

[0009] In a first aspect, an embodiment of the present invention provides a MsRCAR1 protein, whose amino acids have at least 80% identity with the sequence shown in SEQ ID NO:1.

[0010] In a second aspect, an embodiment of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding the MsRCAR1 protein described in the preceding embodiment.

[0011] In a third aspect, an embodiment of the present invention provides a vector comprising the isolated nucleic acid molecule described in the preceding embodiment.

[0012] In a fourth aspect, an embodiment of the present invention provides a recombinant cell or a recombinant bacterium, which contains the isolated nucleic acid molecule described in the preceding embodiments or the vector described in the preceding embodiments.

[0013] In a fifth aspect, an embodiment of the present invention provides a method for preparing the MsRCAR1 protein as described in the preceding embodiments, comprising: culturing the recombinant cells or recombinant bacteria described in the preceding embodiments or artificially synthesizing the MsRCAR1 protein described in the preceding embodiments.

[0014] In a sixth aspect, the embodiments of the present invention provide the use of the MsRCAR1 protein as described in the preceding embodiments, or the isolated nucleic acid molecule as described in the preceding embodiments, or the vector as described in the preceding embodiments, or the recombinant cell or recombinant bacteria as described in the preceding embodiments in improving plant stress resistance or improving microbial stress resistance.

[0015] In a seventh aspect, an embodiment of the present invention provides a method for improving plant stress resistance, comprising: increasing the activity and / or expression level of MsRCAR1 protein in a target plant; the amino acid sequence of the MsRCAR1 protein has at least 80% identity with the sequence shown in SEQ ID NO:1.

[0016] The present invention has the following beneficial effects:

[0017] The MsRCAR1 gene and its encoded protein cloned from the legume plant alfalfa in the present application have an increased expression level under the induction of drought stress. After the MsRCAR1 gene is transferred into the target plant, the stress resistance (including drought resistance) of the target plant can be effectively improved. It can optimize plant varieties and enhance the plant's tolerance to drought stress without changing the basic physiological structure and nutritional value of the plant, providing a new way to cultivate varieties with enhanced drought tolerance and expand their production and planting scale. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0019] Figure 1 The diagram is a result of phylogenetic analysis of the amino acid sequences encoded by MsRCAR1 and Arabidopsis thaliana and Medicago truncatula PYL genes in Example 1;

[0020] Figure 2 The figure is a Real-time PCR expression result diagram of the MsRCAR1 gene under stress induction in Example 2; wherein A is the expression of the aboveground and underground MsRCAR1 proteins at various time points under the condition of a final concentration of mannitol of 400 mM; B is the expression of the aboveground and underground MsRCAR1 proteins at various time points under the condition of a final concentration of plant hormone abscisic acid of 80 μM;

[0021] Figure 3 This is the result diagram of the subcellular localization of MsRCAR1 in tobacco leaves in Example 3;

[0022] Figure 4 The results of molecular detection of target genes in transgenic Arabidopsis in Example 4 are shown in Figure A; wherein A is an electrophoresis diagram; Marker is DL2000, (+) is a positive control, (-) is a water control, (WT) is a wild-type plant control, and OE1-16 is a T3 generation homozygous strain; B is the result of qRT-PCR; WT is a wild-type, and OE1-16 is a T3 generation overexpression homozygous strain;

[0023] Figure 5 The germination conditions of the wild type and transgenic strains in Example 4 in MS medium, MS medium containing 400 mM and 500 mM mannitol are compared; A is the germination phenotype of seeds, B is the green seedling phenotype of seeds, and C is the statistical results of germination rate and green seedling rate;

[0024] Figure 6 The figures are the comparison results of the growth of the T3 homozygous strains OE6, OE9, OE11 and the wild-type strain WT in Example 4 during the dehydration treatment and three days after rehydration; wherein A is the plant growth status under continuous drought, B is the survival rate statistics of each strain, and C is the relative soil water content under continuous drought;

[0025] Figure 7 Comparison of drought survival rates between MsRCAR1-overexpressing Arabidopsis and MsPYL2-overexpressing Arabidopsis; A is the growth phenotype of Arabidopsis, and B is the survival rate statistics of Arabidopsis;

[0026] Figure 8 The comparison of the water loss rate of the detached leaves between alfalfa OE and the wild type in Example 5; A is the continuous water loss phenotype of the leaves of each strain, and B is the water loss rate statistics;

[0027] Fig. 9 The figure shows the comparison of the growth status of OE and WT strains under normal growth conditions in Example 5. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0029] In one aspect, an embodiment of the present invention provides a MsRCAR1 protein, whose amino acids have at least 80% identity with the sequence shown in SEQ ID NO:1.

[0030] On the other hand, an embodiment of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding the MsRCAR1 protein described in any of the preceding embodiments.

[0031] In some embodiments, the nucleic acid molecule can be a gene encoding MsRCAR1 protein or its CDS region.

[0032] In some embodiments, the nucleic acid molecule comprises a sequence that is at least 80% identical to the sequence shown in SEQ ID NO:2.

[0033] In some embodiments, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO:2.

[0034] In some embodiments, the at least 80% identity refers to 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 100% or any two of the identity. Alternatively, one or more amino acids may be substituted, deleted or added to form an amino acid sequence with non-100% identity.

[0035] Further, the primers contained in the primer pair for amplifying any fragment of the above nucleic acid molecule include at least one primer sequence in the primer sequences shown in SEQ ID No: 3 to SEQ ID No: 8. Among them, SEQ ID No: 3 and SEQ ID No: 4 correspond to primers for constructing a vector for overexpression of the alfalfa MsRCAR1 gene, SEQ ID No: 5 and SEQ ID No: 6 correspond to primers for qPCR of the alfalfa MsRCAR1 gene, and SEQ ID No: 7 and SEQ ID No: 8 correspond to primers for constructing a vector for subcellular localization of the alfalfa MsRCAR1 gene. The corresponding amplification method is PCR amplification, and the specific amplification conditions can refer to the prior art, and will not be described in detail here.

[0036] On the other hand, an embodiment of the present invention provides a vector comprising the isolated nucleic acid molecule described in any of the preceding embodiments.

[0037] In some embodiments, the vector includes a cloning vector and an expression vector. A recombinant vector containing the isolated nucleic acid molecule encoding the MsRCAR1 protein can be constructed using a plant expression vector. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1300, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb, etc.

[0038] On the other hand, an embodiment of the present invention provides a recombinant cell or a recombinant bacterium, which contains the isolated nucleic acid molecule described in any of the foregoing embodiments or the vector described in any of the foregoing embodiments.

[0039] In some embodiments, the recombinant bacteria may be bacteria or fungi. The bacteria may be Agrobacterium and Escherichia coli; the fungi may be yeast.

[0040] In some embodiments, the recombinant cell comprises a transgenic cell line.

[0041] On the other hand, an embodiment of the present invention provides a method for preparing the MsRCAR1 protein as described in any of the foregoing embodiments, comprising: culturing the recombinant cell or recombinant bacteria described in any of the foregoing embodiments or artificially synthesizing the MsRCAR1 protein described in any of the foregoing embodiments.

[0042] Based on the amino acid sequence of the protein disclosed in the present invention, it is easy for those skilled in the art to conceive of using genetic engineering technology or other technologies (chemical synthesis, recombinant expression) to prepare the protein, for example, separating and purifying the protein from the culture product of a recombinant cell or recombinant bacteria that can recombinantly express the protein as described in any of the above items, which is easy to achieve for those skilled in the art. Based on this, no matter what technology is used to prepare the MsRCAR1 protein of the present invention, it belongs to the protection scope of the present invention.

[0043] On the other hand, an embodiment of the present invention provides the use of the MsRCAR1 protein as described in any of the preceding embodiments, or the isolated nucleic acid molecule as described in any of the preceding embodiments, or the vector as described in any of the preceding embodiments, or the recombinant cell or recombinant bacteria as described in any of the preceding embodiments in improving plant stress resistance or improving microbial stress resistance.

[0044] In some embodiments, the stress resistance includes drought resistance. "Drought resistance" refers to the ability to resist water loss stress, specifically, water loss stress is a natural stress that is the same or equivalent to the simulated stress with a final mannitol concentration of 400-500 mM.

[0045] In some embodiments, the plant can be a dicot or a monocot.

[0046] In some embodiments, the plant comprises Arabidopsis thaliana, tobacco, or leguminous plants.

[0047] In some embodiments, the legume comprises alfalfa.

[0048] In some embodiments, the microorganism comprises bacteria.

[0049] In some embodiments, the microorganism comprises Escherichia coli or Agrobacterium.

[0050] On the other hand, an embodiment of the present invention provides a method for improving plant stress resistance, comprising: increasing the activity and / or expression level of MsRCAR1 protein in a target plant; the amino acid sequence of the MsRCAR1 protein has at least 80% identity with the sequence shown in SEQ ID NO: 1. The at least 80% identity may specifically be any one of 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 100%, or any two of the identities.

[0051] In some embodiments, the stress resistance and the plant are the same as those described in any of the above embodiments and will not be repeated herein.

[0052] In some embodiments, the expression level includes protein expression level and / or gene expression level.

[0053] In some embodiments, the step of increasing the protein activity and / or expression level of the MsRCAR1 protein in the target plant comprises: inserting a nucleic acid molecule encoding the MsRCAR1 protein into the genome of the target plant.

[0054] In some embodiments, the method further comprises: artificially cultivating transgenic plant seeds obtained by inserting the nucleic acid molecule encoding the MsRCAR1 protein into the genome of the target plant or allowing the transgenic plant seeds to grow naturally.

[0055] In some embodiments, the sequence of the nucleic acid molecule encoding the MsRCAR1 protein has at least 80% identity with the sequence shown in SEQ ID NO: 2. The at least 80% identity may specifically be 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 100% or any two of the identities.

[0056] It should be noted that the contents related to coding, recombination, expression, etc. that are not mentioned and disclosed in this application can be referred to the relevant existing technologies and will not be elaborated here.

[0057] The technical solution provided in this application can optimize plant varieties genetically, improve the plant's tolerance to drought stress without changing the basic physiological structure and nutritional value of the plant, and allow the plant to grow close to normal when the current living status cannot be changed, which is conducive to promoting the development of animal husbandry, agriculture and forestry.

[0058] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0059] Example 1: Cloning and sequencing of the MsRCAR1 gene

[0060] Plant material: Alfalfa Zhongmu No. 1.

[0061] Under normal conditions, healthy and plump seeds were germinated in a culture dish covered with double-layer filter paper for 5 days. When the cotyledons of the seedlings unfolded, they were transferred to the prepared MS nutrient solution with a pH of 5.8. After 7 days of cultivation, NaCl was added to the MS nutrient solution to a final concentration of 150 mM, treated for 24 hours, and quickly sampled, frozen in liquid nitrogen, and stored at -80°C for later use.

[0062] The RNA of the samples was extracted by Trizol extraction method and then reverse transcribed into cDNA using cDNA first-strand synthesis kit.

[0063] The total volume of the PCR detection system was 50 μL, and the system was 5×Phusion HF Buffer 10 μL, cDNA 1 μL, 2.5 mM dNTP 4 μL, Phusion DNA Polymerase 0.5 μL, ddH2O 32.5 μL, primer (SEQ ID No.3) MsRCAR1-F (5'-3'): GCGGATCCATGGCTTTGGTGCATAATATTCA 1 μL and primer (SEQ ID No.4) MsRCAR1-R (5'-3'): GCGAGCTCTTTATTGTCCATGCATGGAAGAA 1 μL. The reaction procedure was as follows: first round: 98°C pre-denaturation for 30 s; second round: 98°C denaturation for 10 s, 58°C annealing for 30 s, 72°C extension for 10 s, second round cycle 35 times; third round: 72°C extension for 5 min; 4°C termination, the reaction was complete.

[0064] The results of electrophoresis in 1.5% agarose gel were tested, and the length of the target fragment was 586 bp. The DNA fragment of the gene was recovered and double-digested with the expression vector pBI121. BamH I and Sac I were selected as the restriction sites. The restriction results were confirmed by gel electrophoresis, and then the product was recovered using the EasyPure gel recovery kit (EG101, Beijing Quanshijin Biotechnology Co., Ltd.). Finally, the target fragment after restriction digestion was connected to the expression vector using T4 DNA ligase (M0202, New England Biolabs Beijing Co., Ltd.), and transferred into Escherichia coli DH5α competent cells, evenly spread on LB resistance plates containing Kan, and cultured in a 37°C incubator overnight. The appropriate positive clone plaques were detected and selected, and picked into a liquid culture medium containing Kan resistance, and cultured overnight in a 37°C shaker at 200 rpm.

[0065] After the bacterial solution was tested, it was sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the colony had the nucleotide sequence in SEQ ID No: 2, which was named MsRCAR1 gene, and the protein encoded by the gene was named MsRCAR1 protein. The amino acid sequence of the protein is shown in SEQ ID No: 1. The results of the phylogenetic analysis of the amino acid sequences encoded by the PYL genes of MsRCAR1 and Arabidopsis and Medicago truncatula are shown in Figure 1. Figure 1 .

[0066] Example 2: Real-time fluorescence quantitative PCR analysis of the expression characteristics of the MsRCAR1 gene

[0067] The germination and hydroponic culture of alfalfa seeds were the same as those in Example 1.

[0068] 12-day-old alfalfa seedlings were used for stress treatment:

[0069] Drought treatment: Mannitol was added to the MS hydroponic nutrient solution to a final concentration of 400 mM, and the treatment time was 0, 1, 3, 6, 12 and 24 h. The samples were quickly sampled, frozen in liquid nitrogen, and stored at -80 °C for later use.

[0070] Plant hormone abscisic acid treatment: plant hormone abscisic acid was added to the MS hydroponic nutrient solution to a final concentration of 80 μM, and the treatment time was 0, 1, 3, 6, 12 and 24 h. The samples were quickly sampled, frozen in liquid nitrogen, and stored at -80°C for later use.

[0071] The sample RNA extraction and reverse transcription cDNA method are the same as in Example 1. The cDNA was diluted to 50 ng / μL. The sample was amplified and detected with (SEQ ID No. 5) qRTMsRCAR1-F (5'-3'): TGGCTTTGGTGCATAATATTCAAGGTCTAA and (SEQ ID No. 6) qRTMsRCAR1-R (5'-3'): TGTGTTTGAGGTTGGTTCTAGTATGTGGTA, and MsACTIN-F (5'-3'): GACAATGGAACTGGAATGG and MsACTIN-R (5'-3'): CAATACCGTGCTCAATGG as internal references.

[0072] The total volume of the qRT-PCR detection system was 10 μL, and the system was 2×SYBR qPCR Mix 5 μL, cDNA 1 μL, primer qRTMsRCAR1-F 0.2 μL, primer qRTMsRCAR1-R 0.2 μL, and RNase-Free ddH2O 3.6 μL. The reaction procedure was as follows: first round: 94°C pre-denaturation for 3 min; second round: 94°C denaturation for 10 s, 60°C annealing for 30 s, second round cycle 40 times, and the reaction was completed.

[0073] The instrument was Bio-Rad CFX96 real-time fluorescence quantitative PCR instrument, and the plotting software was Origin 2022. The method for calculating relative expression was 2 -△△Ct Method. △△Ct=(Ct 目的基因 -Ct 内参基因 ) Time x -(Ct 目的基因 -Ct 内参基因 ) Time 0; Time x represents the adversity treatment time, that is, x represents 1, 3, 6, 12 or 24 hours. Time 0 means no adversity treatment.

[0074] The experimental results are as follows Figure 2The results showed that the MsRCAR1 gene was induced by mannitol and abscisic acid in both the aboveground and underground parts of alfalfa, indicating that the gene level of MsRCAR1 was affected under adverse conditions, but the degree of influence aboveground and underground was different.

[0075] Example 3: Analysis of MsRCAR1 subcellular localization

[0076] 1. Material Preparation

[0077] The plant material in this example is Nicotiana benthamiana. Under normal conditions, healthy and plump seeds are soaked in distilled water in a centrifuge tube for 2 hours, and 2-3 seeds are scattered in each hole in the plug tray. After 6-7 weeks, the tobacco can be infected.

[0078] 2. Construction of subcellular vectors

[0079] Primers MsRCAR1-GFP-F and MsRCAR1-GFP-R were designed according to the sequence of the MsRCAR1 gene, and Xho I and Spe I restriction sites were introduced at the 5' end of the primers, respectively: (SEQ ID No.7) MsRCAR1-GFP-F (5'-3'): CCCTCGAGATGGCTTTGGTGCATAATATTCA, (SEQ ID No.8) MsRCAR1-GFP-R (5'-3'): GGACTAGTCCTTGTCCATGCATGGAAGAACAT.

[0080] Using the cDNA of alfalfa in Example 1 as a template, PCR amplification was performed using MsRCAR1-GFP-F and MsRCAR1-GFP-R. The total volume of the PCR amplification system was 50 μL, including 10 μL of 5×Phusion HF Buffer, 1 μL of cDNA, 4 μL of 2.5 mM dNTP, 0.5 μL of Phusion DNA Polymerase, 32.5 μL of ddH2O, 1 μL of primer MsRCAR1-GFP-F and 1 μL of primer MsRCAR1-GFP-R. The reaction procedure was as follows: first round: 98°C pre-denaturation for 30 s; second round: 98°C denaturation for 10 s, 58°C annealing for 30 s, 72°C extension for 10 s, and 35 cycles of the second round; third round: 72°C extension for 5 min; 4°C termination, the reaction was complete.

[0081] The result of electrophoresis in 1.5% agarose gel was 585 bp in length. The PCR amplification product was recovered and purified: the PCR product was digested with restriction endonucleases Xho I and Spe I, and the size of the digested product was 579 bp; similarly, the pBI121-GFP expression vector was digested with restriction endonucleases Xho I and Spe I, and the size of the digested product was 14 kb.

[0082] The digested product of the target gene and the digested product of the pBI121-GFP expression vector were connected with DNA ligase (Takara, catalog number: 6022). The heat shock ligation product was transferred into E. coli DH5α competent cells, cultured overnight in a 37°C incubator, and the appropriate positive clone plaques were detected and selected for sequencing. The positive clone colony with the MsRCAR1 sequencing sequence completely consistent with its CDS sequence was selected to extract the plasmid, and then transferred into Agrobacterium EHA105 to obtain recombinant Agrobacterium EHA105 / pBI121-Pro35S:MsRCAR1:GFP. The bacterial solution was evenly mixed with 50% glycerol in a volume ratio of 1:1, quick-frozen in liquid nitrogen, and stored at -80°C for later use.

[0083] Take the recombinant Agrobacterium from -80°C and place it on ice. Pick out some of the frozen bacterial blocks and add them to 3 mL of LB liquid. The resistance is rifampicin (Rif) and Kan. Shake in a shaker at 28°C and 200 rpm for 24 h.

[0084] Take 50 μL of bacterial solution and add it to 100 mL of LB liquid, with resistance to Rif and Kan, shake it in a shaker at 28°C and 200 rpm for 16-20 hours until OD 600 =0.5-1. Centrifuge part of the bacterial solution at 4500g for 15 min, discard the LB liquid, and resuspend and dilute with MS resuspension solution to OD 600 =0.4-0.6, resuscitated at 28°C and 120rpm for 2-3h, then injected into tobacco leaves.

[0085] Transform tobacco leaves by injection: Water the tobacco leaves with plenty of water the day before injection and culture them under light for 2-3 hours to keep them healthy and plump. Use a 1mL syringe to inject the bacteria into the leaves from the back of the tobacco leaves without veins. Do not have too many injection holes on the leaves. After injection, keep them in the dark for 24 hours, then grow them under light for 24-48 hours before slicing and observing. Use a fluorescence microscope or a laser confocal microscope.

[0086] Observation method: Take a small piece of healthy leaf near the injection hole and place it on a slide. Observe it under a fluorescence microscope first. If there is expression, take a picture with a confocal microscope. Use tobacco transfected with plasma membrane marker (PM, RFP) as a positive control.

[0087] The results are as follows Figure 3 As shown, from left to right are the GFP fluorescence image of MsRCAR1, the fluorescence image of the plasma membrane marker, the bright field image and the overlap image.

[0088] The above results showed that the MsRCAR1 gene was located in the cytoplasm and cell membrane.

[0089] Example 4: Application of MsRCAR1 in improving stress resistance of Arabidopsis

[0090] It should be noted that Arabidopsis thaliana was used as a model plant to conduct functional analysis and verification of the MsRCAR1 gene, and the conclusions can be considered equivalent to the molecular mechanism by which MsRCAR1 in alfalfa regulates plant response to drought.

[0091] 1. Preparation of MsRCAR1-overexpressing Arabidopsis

[0092] 1. Construction of recombinant vector

[0093] 1) Cloning of MsRCAR1 gene

[0094] Primers MsRCAR1-F and MsRCAR1-R were designed according to the sequence of the MsRCAR1 gene, and BamH I and Sac I restriction sites were introduced into the 5' end of the primers, respectively: (SEQ ID No. 3) MsRCAR1-F (5'-3'): GCGGATCCATGGCTTTGGTGCATAATATTCA, (SEQ ID No. 4) MsRCAR1-R (5'-3'): GCGAGCTCTTATTGTCCATGCATGGAAGAA.

[0095] Using the cDNA of alfalfa in Example 1 as a template, PCR amplification was performed using MsRCAR1-F and MsRCAR1-R. The total volume of the PCR amplification system was 50 μL, including 10 μL of 5×Phusion HF Buffer, 1 μL of cDNA, 4 μL of 2.5 mM dNTP, 0.5 μL of Phusion DNA Polymerase, 32.5 μL of ddH2O, 1 μL of primer MsRCAR1-F and 1 μL of primer MsRCAR1-R. The amplification conditions were as follows: first round: 98°C pre-denaturation for 30 s; second round: 98°C denaturation for 10 s, 58°C annealing for 30 s, 72°C extension for 10 s, 35 cycles in the second round; third round: 72°C extension for 5 min; 4°C termination, the reaction was complete.

[0096] 2) Enzyme digestion of MsRCAR1 gene and expression vector

[0097] The results of electrophoresis in 1.5% agarose gel were used to detect the length of the target gene, which was 586 bp. The DNA fragment of the gene was recovered and double-digested with the expression vector pBI121. The restriction sites were BamH I and Sac I. The restriction results were confirmed by gel electrophoresis, and then the product was recovered using the EasyPure gel recovery kit (EG101, Beijing Quanshijin Biotechnology Co., Ltd.).

[0098] 3) Ligation of MsRCAR1 gene and expression vector

[0099] The target fragment after enzyme digestion was connected to the expression vector using T4 DNA ligase (M0202, New England Biolabs Beijing Co., Ltd.), transferred into Escherichia coli DH5α competent cells, evenly spread on LB resistance plates containing Kan, cultured overnight in a 37°C incubator, detected and selected appropriate positive clone plaques, selected into liquid culture medium containing Kan resistance, and cultured overnight in a 37°C shaker at 200rpm. After the bacterial solution was detected to be appropriate, it was sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The positive clone colony plasmid that was completely consistent with the CDS sequence of the MsRCAR1 gene was obtained.

[0100] 4) Obtaining recombinant Agrobacterium

[0101] The recombinant pBI121-Pro35S:MsRCAR1 vector was used to transform Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens EHA105 / pBI121-Pro35S:MsRCAR1. The bacterial solution was mixed with 50% glycerol at a volume ratio of 1:1, quick-frozen in liquid nitrogen, and stored at -80°C for later use.

[0102] 2. MsRCAR1 overexpression in Arabidopsis

[0103] The recombinant Agrobacterium was taken out from -80°C and placed on ice. Some of the frozen bacterial blocks were picked and placed in 3 mL of LB liquid with resistance to Rif and Kan, and shaken at 28°C and 200 rpm for 24 h.

[0104] Take 2 mL of bacterial solution and add it to 200 mL of LB liquid. The resistance is Rif and Kan. Incubate at 28°C and 200

[0105] Shake at rpm for 20-24h until OD 600 =1.2-2.0.

[0106] Take part of the bacterial solution and centrifuge it at 4500g for 15 min. Pour away the LB liquid, resuspend it with 5% sucrose and dilute it to OD 600 =0.8 flowers are soaked in the infection liquid.

[0107] Soak the inflorescence of Arabidopsis thaliana (Columbia ecotype Co1-0) (the fruit pods can be cut off two days before to improve the transfection efficiency) in the invasion dye solution for 3-5 seconds; after soaking, take out the flower pot, keep it in the dark for 24 hours, and continue to cultivate in the greenhouse. Infect for the second time one week later.

[0108] The T1 generation seeds were harvested, and positive plants were screened with kanamycin (Kan, 50 mg / mL) and subcultured until the T3 generation homozygous strains were obtained. The T2 generation refers to the seeds produced by self-pollination of the T1 generation and the plants grown from the seeds, and the T3 generation refers to the seeds produced by self-pollination of the T2 generation and the plants grown from the seeds.

[0109] The whole plant DNA of the T3 generation regenerated plant was used as a template, and PCR amplification was performed using the target gene primers (SEQ ID No. 9) 35S-F (5'-3'): CTATCCTTCGCAAGACCCTT and (SEQ ID No. 4) MsRCAR1-R (5'-3'): GCGAGCTCTTATTGTCCATGCATGGAAGAA, and Kan primers (SEQ ID No. 10) NPTII-F (5'-3'): CAATCCACATCGGCCAGAT and (SEQ ID No. 11) NPTII-R (5'-3'): AGCTGCCTGTTCCAAAGG. The PCR detection system and amplification conditions of the target gene and Kan gene were consistent. The PCR detection system was as follows: the total volume of PCR was 20 μL, including 10 μL of 2×F8 PCR MasterMix, 1 μL of upstream primer, 1 μL of downstream primer, 6 μL of ddH2O and 2 μL of DNA template (50 ng / μL); the amplification conditions were as follows: (1) pre-denaturation at 94°C for 4 min; (2) denaturation at 94°C for 30 s; (3) annealing at 52°C for 30 s; (4) extension at 72°C for 10 s; (5) 2-4 steps were cycled 35 times; and (6) extension at 72°C for 5 min.

[0110] The results are as follows Figure 4 As shown in A in FIG. The results in this figure show that a single band was amplified at 655 bp in 16 homozygous strains of the T3 generation, and the amplified resistance gene Kan also had a band.

[0111] Randomly selected strains were used to extract RNA from the whole plant of the T3 generation regenerated plants, and reverse transcribed into cDNA as a template. qRT-PCR amplification was performed using the target gene partial fragment primer pairs qRTMsRCAR1-F and qRTMsRCAR1-R, as well as the internal reference gene pairs AtACTIN-F (5'-3') tgtgccaatctacgagggttt and AtACTIN-R (5'-3') tttcccgctctgctgttgt.

[0112] The qRT-PCR system included 2×SG Fast qPCR Master Mix 10 μL, primer qRTMsRCAR1-F 0.5 μL, primer qRTMsRCAR1-R 0.5 μL, DNF buffer 2 μL, ddH2O 5 μL and cDNA 2 μL, with a total volume of 20 μL. The qRT-PCR amplification conditions were as follows: (1) pre-denaturation at 95°C for 10 min; (2) denaturation at 95°C for 15 s; (3) annealing at 60°C for 1 min; (4) steps (2) to (3) were cycled 40 times.

[0113] The results are as follows Figure 4 As shown in B. The results showed that MsRCAR1 was not expressed in the wild-type strain (Col-0), but was expressed to varying degrees in the overexpression homozygous strains. Three high-expression strains were selected from the homozygous strains for subsequent physiological analysis.

[0114] 2. Evaluation of stress resistance of transgenic plants

[0115] 1. Evaluation of the water loss resistance of transgenic plants

[0116] 1) Effect of drought stress on germination rate

[0117] After disinfection, 50 seeds of each of three representative homozygous lines of T3 generation MsRCAR1 overexpressing Arabidopsis, OE6, OE9, OE11 and wild type Col-0, were evenly spotted on MS medium and MS medium containing 400mM and 500mM mannitol using a 10μL pipette tip, sealed with a sealing film, and treated at 4℃ for 3d. They were then moved into an incubator at 22℃, 16h light / 8h dark, and 60% relative humidity for 7d. The germination rate was counted every day, and three biological replicates were set for each treatment. The results were averaged and the standard deviation was calculated.

[0118] The results are as follows Figure 5 As shown: This figure compares the germination of wild-type and overexpression strains in MS medium and MS medium containing 400mM and 500mM mannitol. On MS plates, the germination rate and germination speed of wild-type and overexpression strains are basically the same; while on 400mM and 500mM mannitol plates, the germination rate and germination speed of overexpression Arabidopsis strains are significantly greater than those of wild-type.

[0119] 2) Effect of soil dehydration on resistance of transgenic plants

[0120] The plant materials were three representative homozygous strains of T3 generation MsRCAR1 overexpressing Arabidopsis, OE6, OE9, OE11, and wild type Col-0. After the seeds of each strain were sterilized, healthy and plump seeds were selected, and evenly dotted on the culture medium with a 10μL pipette tip, sealed with a sealing film, and moved into an incubator at 22°C, 16h light / 8h dark, and 60% relative humidity for 14 days after vernalization. The seedlings were moved to small square pots, with 6 seedlings per pot. The soil weight of each pot was consistent and water was absorbed to saturation and then cut off. The dehydration treatment was carried out for 35 days, and then rehydrated. During this period, the plant phenotype was continuously observed and photographed ( Figure 6 shown).

[0121] Figure 6 The results are a comparison of the growth of the T3 homozygous strains OE6, OE9, OE11 and the wild-type strain WT during the dehydration treatment and three days after rehydration. The results show that as the degree of dehydration increases, the growth of the wild type is significantly weaker than that of the overexpression strain; after rehydration, the survival rate of the wild type is lower than that of the overexpression strain.

[0122] Figure 7 The drought survival rate of MsRCAR1-overexpressing Arabidopsis and MsPYL2-overexpressing Arabidopsis is compared. The results show that after 20 days of drought, the growth and survival rate of MsRCAR1-overexpressing Arabidopsis are better than those of MsPYL2-overexpressing Arabidopsis. MsRCAR1 and MsPYL2 belong to the same gene family, and their phenotypic comparison also proves that MsRCAR1 is more effective in improving the stress resistance of Arabidopsis. Therefore, the method provided in this application can enhance the drought resistance of Arabidopsis, which can also be extended to the method that can also enhance the drought resistance of alfalfa.

[0123] Example 5: Application of MsRCAR1 in improving stress resistance of alfalfa

[0124] 1. Preparation of MsRCAR1-overexpressing alfalfa

[0125] 1. Construction of recombinant vector

[0126] It is the same as the recombinant vector used in the preparation of MsRCAR1 overexpression Arabidopsis.

[0127] 2. Obtaining MsRCAR1-overexpressing alfalfa

[0128] Take out the recombinant Agrobacterium from -80°C and place it on ice. The recombinant Agrobacterium is: EHA105 / pBI121-Pro35S:MsRCAR1;

[0129] Pick up some frozen bacterial blocks and put them into 3 mL LB liquid with resistance to Rif and Kan, and shake at 28°C and 200 rpm for 24 h.

[0130] Take 0.5 mL of bacterial solution and add it to 200 mL of LB liquid, with resistance to Rif and Kan, shake at 28°C and 200 rpm for 15 h until OD 600 =0.6-0.8.

[0131] Take part of the bacterial solution and centrifuge it at 4500g for 15 min. Pour away the LB liquid and resuspend and dilute it with SM4 liquid to OD 600 =0.2-0.4 infection solution. Wash and disinfect the alfalfa leaves, soak them in the infection solution, vacuum for 10 minutes, ultrasonically clean for 3-5 minutes, and vacuum again for 10 minutes.

[0132] After infection, the leaves were aired until there was no obvious moisture on the surface, placed in SM4 solid culture medium for dark culture for 2-3 days, transferred to SM4 selective culture medium containing cephalosporin (Cef, 200 mg / mL), ticarcillin disodium / clavulanate potassium (Tim, 200 mg / mL) and kanamycin (Kan, 50 mg / mL), subcultured every 14 days, and selectively cultured for 4-6 weeks.

[0133] The resistant callus was transferred to MSBK medium containing cephalosporin (Cef, 200 mg / mL), ticarcillin disodium / clavulanate potassium (Tim, 200 mg / mL) and kanamycin (Kan, 50 mg / mL), subcultured every 14 days and cultured for about 4 weeks, with the appearance of obvious resistant buds as the standard.

[0134] The embryonic callus with differentiated buds was transferred to SH9 medium containing cefotaxime (Cef, 200 mg / mL), ticarcillin disodium / clavulanate potassium (Tim, 200 mg / mL) and kanamycin (Kan, 50 mg / mL), subcultured every 3-4 weeks, and cultured for 8-12 weeks, with the differentiated buds growing normal three leaves and partial rooting as the standard. The rooted seedlings were transferred to MS0 medium and cultured for 6-8 weeks. After strong roots grew, they could be transplanted.

[0135] The regenerated plants were screened positively and the expression level was identified. The specific method was the same as the screening and identification method for Arabidopsis plants. Positive plants with higher expression levels were selected for subsequent experiments.

[0136] 2. Evaluation of water loss rate of detached leaves of transgenic alfalfa

[0137] Collect five to six three-leaf leaves of similar size and tenderness from alfalfa plants of uniform growth, weigh them immediately, and then place them on the laboratory bench and weigh them every 1 hour for a total of 8 hours. Set up at least 3 biological replicates for each strain. Calculate the relative water loss based on the initial weight of the leaf, leaf Time x water loss rate = (leaf Time 0 weight – leaf Time x weight) / leaf initial weight × 100%, Time x represents the in vitro time 1-8 hours, and the Time 0 water loss rate of each leaf is set to 0.

[0138] Figure 8 The results show that after the leaves were placed in vitro for 8 hours, the OE strain retained more water than the WT, indicating that the transgenic MsRCAR1 gene changed the permeability of the alfalfa leaf epidermis and enhanced the water retention capacity of alfalfa under adverse conditions.

[0139] 3. Evaluation of soil drought phenotype of transgenic alfalfa

[0140] Soil drought test was conducted on WT and OE alfalfa cuttings at the one-month-old seedling stage. The OE strain and WT plants were divided into three groups: WT and OE2, WT and OE7, and WT and OE9, with two plants from each strain, and each group was planted in the same seedling pot. The soil weight of each pot was consistent and water was absorbed to saturation and then cut off. Soil drought treatment was performed and the phenotype was observed ( Fig. 9 shown).

[0141] The results are as follows Fig. 9 As shown in the figure, under normal growth conditions, there was no significant difference in the growth status of OE and WT strains. On the 33rd day of drought treatment, the leaves of the plants began to wilt, and the degree of wilting of the OE strain was lower than that of the WT. As the drought treatment continued to the 39th day, the WT plants were severely water stressed, and most of the leaves completely curled and dried up. In contrast, the leaves of the OE plants could still maintain a certain green color, and the degree of curling due to water loss was significantly lower than that of the WT plants. After 9 days of rehydration, most of the WT plants failed to resume growth, while the OE plants resumed growth.

[0142] In continuation of the above, the embodiment of the present invention provides an MsRCAR1 protein with drought tolerance function. Through qRT-PCR experiments, it is determined that the expression of the MsRCAR1 gene is induced by drought stress. After the MsRCAR1 gene is overexpressed in Arabidopsis, it is found that the overexpressed Arabidopsis has stronger drought resistance than the wild-type Arabidopsis; in vitro leaf water loss rate analysis is performed in alfalfa, and it is found that the leaves of overexpressed alfalfa retain more water than the leaves of wild-type plants under drought conditions; soil drought phenotype evaluation is performed in alfalfa, and it is found that the overexpressed alfalfa grows better than the wild-type plants under drought conditions, and can recover to a good state after rehydration. Therefore, the study of drought resistance of the MsRCAR1 gene provides a new gene resource for the molecular design breeding of drought resistance in alfalfa, which has reference and reference significance for the cultivation and acquisition of drought-resistant plants and new varieties with enhanced functions.

[0143] In summary, the coding gene cloned from the legume plant alfalfa in this application increases in expression under the induction of drought and plant hormone abscisic acid, and the encoded protein is localized to the cytoplasm and cell membrane; after the coding gene is transferred into the plant, the drought resistance of the target plant can be improved. The drought-resistant protein obtained after encoding is conducive to the cultivation of plant varieties with stronger stress resistance or the transformation of stress resistance of other plants.

[0144] The stress resistance genes and drought-resistant proteins provided in this application provide ideas and methods for studying related drought-resistant regulatory genes, and have important reference and reference significance for cultivating and obtaining drought-resistant plants (such as Arabidopsis, tobacco or legumes), which is conducive to cultivating alfalfa with or enhancing drought tolerance, expanding the scale of alfalfa production and planting, and accelerating the development of animal husbandry industry.

[0145] The sequences involved in this application are as follows.

[0146]

[0147] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A MsRCAR1 protein, characterized in that Its amino acid sequence has at least 80% identity with the sequence shown in SEQ ID NO:

1.

2. An isolated nucleic acid molecule, characterized in that It comprises a nucleotide sequence encoding the MsRCAR1 protein according to claim 1; Optionally, the nucleic acid molecule comprises a sequence having at least 80% identity to the sequence shown in SEQ ID NO: 2; Optionally, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO:

2.

3. A carrier, characterized in that It comprises the isolated nucleic acid molecule according to claim 2.

4. A recombinant cell or recombinant bacterium, characterized in that: It contains the isolated nucleic acid molecule according to claim 2 or the vector according to claim 3.

5. The method for preparing the MsRCAR1 protein according to claim 1, characterized in that: It includes: Cultivate the recombinant cell or recombinant bacteria described in claim 4 or artificially synthesize the MsRCAR1 protein described in claim 1.

6. Use of the MsRCAR1 protein according to claim 1, the isolated nucleic acid molecule according to claim 2, the vector according to claim 3, or the recombinant cell or recombinant bacterium according to claim 4 in improving plant stress resistance or improving microbial stress resistance.

7. The use according to claim 6, characterized in that: The stress resistance includes drought resistance; Optionally, the plant comprises: Arabidopsis thaliana, tobacco or leguminous plants; Optionally, the legume includes alfalfa; Optionally, the microorganism comprises bacteria; Optionally, the microorganism comprises Escherichia coli or Agrobacterium.

8. A method for improving plant stress resistance, characterized in that: It includes: The activity and / or expression level of the MsRCAR1 protein in the target plant is improved; the amino acid sequence of the MsRCAR1 protein has at least 80% identity with the sequence shown in SEQ ID NO:

1.

9. The method according to claim 8, characterized in that The stress resistance includes drought resistance; Optionally, the plant comprises: Arabidopsis thaliana, tobacco or leguminous plants; Optionally, the legume comprises alfalfa.

10. The method according to claim 8 or 9, characterized in that: The expression level includes protein expression level and / or gene expression level; Optionally, the step of increasing the protein activity and / or expression level of the MsRCAR1 protein in the target plant comprises: inserting a nucleic acid molecule encoding the MsRCAR1 protein into the genome of the target plant; Optionally, the method further comprises: artificially cultivating transgenic plant seeds obtained by inserting the nucleic acid molecule encoding the MsRCAR1 protein into the genome of the target plant or allowing the transgenic plant seeds to grow naturally; Optionally, the sequence of the nucleic acid molecule encoding the MsRCAR1 protein has at least 80% identity with the sequence shown in SEQ ID NO:2.

Images