Monoclonal antibody of tyrosine iodination modified EGFR (epidermal growth factor receptor) protein, preparation method and application

Abstract

The invention relates to the technical field of biology, in particular to a monoclonal antibody of tyrosine iodination modified EGFR (epidermal growth factor receptor) protein as well as a preparation method and application of the monoclonal antibody. According to the invention, two monoclonal antibodies M018 and M025 with high sensitivity and specificity are obtained by preparing tyrosine iodized modified EGFR protein antigen peptides, immunizing mice to prepare monoclonal antibodies, panning by using a phage display technology, expressing related antibodies by using an expression vector, screening by using ELISA (Enzyme-Linked Immunosorbent Assay), and carrying out immunohistochemistry and cell fluorescence detection. The monoclonal antibody obtained through screening can be used for detection and monitoring of EGFR protein 845-site tyrosine iodination modification, and support is provided for tumor diagnosis and research and development of anti-tumor drugs.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a monoclonal antibody for tyrosine iodination-modified EGFR protein, a preparation method and an application thereof. Background Art

[0002] Protein phosphorylation is one of the most important modifications in the body. The protein phosphorylation sites of eukaryotic cells mainly occur at tyrosine, serine, and threonine. Tyrosine kinase is the largest known protein superfamily. Tyrosine kinase can catalyze the transfer of the γ-phosphate group on ATP to many substrate tyrosine residues, causing phosphorylation, thereby activating various substrate enzymes and their downstream signaling pathways, affecting cell proliferation, differentiation, adhesion, migration, invasion, and apoptosis.

[0003] Epidermal Growth Factor Receptor (EGFR) is a type of cell membrane surface receptor with tyrosine kinase activity. EGFR is an important target for promoting mitosis and transformation of tumor cells. The signal transduction mediated by EGFR is closely related to the growth, proliferation, and metastasis of tumor cells.

[0004] CN202310055904.3 discloses that when the expression of the sodium iodine transporter (NIS) of the cell is high, sodium iodide can significantly inhibit EGFR protein phosphorylation; when the expression of NIS of the cell is low, the iodine uptake function of NIS of the cell can be improved by the auxiliary agent KT5823, so that sodium iodide can enter the cell normally and significantly inhibit EGFR protein phosphorylation, and sodium iodide can significantly inhibit the phosphorylation of EGFR protein, and its phosphorylation sites 845 and 1068 can be significantly inhibited by sodium iodide, and sodium iodide can be used as an inhibitor of EGFR. However, for the purpose of monitoring the situation of iodination modification, in addition to traditional liquid chromatography and mass spectrometry, more detection methods need to be developed for the detection method of iodination modification of tyrosine. Summary of the invention

[0005] The purpose of the present invention is to provide a monoclonal antibody that can be rapidly, highly specific and sensitively modified with iodinated EGFR protein to meet the needs of detection and monitoring. Through extensive research and screening, the present invention achieves this purpose, and the scheme provided by the present invention is as follows:

[0006] A monoclonal antibody for tyrosine iodination-modified EGFR protein, the amino acid sequence of which is shown in SEQ ID NO.1 or SEQ ID NO.9.

[0007] A monoclonal antibody for tyrosine iodination-modified EGFR protein, the nucleotide sequence of which is shown in SEQ ID NO.2 or SEQ ID NO.10.

[0008] A nucleic acid vector comprising a nucleic acid sequence of a monoclonal antibody against tyrosine iodinated EGFR protein, wherein the nucleic acid sequence is shown in SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.17 or SEQ ID NO.19.

[0009] A method for preparing an iodinated EGFR protein monoclonal antibody, the method comprising recombinantly expressing a vector containing heavy chain and light chain sequences of the monoclonal antibody to the EGFR protein; preferably, the sequence of the light chain of the monoclonal antibody to the EGFR protein is as shown in SEQ ID NO.13 or SEQ ID NO.15; the sequence of the heavy chain of the monoclonal antibody to the EGFR protein is as shown in SEQ ID NO.17 or SEQ ID NO.19.

[0010] An application of an iodinated EGFR protein monoclonal antibody comprises combining the monoclonal antibody with the EGFR protein in a sample to detect whether the tyrosine at position 845 of the EGFR protein is iodinated.

[0011] The invention discloses an application of an iodinated EGFR protein monoclonal antibody in immunoassay, wherein the immunoassay includes one or more of immunohistochemistry, Western Blot, immune cell imaging, immunochemiluminescence, immunofluorescence, ELISA, immunolateral flow, immunoelectrochemistry, and fluorescence resonance energy transfer (FRET). It is well known to those skilled in the art that in immunoassay, a monoclonal antibody against an iodinated EGFR protein can be combined with a target sample to determine whether there is an EGFR protein iodinated with tyrosine at position 845 in the sample, and the content of the iodinated protein can also be determined. In some embodiments, a secondary antibody is also present to combine with the monoclonal antibody of the present invention. A marker molecule can also be modified on the antibody of the present invention for direct detection. In some embodiments, the interface change caused by the combination of antigen and antibody can be performed, and the combination of antigen and antibody can be reflected by detecting the change of the interface information, such as causing the change of the current signal of the interface, the change of the optical information of the interface, and the change of the structural information of the interface. The source of the sample can be blood, plasma, serum, cells, tissues, feces, urine, and saliva. The subject of the sample is a human or a mammal.

[0012] In one aspect of the present invention, the present invention discloses a reagent or a kit for detecting iodinated EGFR protein, wherein the reagent comprises a monoclonal antibody that specifically binds to iodinated tyrosine at position 845 of the EGFR protein. The amino acid sequence of the monoclonal antibody is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.11; preferably, the amino acid sequence of the monoclonal antibody is shown in SEQ ID NO.1 or SEQ ID NO.9.

[0013] In one embodiment, the reagent or kit is suitable for immunohistochemistry, Western Blot, immune cell imaging, immunochemiluminescence, immunofluorescence, ELISA, immunolateral flow, immunoelectrochemistry, fluorescence resonance energy transfer (FRET).

[0014] In one embodiment, immune cell imaging is used in multiple tumor cell models, including thyroid cancer cells, human placental choriocarcinoma cells, human esophageal cancer cells, and human gastric cancer cells.

[0015] Beneficial Effects

[0016] The present invention finally screened out the EGFR protein antibodies (M018 and M025) with high affinity and strong specificity for iodination modification of tyrosine 845 site for the first time through phage display technology. The provided antibodies can be used as a protein functional modification antibody in non-disease diagnosis and treatment research and development, and can also be used as a diagnostic antibody in the detection of iodination modification of tyrosine 845 site of EGFR. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The results of human thyroid cancer transplanted tumors detected by the immunohistochemical method provided in the embodiment of the present invention;

[0018] Figure 2 The results of human thyroid cancer tissue and human thyroid normal tissue detected by the immunohistochemical method provided in the embodiment of the present invention;

[0019] Figure 3 The specificity results of M018 and M025 antibodies for detecting human thyroid cancer B-Cpap cells by high-content live cell imaging provided in the embodiments of the present invention;

[0020] Figure 4 The antibody recognition specificity results of human thyroid cancer B-Cpap cells detected by the high-content live cell imaging method provided in the embodiment of the present invention;

[0021] Figure 5The antibody recognition specificity results of immortalized human thyroid Nthy-Ori-3-1 cells detected by the high-content live cell imaging method provided in the embodiments of the present invention;

[0022] Figure 6 The antibody recognition specificity results of human placental choriocarcinoma BeWo cells detected by the high-content live cell imaging method provided in the embodiments of the present invention;

[0023] Figure 7 The antibody recognition specificity results of human esophageal cancer TE-1 cells detected by the high-content live cell imaging method provided in the embodiment of the present invention;

[0024] Figure 8 The antibody recognition specificity results of human gastric cancer MKN-45 cells detected by the high-content live cell imaging method provided in the embodiments of the present invention. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with specific embodiments.

[0026] Embodiment 1:

[0027] Preparation of a monoclonal antibody targeting EGFR 845 site tyrosine iodination modification, the preparation method comprising:

[0028] (1) Synthesis of EGFR peptide antigen modified with iodination at position 845 of tyrosine: Synthesize the iodinated peptide EGFR(I): EKEY(I)HAEGGKVPC; at the same time, synthesize the EGFR peptide antigen modified with non-iodination at position 845 of tyrosine EGFR(no I): EKEYHAEGGKVPC.

[0029] (2) The synthesized iodinated modified peptide EGFR (I) and non-iodinated modified peptide EGFR (no I) were conjugated to BSA as immune antigens.

[0030] (3) The above-mentioned immune antigens were mixed and emulsified with Freund's complete adjuvant, and the experimental animals (Balb / c mice) were subcutaneously injected with multiple points (more than 8 points), with an immunization dose of 0.5 mg / mouse. The second immunization was performed two weeks later, and the area measurement was 0.5 mg / mouse. From the third immunization onwards, no adjuvant was added. After three immunizations, blood was collected from the tail and the serum titer was determined by gradient dilution by ELISA. The strength of the ELISA titer of 24W was used as the standard. If the titer requirement was not met, the immunization was continued. If the titer requirement was met, all blood samples of the mice were collected according to the titer results, and the serum was centrifuged and the spleen tissue was collected.

[0031] (4) Establish an antibody light chain and heavy chain ScFv phage display library through reverse transcription, in vitro gene amplification, and phagemid construction to prepare for the next step of panning.

[0032] (5) Target phage panning: Add the phage solution to a high-affinity ELISA plate coated with EGFR(I) antigen for panning, collect the eluted phages, rescue and amplify them, and obtain a phage primary screening library;

[0033] (6) Antibody DNA sequencing: After phage screening, the sequence of the candidate monoclonal antibody is obtained by antibody DNA sequencing.

[0034] (7) Construct an expression vector to express and purify the candidate antibody.

[0035] (8) Use ELISA to screen antibodies with high stability and affinity for antigenic proteins.

[0036] Results: 1.1 The specific sequences of several monoclonal clones screened out in step (6) are shown in Table 1.

[0037] Table 1 Sequence information of candidate antibodies

[0038]

[0039]

[0040]

[0041] 1.2 Taking M018 and M025 as examples, the construction of related antibody gene vectors is demonstrated:

[0042] 1) The VL nucleotide sequence of the M018 antibody obtained by sequencing and analysis is:

[0043] GATGTTTTGATGACCCAGACTCCACTCACTTTGTCGGTTACCATTGGACAACCAGCCTCCATCTCTTGCAAGTCAAGTCAGAGCCTCTTATATAGTGATGGCAAGACATATTTGAATTGGTTCTTACAGAGGCCAGGCCAGTCTCCAAAGCGCCTAATCTATCTGGTGTC TAAACTGGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGACAGATTTCACACTGAAAATCAGCAGATGGAGGCTGAGGATTTGGGAGTTTATTATTGCTCTCAAAGTACACGTTTTCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAA(SEQ ID NO.13)

[0044] The VL sequence information of the M018 antibody expression vector for construction is as follows:

[0045] atgggctggtcctgtatcatcctgttcctggtggctacagccacaggagtgcatagtGATGTTTTGATGACCCAGACTCCACTCACTTTGTCGGTTACCATTGGACAACCAGCCTCCATCTCTTGCAAGTCAAGTCAGAGCCTCTTATATAGTGATGGCAAGACATATTTGAATTGGTTCTTACAGAGGCCAGGCCAGTCTCCAAAGCGCCTAATCTATCTGGTGTCTAAACTGGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGACAGATTTCACACTGAAAATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATTATTGCTCTCAAAGTACACGTTTTCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAAcgggctgatgctgcaccaactgtatccatcttcccaccatccagtgagcagttaacatctggaggtgcctcagtcgtgtgcttcttgaacaacttctaccccaaagacatcaatgtcaagtggaagattgatggcagtgaacgacaaaatggcgtcctgaacagttggactgatcaggacagcaaagacagcacctacagcatgagcagcaccctcacgttgaccaaggacgagtatgaacgacataacagctatacctgtgaggccactcacaagacatcaacttcacccattgtcaagagcttcaacaggaatgagtgttaa(SEQ ID NO.14);

[0046] Among them, atgggctggtcctgtatcatcctgttcctggtggctacagccacaggagtgcatagt is the signal peptide sequence;

[0047] cgggctgatgctgcaccaactgtatccatcttcccaccatccagtgagcagttaacatctggaggtgcctcagtcgtgtgcttcttgaacaacttctaccccaaagacatcaatgtcaagtggaagattgatggcagtgaacgacaaaatggcgtcctgaacagt tggactgatcaggacagcaaagacagcacctacagcatgagcagcaccctcacgttgaccaaggacgagtatgaacgacataacagctatacctgtgaggccactcacaagacatcaacttcacccattgtcaagagcttcaacaggaatgagtgttaa is the constant region sequence.

[0048] 2) The VL nucleotide sequence of the M025 antibody obtained by sequencing and analysis is:

[0049] GATGTTGTGATGACCCAGACTCCACTCACTTTGTCGGTTACCATTGGACAACCAGCCTCCATCTCTTGCAAGTCAAGTCAGAGCTCTTAGATAGTGATGGAAAGACATATTTGAATTGGTTGTTACAGAGGCCAGGCCAGTCTCCAAAGCGCCTAATCTATCTGGTGTC TAAACTGGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGACAGATTTCACACTGAAAATCAGCAGATGGAGGCTGAGGATTTGGGAGTTTATTATTGCTGGCAAGGTACACATTTTCCTCGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA(SEQ ID NO.15)

[0050] The VL sequence information used to construct the M025 antibody expression vector is:

[0051] atgggctggtcctgtatcatcctgttcctggtggctacagccacaggagtgcatagtGATGTTGTGATGACCCAGACTCCACTCACTTTGTCGGTTACCATTGGACAACCAGCCTCCATCTCTTGCAAGTCAAGTCAGAGCCTCTTAGATAGTGATGGAAAGACATATTTGAATTGGTTGTTACAGAGGCCAGGCCAGTCTCCAAAGCGCCTAATCTATCTGGTGTCTAAACTGGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGACAGATTTCACACTGAAAATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATTATTGCTGGCAAGGTACACATTTTCCTCGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAAcgggctgatgctgcaccaactgtatccatcttcccaccatccagtgagcagttaacatctggaggtgcctcagtcgtgtgcttcttgaacaacttctaccccaaagacatcaatgtcaagtggaagattgatggcagtgaacgacaaaatggcgtcctgaacagttggactgatcaggacagcaaagacagcacctacagcatgagcagcaccctcacgttgaccaaggacgagtatgaacgacataacagctatacctgtgaggccactcacaagacatcaacttcacccattgtcaagagcttcaacaggaatgagtgttaa(SEQ ID NO.16).

[0052] 3) The VH nucleotide sequence of the M018 antibody obtained by sequencing and analysis is as follows:

[0053] GAGGTTCAGCTGCAGCAGTCTGCAGATGAACTGGCAAGACCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACAGTTTTACTGGTTACACGATACACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCCAGCAGTGGATATACTGAGTACAATCAGAAGTTCAAGGACAAGACCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGGCATCTGAGGACTCTGCGGTCTATTATTGTTCAAGATATAAAGGGGGCTATTGGGGCCAAGGCTCCACTCTCACAGTCTCCTCA(SEQ ID NO.17)

[0054] The VH sequence information for constructing the M018 antibody expression vector is as follows:

[0055]

[0056] Among them, atgggctggtccctgattctgctgttcctggtggctgtggctaccagggtgctgagt is a signal peptide,

[0057] gccaaaacaacagccccatcggtctatccactggcccctgtgtgtggagatacaactggctcctcggtgactctaggatgcctggtcaagggttatttccctgagccagtgaccttgacctggaactctggatccctgtccagtggtgtgcacaccttcccagctgtcctgcagtctgacctctacaccctcagcagctcagtgactgtaacctcgagcacctggcccagccagtccatcacctgcaatgtggcccacccggcaagcagcaccaaggtggacaagaaaattgagcccagagggcccacaatcaagccctgtcctccatgcaaatgcccagcacctaacctcttgggtggaccatccgtcttcatcttccctccaaagatcaaggatgtactcatgatctccctgagccccatagtcacatgtgtggtggtggatgtgagcgaggatgacccagatgtccagatcagctggtttgtgaacaacgtggaagtacacacagctcagacacaaacccatagagaggattacaacagtactctccgggtggtcagtgccctccccatccagcaccaggactggatgagtggcaaggagttcaaatgcaaggtcaacaacaaagacctgccagcgcccatcgagagaaccatctcaaaacccaaagggtcagtaagagctccacaggtatatgtcttgcctccaccagaagaagagatgactaagaaacaggtcactctgacctgcatggtcacagacttcatgcctgaagacatttacgtggagtggaccaacaacgggaaaacagagctaaactacaagaacactgaaccagtcctggactctgatggttcttacttcatgtacagcaagctgagagtggaaaagaagaactgggtggaaagaaatagctactcctgttcagtggtccacgagggtctgcacaatcaccacacgactaagagcttctcccggactccgggtaaatga is the constant region sequence.

[0058] 4) The VH nucleotide sequence of the M025 antibody obtained by sequencing and analysis is:

[0059] CAGGTGCAACTTCAGCAGTCTGGGACTGTGTTGGCAAGGCCTGGGGATTCCGTGAAGATGTCCTGCAAGACTTCTGGCTACAGGTTTACCAGACAGTGGATGCACTGGGTAAAACAGAGGCCTGGGCAGGGTCTAGAATGGATTGGTACTATTTATCCTGGAGATGGTGAT ACTAGATACAACCAGAAGTTCAAGGACAAGGCCAAACTGTCTGCAGTCACATCCGCCAGCACTGCCTACATGGAACTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGTTCAACTACGATAGTCCACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA(SEQ ID NO.19)

[0060] The VH sequence information used to construct the M025 antibody expression vector is:

[0061]

[0062] 5) PCR system reaction conditions:

[0063] component volume 2×KOD PCR Master mix 25μL Forward primer (10μM) 1μL Reward primer (10μM) 1μL template(10pg-200ng) ~1μL <![CDATA[ddH2O]]> ~22 μL

[0064] The primer sequences are as follows:

[0065] Primer name sequence Primer sequence number EGFR(I)-M018-VL-F cacaggagtgcatagtGATGTTTTGATGACCCC SEQ ID NO.21 EGFR(I)-M018-VL-R ttggtgcagcatcagcccgTTTTATTTCCAGCTTGGT SEQ ID NO.22 EGFR(I)-M018-VH-F taccagggtgctgagtGAGGTTCAGCTGCAGC SEQ ID NO.23 EGFR(I)-M018-VH-R gggctgttgttttggcTGAGGAGACTGTGAGAGT SEQ ID NO.24 EGFR(I)-M025-VL-F cacaggagtgcatagtGATGTTGTGATGACCCC SEQ ID NO.25 EGFR(I)-M025-VL-R ttggtgcagcatcagcccgTTTGATTTCCAGCTTGG SEQ ID NO.26 EGFR(I)-M025-VH-F taccagggtgctgagtCAGGTGCAACTTCAGC SEQ ID NO.27 EGFR(I)-M025-VH-R gggctgttgttttggcTGAGGAGACTGTGAGAGT SEQ ID NO.28

[0066] Before the first cycle, the template was pre-denatured at 94°C for 2 minutes;

[0067] Denaturation: 98°C, 10 seconds;

[0068] Annealing at 58 °C for 10 seconds;

[0069] extension 68°C, 1 sec;

[0070] The reaction was repeated for 30 cycles. After the last cycle, the sample was further extended at 68°C for 5 minutes to fill the ends. The PCR products were detected by 1% agarose gel electrophoresis, and the target fragments were recovered at the corresponding lengths.

[0071] 6) Vector ligation: The above PCR reaction product was ligated to the pABm vector: 7 μL of the PCR reaction product was added to 1 μL of the pABm vector, 1 μL of 10× ligation buffer, 1 μL of T4-DNA ligase, and ligated overnight at 16°C. The ligated vectors were named: pABm-EGFR(I)-M018-mKappa-VL, pABm-EGFR(I)-M018-mIgG2a-VH, pABm-EGFR(I)-M025-mKappa-VL, pABm-EGFR(I)-M025-mIgG2a-VH.

[0072] 7) Transformation: The ligation system was used to transform DH5α competent cells. The specific steps are as follows: take 1 tube of competent cells from a -80°C refrigerator and immediately place it on ice; add the ligation system (the volume does not exceed 10 μL), gently mix, and place on ice for 30 minutes; accurately heat shock in a 42°C water bath for 90 seconds, and quickly place on ice for 3-5 minutes after heat shock; add 1 mL of LB liquid culture medium (without antibiotics) to the tube, mix well, and culture at 37°C, 200 rpm on a shaker for 1 hour to allow the bacteria to resume normal growth; centrifuge the above bacterial solution, remove 800 μL of the supernatant, pipette and mix the remaining culture medium, and then spread it on a screening plate containing the corresponding antibiotic (containing antibiotic-ampicillin); invert the culture dish and culture at 37°C for 16-24 hours; pick the bacteria on the transformed plate and culture them in LB liquid culture medium (containing antibiotic-ampicillin) at 37°C with shaking overnight.

[0073] 8) Identification of positive clones: Take an appropriate amount of the bacteria cultured overnight at 37°C with shaking for sequencing.

[0074] 9) Extraction of recombinant plasmids in large quantities: The bacteria with successfully constructed plasmids were inoculated into LB liquid culture medium and cultured at 37°C with shaking for 12-24 hours; plasmid DNA was extracted from the bacterial liquid using an endotoxin-free plasmid extraction kit.

[0075] 10) Transient transfection of recombinant plasmid into HEK293E cells: The recombinant plasmid DNA was transiently transfected into HEK293E cells using the PEI transfection method; HEK293E cells were subcultured in a 10% DMEM medium suspension containing fetal bovine serum within 12-24 hours before transfection at a subculture density of 4×10 5 mL; prepare a plasmid DNA-PEI mixture, the ratio of PEI to DNA is 3:1, and the formulas of the two antibodies are shown in Table 1 below:

[0076]

[0077] The HEK293E cells to be transfected were transferred into serum-free DMEM medium, and then the DNA-PEI mixture was added dropwise thereto; 3 hours after cell transfection, an equal volume of DMEM medium containing 10% fetal bovine serum was used; after culturing in a 37°C, 5% CO2 incubator for 36-48 hours, the harvested cell supernatant was separated and purified.

[0078] 11) Isolation and purification of antibodies: ①. Take the cultured bacteria, centrifuge in a low-temperature centrifuge (5000rmp, 30min, 4℃), and retain the supernatant; ②. Filter the supernatant after centrifugation with a 0.45μm filter membrane; ③. Add 5mL of ProteinG filler to the filtered bacterial solution, incubate at 4℃ for 2h, and then purify the protein through a chromatography column. The steps are as follows: let the incubated bacterial solution flow through the chromatography column at a rate of 1ml / min; balance the column with Buffer A; Buffer A: PBS, pH8.0; elute with 0.1M glycine (pH2.7, adjusted to neutral with 2M Tris, pH9.0); analyze the eluted samples by SDS-PAGE gel to see if there is the target protein; ④. Collect the eluted protein, dialyze into buffer (PBS, pH8.0), incubate overnight at 4℃, and use SDS-PAGE gel to detect the purity of the target protein.

[0079] 1.3 The process and results of ELISA detection of candidate antibodies are shown in Tables 2 and 3

[0080] Table 2 EGFR antibody sample detection

[0081]

[0082] Table 3 EGFR antibody competition assay

[0083]

[0084] Example 2 Immunohistochemical verification of antibody binding ability

[0085] In this example, the immunohistochemical results of antibodies M018 and M025 obtained in Example 1 of the present invention were compared. In this example, the immunohistochemical process in addition to the primary antibody, other reagents and experimental conditions were the same, and the concentration of the primary antibody was also the same. The specific immunohistochemical operation steps are as follows:

[0086] 1. Dewax the paraffin sections and wash them in distilled water for 5 minutes.

[0087] 2. Place the slices in the repair solution, heat and wait for the water to boil, take out the repair box, and allow the slices to cool naturally to room temperature.

[0088] 3. Add 3% hydrogen peroxide, incubate at room temperature, and wash with PBS buffer.

[0089] 4. Add blocking solution and block at 37℃ for 30 minutes.

[0090] 5. Add M018 and M025 antibodies respectively and incubate overnight at 4°C.

[0091] 6. Wash the sections with PBS buffer, add secondary antibody, and block at 37°C for 30 minutes.

[0092] 7. DAB color development: Wash the tissue with PBS buffer, add DBA color development solution, and develop color at room temperature.

[0093] 8. Hematoxylin re-staining: Wash the surface of the slice with tap water, soak the slice in a hematoxylin staining jar, take out the slice and wash it with tap water. Put it in 1% hydrochloric acid alcohol for differentiation and take it out immediately, and rinse the slice with tap water.

[0094] 9. Soak the slices in 90% ethanol and anhydrous ethanol in turn, use a hair dryer to dry the alcohol remaining on the surface of the tissue, and use resin to seal the slices.

[0095] Dyeing effect as attached Figure 1 As shown, from Figure 1 It can be seen that the antibody M018 of the present invention is localized in the cell nucleus, and the antibody M025 of the present invention is localized in the cytoplasm. Figure 2 The results showed that the M025 antibody was accurately positioned during the immunohistochemistry process, with clear staining, no nonspecific staining, and a clean background.

[0096] Example 3: High-content live cell imaging for validation of M018 and M025 antibodies

[0097] In this example, the antibody M018 obtained in Example 1 of the invention was verified by live cell imaging. The specific steps are as follows:

[0098] 1. Instruments and reagents:

[0099] High-content cell imaging analysis system (Molecular Devices); fixative: (4% paraformaldehyde) FIXATION BUFFER (Biolegent, catalog number 420801); permeabilization solution: PBS containing 0.25% Triton X-100; blocking solution / antibody diluent: QuickBlock immunostaining blocking solution (Biolegent, P0260); antibodies M018 and M025; secondary antibody Anti-mouse IgG (H+L), F(ab')2Fragment (Alexa Fluor 647 Conjugate) (#4410S).

[0100] 2. Culture of B-CPAP cells and analysis of iodination modification of EGFR protein 845 site

[0101] (1) B-CPAP cell recovery and passage: Shake the cryotube containing 1 mL of cell suspension quickly in a 37°C water bath to thaw, add 5 mL of culture medium (RPMI-1640 + 10% FBS + 1% Penicillin-Streptomycin Solution) and mix well. Centrifuge at 500 RPM for 5 minutes, discard the supernatant, add 4-6 mL of complete culture medium and blow evenly. Then add all the cell suspension to the culture bottle and culture overnight (or add the cell suspension to a 6 cm dish) and culture overnight. Change the medium on the next day and check the cell density.

[0102] When the cell density reaches 80%-90%, it can be subcultured. Preheat 0.25% trypsin-0.53mM EDTA digestion solution at 37℃, pour out the culture medium in the culture flask, add 3-5mL PBS to the culture flask, shake it gently to wash and discard it. Add 1-2ml preheated trypsin to the flask, incubate at 37℃ for digestion, and add 3mL complete culture medium to terminate digestion after digestion. Use a pipette to gently blow the cells on the wall of the flask to make them completely fall off, then collect the cell suspension, centrifuge at 1200rpm for 3min, discard the supernatant, add complete culture medium to resuspend the cells, and then subculture.

[0103] (2) When the cells have grown to a sufficient amount, collect the cells and measure the cell density. Then, plate the cells into a 96-well plate with 2×10 4 The cells were cultured overnight in a 37°C, 5% carbon dioxide cell culture incubator.

[0104] (3) Cell fixation: Wash the cultured cells 2-3 times with phosphate buffered saline (PBS); add an appropriate amount of fixative and fix at room temperature for 15 minutes.

[0105] (5) Cell washing: Wash with permeabilization solution, 200uL per well, and wash twice with shaking.

[0106] (6) Permeabilization: 200uL of permeabilization solution per well, permeabilization for 15 minutes.

[0107] (7) Blocking: QuickBlock immunostaining blocking solution, 100uL per well, at room temperature for 15 minutes.

[0108] (8) Primary antibody incubation: Pour off the blocking solution and incubate with 50uL of primary antibody per well at 4°C overnight.

[0109] (9) Cleaning: Clean three times with permeabilization solution.

[0110] (10) Secondary antibody incubation: antibody diluent + secondary antibody (1:1000) + Hoechst (1:100), 50uL per well, room temperature for 1h.

[0111] (11) Cleaning: Clean three times with permeabilization solution.

[0112] (12) High-content detection: Pour off the washing solution, add 200 μL of Flurbrite DMEM, protect from light, and immediately perform high-content cell imaging analysis system detection. The high-content cell imaging analysis system selects two channels, DAPI and Cy5, for detection. The exposure time of the DAPI channel is 5 ms, and the exposure time of the Cy5 channel is 100 ms. A 20x lens is used to collect 9 fields of view per well. The EGFR expression level is analyzed using the analysis software provided by the system.

[0113] Dyeing effect as attached Figure 3 As shown in the figure, it can be seen that the staining effect of M018 and M025 antibodies is good. The results show that M018 and M025 antibodies are accurately positioned in the living cell process, the staining is clear and there is no non-specific staining, and the background is clean. Therefore, both M018 and M025 antibodies can be used for living cell imaging detection.

[0114] Example 4: High-content B-CPAP live cell imaging verification:

[0115] 1. Instruments and reagents:

[0116] High-content cell imaging analysis system (Molecular Devices); fixative: (4% paraformaldehyde) FIXATION BUFFER (Biolegent, catalog number 420801); permeabilization solution: PBS containing 0.25% Triton X-100; blocking solution / antibody diluent: QuickBlock immunostaining blocking solution (Biolegent, P0260); antibody M018 or M025; secondary antibody Anti-mouse IgG (H+L), F(ab')2Fragment (Alexa Fluor 647 Conjugate) (#4410S).

[0117] 2. Culture of B-CPAP cells and analysis of iodination modification of EGFR protein 845 site

[0118] (1) B-CPAP cell recovery and passage: Shake the cryotube containing 1 mL of cell suspension quickly in a 37°C water bath to thaw, add 5 mL of culture medium (RPMI-1640 + 10% FBS + 1% Penicillin-Streptomycin Solution) and mix well. Centrifuge at 500 rpm for 5 minutes, discard the supernatant, add 4-6 mL of complete culture medium and blow evenly. Then add all the cell suspension to the culture bottle and culture overnight (or add the cell suspension to a 6 cm dish) and culture overnight. Change the medium on the next day and check the cell density.

[0119] When the cell density reaches 80%-90%, subculture can be performed. Preheat 0.25% trypsin-0.53mM EDTA digestion solution at 37℃, pour out the culture medium in the culture flask, add 3-5mL PBS to the culture flask, shake gently to wash and discard. Add 1-2mL preheated trypsin to the flask, incubate at 37℃ for digestion, and add 3mL complete culture medium to terminate digestion after digestion. Use a pipette to gently blow the cells on the wall of the flask to make them completely fall off, then collect the cell suspension, centrifuge at 1200rpm for 3min, discard the supernatant, add complete culture medium to resuspend the cells, and then subculture.

[0120] (2) When the cells have grown to a sufficient amount, collect the cells and measure the cell density. Then, plate the cells into a 96-well plate with 2×10 4 The cells were cultured overnight in a 37°C, 5% carbon dioxide cell culture incubator.

[0121] (3) Treatment with iodinated modifier: Prepare EGFR iodinated modified medium, add an appropriate amount of 200 mM sodium iodide stock solution to each cell culture medium, and prepare a cell culture medium with a sodium iodide concentration of 100 μM. After the cells are cultured overnight, carefully aspirate the cell culture medium, add EGFR iodinated modified medium, and continue to culture at 37°C, 5% carbon dioxide in a cell culture incubator for 24 hours.

[0122] (4) Cell fixation: The cells cultured in the EGFR iodine-modified medium were washed 2-3 times with phosphate buffered saline (PBS); an appropriate amount of fixative was added and fixed at room temperature for 15 minutes.

[0123] (5) Cell washing: Wash with permeabilization solution, 200uL per well, and wash twice with shaking.

[0124] (6) Permeabilization: 200uL of permeabilization solution per well, permeabilization for 15 minutes.

[0125] (7) Blocking: QuickBlock immunostaining blocking solution, 100uL per well, at room temperature for 15 minutes.

[0126] (8) Primary antibody incubation: Pour off the blocking solution and incubate with 50uL of primary antibody per well at 4°C overnight.

[0127] (9) Cleaning: Clean three times with permeabilization solution.

[0128] (10) Secondary antibody incubation: antibody diluent + secondary antibody (1:1000) + Hoechst (1:100), 50uL per well, room temperature for 1h.

[0129] (11) Cleaning: Clean three times with permeabilization solution.

[0130] (12) High-content detection: Pour off the washing solution, add 200 μL of FluoroBrite DMEM with Hoechst, a nuclear staining solution, and immediately perform high-content cell imaging analysis system detection. The high-content cell imaging analysis system selects two channels, DAPI and Cy5, for detection. The exposure time of the DAPI channel is 5 ms, and the exposure time of the Cy5 channel is 100 ms. A 20X lens is used to collect 9 fields of view per well. The EGFR expression level is analyzed using the analysis software provided by the system.

[0131] The same method was also used to analyze the casein iodination modification of EGFR protein 845 site in immortalized thyroid cells Nthy-Ori-3-1 cells, human placental choriocarcinoma cells BeWo, human esophageal cancer cells TE-1, and human gastric cancer cells MKN-45.

[0132] Results: See Figure 4-Figure 8It can be seen that after sodium iodide treatment, the iodination modification of EGFR protein 845 site in B-CPAP, Nthy-Ori-3-1, BeWo, TE-1 and MKN-45 cells was significantly increased. Therefore, the iodinated antibody modified at site 845 of EGFR protein in the present invention and its application can provide a basis for the research and development of cancer drugs.

[0133] The above content is a further detailed description of the present invention in combination with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the protection scope determined by the claims submitted for the present invention.

Claims

1. A monoclonal antibody for tyrosine iodination-modified EGFR protein, characterized in that: The amino acid sequence of the monoclonal antibody is shown as SEQ ID NO.1 or SEQ ID NO.

9.

2. A monoclonal antibody for tyrosine iodination-modified EGFR protein, characterized in that: The nucleotide sequence of the monoclonal antibody is shown as SEQ ID NO.2, or as SEQ ID NO.

10.

3. A nucleic acid vector, characterized in that The nucleic acid vector contains a nucleic acid sequence of a monoclonal antibody against tyrosine iodinated EGFR protein, and the nucleic acid sequence is shown in SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.17 or SEQ ID NO.

19.

4. A method for preparing an iodinated EGFR protein monoclonal antibody, characterized in that: The method comprises recombinantly expressing a vector containing heavy chain and light chain sequences of a monoclonal antibody to the EGFR protein; preferably, the sequence of the light chain of the monoclonal antibody to the EGFR protein is as shown in SEQ ID NO.13 or SEQ ID NO.15; the sequence of the heavy chain of the monoclonal antibody to the EGFR protein is as shown in SEQ ID NO.17 or SEQ ID NO.

19.

5. An application of an iodinated EGFR protein monoclonal antibody, characterized in that: The application includes combining the monoclonal antibody with EGFR protein in a sample to detect whether iodination modification exists in the tyrosine at position 845 of the EGFR protein.

6. Use of an iodinated EGFR protein monoclonal antibody in immunoassay, characterized in that: The immunoassay includes one or more of immunohistochemistry, immunocytometry, immunochemiluminescence, immunofluorescence, ELISA, immunolateral flow, immunoelectrochemistry, and fluorescence resonance energy transfer (FRET).

7. The use according to claim 6, characterized in that: The samples for immunoassay are one or more of blood, plasma, serum, cells, tissue, feces, urine, and saliva.

8. The use according to claim 7, characterized in that: The immunoassay is used for cell imaging of tumor cell models, including thyroid cancer cells, human placental choriocarcinoma cells, human esophageal cancer cells, and human gastric cancer cells.

9. A reagent for detecting iodinated EGFR protein, characterized in that: The reagent includes a monoclonal antibody that is iodinated and specifically binds to the tyrosine at position 845 of the EGFR protein, and the amino acid sequence of the monoclonal antibody is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.11; preferably, the amino acid sequence of the monoclonal antibody is shown in SEQ ID NO.1 or SEQ ID NO.

9.

10. A kit for detecting iodinated EGFR protein, characterized in that: The reagent includes a monoclonal antibody that is iodinated and specifically binds to the tyrosine iodinated residue at position 845 of the EGFR protein, and the amino acid sequence of the monoclonal antibody is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.11; preferably, the amino acid sequence of the monoclonal antibody is shown in SEQ ID NO.1 or SEQ ID NO.9.

Images