VSV-WEEV recombinant virus, composition containing VSV-WEEV recombinant virus, nucleic acid molecule and application

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a VSV-WEEV recombinant virus, a composition containing the VSV-WEEV recombinant virus, a nucleic acid molecule and application. The VSV-WEEV recombinant virus is constructed by replacing a vesicular stomatitis virus G protein with a western equine encephalitis virus structural protein E3E2E1. The recombinant virus is identified and subjected to immunogenicity evaluation, serum of a mouse immunized by the recombinant virus shows high antibody titer aiming at the WEEV, and a plaque reduction neutralization experiment also proves that the serum can effectively inhibit cell infection caused by another chimeric virus, namely SINV-WEEV, replacing a WEEV wild strain.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a VSV-WEEV recombinant virus, a composition and a nucleic acid molecule containing the VSV-WEEV recombinant virus, and applications thereof. Background Art

[0002] Western Equine Encephalitis Virus (WEEV) belongs to the Togaviridae family and the Alphavirus genus. It has strong pathogenicity and a biosafety level of BSL-3. It is mainly distributed in the western United States and South America. It is a Class I quarantine object stipulated in my country's entry-exit inspection and quarantine. In recent years, with the increase in international trade and tourism population, many imported cases have been reported. WEEV virus particles are icosahedral symmetric, and the genome is a single-stranded positive-strand RNA molecule of about 11,000 nt, encoding a total of 9 proteins, including 4 non-structural proteins (NSP1, NSP2, NSP3, NSP4) and 5 structural proteins (core protein C, envelope protein E3 / E2 / E1, 6K protein). WEEV is mainly transmitted by the bites of Culex annularis. In addition to milder symptoms such as fever, dizziness, and vomiting, infection can also cause encephalitis, with a mortality rate of 3% to 7%. Among the survivors, 15% to 30% will cause permanent neurological lesions, such as mental retardation and paralysis. There is currently no approved vaccine or other means to effectively reduce the pathogenicity of Western equine encephalitis virus. Summary of the invention

[0003] In view of the above technical problems, the present invention constructs VSV-WEEV recombinant virus by replacing the G protein of VSV with the structural protein E3E2E1 of WEEV, so as to achieve the purpose of attenuation and replace the WEEV wild strain for testing in a BSL-2 laboratory.

[0004] In order to achieve the above purpose, the specific technical solution provided by the present invention is as follows:

[0005] In a first aspect, the present invention provides a VSV-WEEV recombinant virus, which is constructed by replacing the G protein of vesicular stomatitis virus with the structural protein E3E2E1 of western equine encephalitis virus.

[0006] As a preferred embodiment of the present invention, the VSV-WEEV recombinant virus is specifically constructed according to the following steps:

[0007] Based on the gene sequence of Western equine encephalitis virus, the target gene encoding structural protein E3E2E1 was synthesized;

[0008] Using the target gene as a template, designing primers and amplifying the target gene;

[0009] The amplified product was connected to the pVSV-△G-EGFP vector, transformed into tool cells, cultured, and extracted to obtain the pVSV-△G-WEEV-E3E2E1-EGFP recombinant plasmid;

[0010] Transfection and rescue were performed to obtain the VSV-WEEV recombinant virus.

[0011] As a preferred embodiment of the present invention, the pVSV-△G-EGFP vector was digested with EcoR I and then connected with the amplified product at 50° C. for 10 min to obtain a connection product.

[0012] As a preferred embodiment of the present invention, the tool cell is a DH5α competent cell. After the ligation product is transfected into the DH5α competent cell, a single colony is picked and cultured and amplified in a shaking incubator at 37° C. to obtain the pVSV-△G-WEEV-E3E2E1-EGFP recombinant plasmid.

[0013] The second aspect of the present invention provides a composition containing the recombinant virus.

[0014] As a preferred embodiment of the present invention, the composition includes a pharmaceutically acceptable carrier or excipient.

[0015] The third aspect of the present invention provides a nucleic acid molecule comprising the genome of the recombinant virus.

[0016] In a fourth aspect, the present invention provides a use of the VSV-WEEV recombinant virus, the composition or the nucleic acid molecule in the preparation of a drug for resisting Western equine encephalitis virus infection.

[0017] As a preferred embodiment of the present invention, the drug is a vaccine.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] The present invention provides a VSV-WEEV recombinant virus, which is constructed by replacing the G protein of VSV with the structural protein E3E2E1 of the Western Equine Encephalitis Virus. The VSV-WEEV recombinant virus can not only achieve the purpose of attenuation, but also can carry out multiple rounds of replication compared with the recombinant virus in which the G protein is replaced by a fluorescent reporter protein. The present invention identifies the recombinant pseudovirus and evaluates its immunogenicity, and the serum of mice immunized with the recombinant virus shows a high antibody titer against WEEV.

[0020] The plaque reduction neutralization experiment proved that the serum (polyclonal antibody) obtained by VSV-△G-WEEV-EGFP immunization had neutralizing activity and could effectively inhibit the infection of cells by another chimeric virus that replaced the wild-type WEEV strain, SINV-WEEV; while the monoclonal antibody of the 2F1E12 strain had no neutralizing activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is pVSV-△G-WEEV-E3E2E1-EGFP recombinant plasmid identification; M: DNA Marker; 1: WEEV-E3E2E1 gene amplification product;

[0022] Figure 2 It is the sequencing result of the target gene in the pVSV-△G-WEEV-E3E2E1-EGFP recombinant plasmid;

[0023] Figure 3 These are fluorescence images of the virus rescue process; A: P224h fluorescence image, B: P324h fluorescence image;

[0024] Figure 4 This is the result of Western blot identification of VSV-△G-WEEV-E3E2E1-EGFP recombinant virus; M: Marker; 1: E2 and pE2 protein bands;

[0025] Figure 5 It is the result graph of the recombinant virus growth curve;

[0026] Figure 6 A is an electron microscope image of the recombinant virus; B is a partial magnified image of A;

[0027] Figure 7 It is the process of immunizing mice with recombinant viruses;

[0028] Figure 8 It is the determination of serum antibody titer of mice immunized with recombinant virus;

[0029] Fig. 9 This is a graph showing the results of a plaque reduction neutralization experiment. DETAILED DESCRIPTION

[0030] The following describes the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0031] In the present invention, the term "G protein" generally refers to the glycoprotein of VSV virus, also known as envelope protein. The term "G protein" also includes its homologues, orthologues, variants, functionally active fragments, etc.

[0032] In the present invention, the term "expression vector" generally refers to a nucleic acid vector. Under appropriate conditions, it is generally capable of expressing a target gene and / or a target protein. In certain embodiments of the present invention, the expression vector includes a nucleic acid molecule for expressing one or more components of a virus. For example, the expression vector may include at least one viral genome element and may be packaged into a virus or packaged as a viral particle.

[0033] In the present invention, the term "pharmaceutical composition" generally refers to a preparation that exists in a form that allows the biological activity of the active ingredient to be effective, and it does not contain other ingredients that have unacceptable toxicity to the subject to be administered with the preparation. In certain embodiments, these preparations may include the active ingredient of the drug and a pharmaceutically acceptable carrier. In certain embodiments, the drug product includes parenteral, percutaneous, intracavitary, intraarterial, intrathecal and / or intranasal administration or direct injection into the tissue of the drug product. The drug product can be administered in different ways, such as intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration.

[0034] In the present invention, the term "prevention" generally refers to preventing the generation and onset, recurrence and / or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In the present invention, the term "treatment" generally refers to eliminating or ameliorating a disease, or one or more symptoms associated with a disease. In certain embodiments, treatment generally refers to administering one or more drugs to a patient suffering from the disease so that the disease is eliminated or alleviated. In certain embodiments, "treatment" can be the administration of the drug combination and / or drug product in the presence or absence of other drugs after the onset of symptoms of a particular disease. For example, the use of the drug combination and / or drug product of the present invention prevents the generation, development, recurrence and / or transfer of Western equine encephalitis virus infection.

[0035] Among the alphavirus genus, the alphaviruses that can cause encephalitis include Venezuelan equine encephalitis virus (VEEV), Western equine encephalitis virus (WEEV), and Eastern equine encephalitis virus (EEEV). The biohazard level of their wild strains is relatively high, and they can cause severe encephalitis in humans. However, there are currently no safe and effective prevention and treatment methods for these three viruses. Therefore, the present invention selects a VSV that is less harmful to humans and has a relatively mature technology as a vector, replaces the G protein of vesicular stomatitis virus with the structural protein E3E2E1 of Western equine encephalitis virus, and successfully constructs a VSV-WEEV recombinant attenuated live virus.

[0036] The present invention identified the recombinant pseudovirus and evaluated its immunogenicity. The serum of mice immunized with the recombinant virus showed a high antibody titer against WEEV. The plaque reduction neutralization experiment also proved that the serum could effectively inhibit the infection of cells by another pseudovirus that replaces the wild strain of WEEV, namely SINV-WEEV. Therefore, the VSV-WEEV recombinant virus constructed by the present invention can be used as an alternative research tool for the prevention and treatment of WEEV.

[0037] The present invention is described in detail below.

[0038] Example 1

[0039] Rescue of VSV-△G-WEEV-E3E2E1-EGFP recombinant virus

[0040] 1. Methods

[0041] 1.1 Design and synthesis of WEEV-E3E2E1 encoding gene and amplification primers

[0042] According to the gene sequence of WEEV CBA87 strain (GenBank: DQ432026.1), the target gene E3E2E1 (SEQID NO.3) was synthesized with a length of 2931 bp. The upstream primer was designed by SnapGene software as 5ˊ-cttagcctttttatgcatgcatgagcctggtgaccgccctgtgcgtgc-3ˊ, as shown in SEQ ID NO.1; the downstream primer was 5ˊ-ctatgtcgtaccgcatgcttagcggcgggtgttgatcag-3ˊ, as shown in SEQ ID NO.2. The target gene and primer sequences were sent to Qingke Biotechnology Co., Ltd. for synthesis.

[0043] SEQ ID NO.3:

[0044] tcactagttacagcgctgtgcgtgctttcgaatgtcacattcccttgcgacaaaccacccgtgtgctattcactggcgccagaa

[0045] cgaacactcgacgtgctcgaggagaacgtcgacaatccaaattacgacacgctgctggagaacgtcttgaaatgtccatca

[0046] cgccggcccaaacgaagcattaccgatgacttcacgctgaccagtccctacctggggttctgcccgtattgcagacactcag

[0047] cgccatgttttagcccaataaaaattgagaacgtgtgggacgaatctgatgatgggtcgattagaatccaggtctcggcacaa

[0048] ttcggctacaatcaggcaggcactgcagacgtcaccaagttccggtacatgtcttacgaccacgaccatgacatcaaggaa

[0049] gacagtatggagaaattagctattagtacatccggaccatgccgtcgtcttggccacaaagggtacttcctgttagctcaatgt

[0050] cctccaggtgacagtgtaaccgtcagtatcacgagcggagcatctgagaattcatgcaccgtggagaaaaagatcaggag

[0051] gaagtttgtcggtagagaggagtacttgttcccacctgtccatggaaagctggtaaagtgccacgtttacgatcacttgaagg

[0052] agacgtctgccggatatataactatgcacaggccaggcccacacgcgtataagtcctacctggaggaagcgtcaggcgaa

[0053] gtgtacattaaaccaccttctggcaagaacgtcacctacgaatgtaagtgtggtgactacagcacaggtattgtgagcacgc

[0054] gaacgaagatgaacggctgcactaaagcaaaacaatgcattgcctacaagcgcgaccaaacgaaatgggtcttcaactcg

[0055] ccggatcttattaggcacacagaccactcagtgcaaggtaaactgcacattccattccgcttgacaccgacagtctgcccggt

[0056] tccgttagctcacacgcctacagtcacgaagtggttcaaaggcatcaccctccacctgactgcaacgcgaccaacattgctg

[0057] acaacgagaaaattggggctgcgagcagacgcaacagcagaatggattacggggactacatccaggaatttttctgtggg

[0058] gcgagaagggctggagtacgtatggggcaaccatgaaccagtcagagtctgggcccaggagtcggcaccaggcgaccc

[0059] gcatggatggccgcatgagatcatcatccattattatcatcggcatccagtctacactgtcattgtgctgtgcggtgtcgctctg

[0060] gctatcctggtaggcactgcatcgtcagcagcttgtatcgccaaagcaagaagagactgcctgacgccatacgcgcttgca

[0061] ccgaacgcaacggtacccacagcattagcagttttgtgctgtattcggccaaccaacgctgaaacatttggagaaactttgaa

[0062] tcatctgtggtttaacaaccaaccgtttctctgggcacagttgtgcatccctctggcagcgcttattattctgttccgctgcttttca

[0063] tgctgcatgccttttttattggttgcaggcgtctgcctggggaaggtagacgccttcgaacatgcgaccactgtgccaaatgtt

[0064] ccggggatcccgtataaggcgttggtcgaacgtgcaggttacgcgccacttaatctggagattacggtcgtctcatcggaatt

[0065] aacaccctcaactaacaaggagtacgtgacctgcaaatttcacacagtcgttccttcaccacaagttaaatgctgcgggtccc

[0066] tcgagtgtaaggcatcctcaaaagcggattacacatgccgcgtttttggcggtgtgtaccctttcatgtggggaggcgcaca

[0067] gtgcttctgtgacagtgagaacacacaactgagtgaggcatacgtcgagttcgctccagactgcactatagatcatgcagtc

[0068] gcactaaaagttcacacagctgctctgaaagtcggcctgcgtatagtatacggcaataccacagcgcgcctggatacattcg

[0069] tcaacggcgtcacaccaggttcctcacgggacctgaaggtcatagcagggccgatatcagcagctttttcaccctttgaccat

[0070] aaggtcgtcattagaaaggggcttgtttacaactacgacttccctgagtatggagctatgaacccaggagcgttcggcgatat

[0071] tcaagcatcctctcttgatgccacagacatagtagcccgcaccgacatacggctgctgaagccttctgtcaagaacatccac

[0072] gtcccctacacccaagcagtatcagggtatgaaatgtggaagaacaactcaggacgacccctgcaagaaacagcaccatt

[0073] cggatgtaaaattgaagtggagcctctgcgagcgactaactgtgcttatgggcacatccctatctcgattgacatccctgatg

[0074] cagcttttgtgagatcatctgaatcaccaacaattttagaagtcagctgcacagtagcagactgcatttattctgcagactttggt

[0075] ggttcgctaacactacagtacaaagctaacagagagggacattgtccagttcactcccactccactacagctgttttgaagga

[0076] agcgaccacacatgtgactgccacaggcagcataacactacattttagcacatcgagcccacaagcaaatttcatagtttcgc

[0077] tatgcggcaagaagaccacctgcaatgctgaatgtaaaccaccggccgaccacataattggagaaccacataaggtcgac

[0078] caagaattccaggcggcagtttccaaaacatcttggaactggctgcttgcactgtttggggggagcatcatccctcattgttgta

[0079] ggacttatagtgttggtctgcagctctatgcttataaacacacgtaga

[0080] 1.2 PCR amplification of the WEEV-E3E2E1 encoding gene

[0081] The synthesized target gene E3E2E1 was used as a template, and the designed primers and Prime STARMAX polymerase 50 μL amplification system were used for amplification, and finally the amplified product was identified and recovered by 1% agarose gel electrophoresis.

[0082] The amplification system was as follows: 1 μL of each primer, 1 μL of template, 25 μL of enzyme, and 22 μL of ddH2O;

[0083] The PCR amplification program was as follows: pre-denaturation at 98°C for 2 min, 1 cycle; denaturation at 98°C for 10 s; annealing at 59°C for 5 s; extension at 72°C for 30 s, 30 cycles; final extension at 72°C for 5 min, 1 cycle.

[0084] The target gene amplification product was identified and recovered by 1% agarose gel electrophoresis.

[0085] 1.3. Construction of pVSV-△G-WEEV-E3E2E1-EGFP plasmid

[0086] The pVSV-△G-EGFP vector was constructed by referring to the method described in the paper published by the present invention team, "Zhang Hui. Construction, identification and preliminary study of the immunological properties of a new Hantaan virus vaccine based on rVSV [D]. Air Force Medical University, 2021".

[0087] The pVSV-△G-EGFP vector was digested with EcoR I, and the recovered amplified product was connected with the single-enzyme-cut vector by homologous recombination at 50°C for 10 minutes. The ligated product was transformed into DH5α competent state, and then a single colony was picked for amplification in a small amount on a shaking incubator at 37°C. A small amount of plasmid was extracted and sent to Qingke Biotechnology Co., Ltd. for sequencing.

[0088] like Figure 1 The result showed a band of about 3000 bp, which was consistent with the expected band size. Figure 2 , the box is the comparison result), and the pVSV-△G-WEEV-E3E2E1-EGFP recombinant plasmid was successfully constructed.

[0089] 1.4 Transfection rescue

[0090] First, BHK cells were infected with poxvirus for 24 hours to provide the action of T7 RNA polymerase; then the sequenced pVSV-△G-WEEV-E3E2E1-EGFP plasmid and auxiliary plasmids pBlueScript-N (pBS-N), pBS-P, pBS-G, and pBS-L were co-transfected into BHK cells with liposome transfection reagent at a mass of 1.25μg, 0.75μg, 1.25μg, 2.00μg, and 0.25μg, respectively. The auxiliary plasmids pBlueScript-N (pBS-N), pBS-P, pBS-G, and pBS-L were all donated by the Wuhan Institute of Virology. After successful rescue, the growth of poxvirus was inhibited with 75μg / ml cytarabine.

[0091] The sequenced pVSV-△G-WEEV-E3E2E1-EGFP plasmid and four auxiliary plasmids were co-transfected into BHK cells for 48 hours, and EGFP green fluorescence began to appear, indicating that the exogenous EGFP protein had been expressed in the cells; after collecting the cell supernatant and subculturing, the green fluorescence gradually increased and the cells were infectious, preliminarily proving that the virus was successfully rescued and the VSV-△G-WEEV-E3E2E1-EGFP recombinant virus was obtained, recorded as VSV-WEEV recombinant virus ( Figure 3 ).

[0092] 1.5. Identification of VSV-WEEV recombinant virus by Western blot

[0093] The crude VSV-WEEV from the 20% sucrose cushion was dialyzed to remove the sucrose, and then the VSV-WEEV recombinant virus was directly mixed with 5× protein loading buffer and boiled for 10 minutes. After SDS-PAGE and transfer to PVDF membrane, it was blocked with 5% skim milk at room temperature for 1 hour, and then washed three times with PBST, 5 minutes each time; then incubated with primary antibody, incubated overnight at 4°C, washed 3 times with PBST, 5 minutes each time; incubated with IRDye 680RD Goat anti-Mouse secondary antibody for 1 hour, 37°C, and then washed 3 times with PBST, 5 minutes each time.

[0094] Referring to the method described in the journal article "Preparation of mouse anti-Zika virus envelope protein extracellular region (Eecto) monoclonal antibody. Xue Pan, Dong Yangchao, Wu Fuxing, et al. Journal of Cellular and Molecular Immunology, 2024, 5." published by the present invention team, a monoclonal antibody against WEEV-E2ecto was prepared, and the monoclonal antibody against WEEV-E2ecto was used as the primary antibody. The results showed two bands consistent with expectations, one of which was an E2 protein with a size of about 46Kd, and the other was a pE2 protein with a size of about 53Kd (the common size of E3E2 protein in the immature state of the virus) ( Figure 4 ).

[0095] 1.6 Growth Curve

[0096] The VSV-EGFP virus was constructed according to the method described in the journal article "Zhang H, Liu H, Wei J, Dang Y, Wang Y, Yang Q, Zhang L, Ye C, Wang B, Jin X, Cheng L, Ma H, Dong Y, Li Y, Bai Y, Lv X, Lei Y, Xu Z, Ye W, Zhang F. Singledose recombinant VSV-based vaccine elicits robust and durable neutralizing antibody against Hantaanvirus. NPJ Vaccines. 2024 Feb 10; 9(1): 28. doi: 10.1038 / s41541-024-00814-2." published by the present invention team.

[0097] Four bottles of T75 BHK cells were infected with 0.001 MOI of VSV-△G-WEEV-E3E2E1-EGFP recombinant virus and VSV-EGFP virus respectively, and then the cell supernatants of the two viruses were collected at 24h, 48h, 72h, and 96h respectively; then, the number of viruses in different time periods was detected by plaque assay; finally, the virus growth curve was made based on the plaque results.

[0098] By comparing the growth curve of VSV-EGFP virus, the results showed that the recombinant virus of VSV-△G-WEEV-E3E2E1-EGFP could also reach 10 at 48h of infection. 9 PFU maximum replication titer ( Figure 5 ).

[0099] 1.7 Transmission Electron Microscope

[0100] T75 BHK cells in three wells of a 6-well plate were infected with 0.001 MOI of VSV-△G-WEEV-E3E2E1-EGFP recombinant virus. After 24 hours, the cells became rounded and then digested and centrifuged at 1000r / min for 5 minutes. After washing twice with PBS, 1ml of glutaraldehyde was added to fix the cells for 24 hours. Finally, the samples were sliced ​​and observed by electron microscopy.

[0101] Electron microscopy results Figure 6 As shown, Figure 6 The red box in A is the VSV-△G-WEEV-E3E2E1-EGFP recombinant virus, which has a more classic rhabdovirus morphology. Figure 6 The red arrow in B is a local enlarged image (about 170-180 nm); the blue arrow is a cross section of the recombinant virus (about 70-80 nm), which proves that the VSV-△G-WEEV-E3E2E1-EGFP recombinant virus was successfully prepared.

[0102] Example 2

[0103] Preparation of monoclonal antibodies

[0104] 1. Mouse immunization

[0105] Female Babl / c mice aged 6 to 8 weeks were selected and VSV-△G-WEEV-E3E2E1-EGFP recombinant virus was injected at 1×10 5 The dose of PFU was given by intramuscular injection for the primary immunization and the first booster immunization. 1×10 4 The second booster dose of PFU was given by intraperitoneal injection. The immunization process is shown in Figure 7 .

[0106] 2. Establishment of indirect ELISA method for detecting VSV-WEEV antibodies

[0107] ELISA 96-well plate was coated with purified WEEV E2ecto protein at 2 μg / well. Positive control, negative control, blank control and the object to be detected were added to the wells at 100 μL / well, incubated at 37°C for 1 hour, and washed 3 times with ELISA washing solution at 5 min / time. After the plate was patted dry, goat anti-mouse HRP-IgG was added at 100 μl / well, incubated at 37°C for 1 hour, and washed 3 times with ELISA washing solution at 5 min / time. Finally, color development was added and the absorbance (A) value at 450 nm was detected. If A 待测孔 -A 空白对照 ≥2.1(A 阴性对照 -A 空白对照 ), it is judged as a positive result.

[0108] 3. Screening of hybridoma cells

[0109] After two rounds of immunization with the recombinant virus, two mice No. 1 and No. 2 were taken. Blood was collected from the tail vein on the 51st day after immunization, and the titer of the immune serum was determined by indirect ELISA. The immune titer was greater than 1×10 4 Three days before fusion, mice were fed with 1×10 4 PFU dose for intraperitoneal boosting immunization.

[0110] The results showed that the antibody titer in the serum of the two mice was above 1:10000, indicating that the immune effect was good and that monoclonal antibodies could be prepared by hybridoma fusion experiment ( Figure 8 ). In addition, by observing the behavior and life status of mice within 2 months after immunization, no obvious side effects were observed.

[0111] Then, mouse spleen cells (about 1.0×10 8 ) and SP2 / 0 (about 2~3×10 7 ), fused under the action of 50% PEG1500 catalytic agent, and the fused cell suspension was added to the feeder cells containing HAT culture medium at 100μl / well. In the first and second weeks after fusion, the hybridoma cells were screened and cultured using HAT and HT culture medium respectively; after the 10th day after fusion, the antibody secretion in the formed cell clones was detected by indirect ELISA; the positive clones were cloned at least 3 times, and finally the hybridoma cells that stably secreted monoclonal antibodies were screened for expansion culture and preservation.

[0112] After 4 to 5 rounds of cloning, the 2F1E12 monoclonal antibody was obtained.

[0113] 4. Detection of monoclonal antibody titer

[0114] The hybridoma cells obtained above were injected into the peritoneal cavity of mice, and 10 μL of antibody ascites was taken for 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 The ascites titer was tested by serial dilution and indirect ELISA.

[0115] The results showed that the titer of antibodies in ascites fluid was 10 6 (Table 1).

[0116] Table 1 Antibody titer in ascites (A 450 value)

[0117]

[0118]

[0119] Example 3

[0120] Plaque reduction neutralization assay

[0121] 1. Preparation of SINV-WEEV chimeric virus

[0122] The full-length genome of the SINV-WEEV chimeric virus is divided into three fragments, namely the SINV non-structural protein part, the WEEV CE3E2E1 structural protein part and the linker part (the linker part is because the reporter gene ZsGreen is inserted for subsequent experiments). After the three fragments are amplified and recovered, the plasmid is circularized using a PCR instrument and a circular polymerase extension reaction method, and then the circularized plasmid is transfected into BHK cells for rescue. Finally, Western Blot verification is performed using a monoclonal antibody obtained by immunization with the WEEVE2ecto protein. The specific operation includes the following steps:

[0123] (1) Design and synthesis of WEEV-CE3E2E1, SINV-NSP1, NSP2, NSP3, NSP4 (non-structural protein part), linker target genes and amplification primers

[0124] According to the gene sequence of WEEV CBA87 strain (GenBank: DQ432026.1), the WEEV CE3E2E1 target gene and the 5′ end containing the SINV subgenomic 26s gene and the 3′ end containing the poly-A tail, ZsGreen reporter gene, and the 5′ end homology arm gene of the Linker gene were synthesized, totaling 4979 bp. The upstream primer designed by SnapGene software was 5′-atagtcagcatagtacatttcatctgactaatactac-3′, SEQ ID NO.4; the downstream primer was 5′-tgccggccagtggttttgtg-3′, SEQ ID NO.5. The upstream primer designed for amplification of the SINV nonstructural protein encoding gene was 5′-atagtcagcatagtacatttcatctgactaatactac-3′, SEQ ID NO.6; the downstream primer was 5′-ggtggtggtgttgtagtattagtcagatgaaatgtactatgctgac-3′, SEQ ID NO.7. The SINV nonstructural protein coding gene template was derived from SINV plasmid JK-57 (purchased from addgene), totaling 7647 bp. The target gene of the synthetic Linker (containing the CMV promoter gene) was shown in SEQ ID NO.8: 5'-GGATGACAAACACAAAACCACTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCCGGGAGCGCTAAGCTTGATTCTTCTGACACAACAGTCTCGAACTTAAGGCTAGAGCCACCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTACACATTTCCCCGAAAAGTGCCACCTGGGTCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTGCGATCGCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT-3', a total of 836 bp, and the upstream amplification primer 5'-ggatgacaaacacaaaaccactggccggcatgg-3', SEQ ID NO.9; the downstream amplification primer 5'-caatagtgtgtactacgccgtcaatagctctgcttatatagacctcccac-3', SEQ ID NO.10.

[0125] (2) Plasmid cyclization

[0126] pSINV-WEEV CE3E2E1-ZsGreen plasmid circularization: The three target genes successfully amplified by PCR were obtained by gel recovery, and then the three target genes were mixed with 0.1pmol of equal molar mass, and circularized by using a PCR instrument and a circular polymerase extension reaction. The specific conditions of circularization are described in the literature: Establishment of a reverse genetics system for SARS-CoV-2 using circular polymerase extension reaction

[0127] (3) Transfection and rescue of BHK cells

[0128] Finally, Western validation was performed, and the monoclonal antibody used was the same as the monoclonal antibody for VSV-WEEV in the article to obtain SINV-WEEV chimeric virus.

[0129] 2. Plaque reduction and neutralization assay

[0130] Take 1.88×10 BHK cells 6 The cells were evenly spread into 6 wells of a 6-well plate. After 24 hours, about 50 PFU of SINV-WEEV chimeric virus was mixed with serum or ascites containing the above-mentioned 2F1E12 monoclonal antibody and incubated at 37°C for 2 hours. The serum or ascites mixed with VSV-△G-WEEV-E3E2E1-EGFP recombinant virus and DMEM was used as a negative control. Subsequently, the cells were infected and replaced with 2% methylcellulose covering solution after 2 hours; finally, the covering solution was washed after 48 hours and stained with crystal violet for 15 minutes, and then the crystal violet was washed. After the 6-well plate was dried, the number of white spots was counted and compared with the number of white spots in the negative control well to determine whether there was a neutralizing effect in the serum or ascites.

[0131] The serum (polyclonal antibody) obtained by immunization with VSV-△G-WEEV-EGFP and the prepared monoclonal antibody of 2F1E12 strain were respectively used for neutralization activity detection. The high-glucose DMEM culture medium and virus suspension incubation group were used as negative controls, and the plaque counts of monoclonal antibodies or polyclonal antibodies and virus suspensions were used to determine whether the antibodies had neutralization activity. The results are shown in ( Fig. 9 ), the number of empty plaques in the cell wells of the immunized serum (polyclonal antibody) was significantly reduced compared with the negative control wells, indicating neutralizing activity, while the number of empty plaques in the cell wells of the 2F1E12 strain monoclonal antibody was not significantly reduced compared with the negative control, indicating no neutralizing activity.

[0132] This specific embodiment is merely an explanation of the present invention and is not a limitation of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A VSV-WEEV recombinant virus, characterized in that: It is constructed by replacing the G protein of vesicular stomatitis virus with the structural protein E3E2E1 of western equine encephalitis virus.

2. The VSV-WEEV recombinant virus according to claim 1, characterized in that The VSV-WEEV recombinant virus is specifically constructed according to the following steps: Based on the gene sequence of Western equine encephalitis virus, the target gene encoding structural protein E3E2E1 was synthesized; Using the target gene as a template, designing primers and amplifying the target gene; The amplified product was connected to the pVSV-△G-EGFP vector, transformed into tool cells, cultured, and extracted to obtain the pVSV-△G-WEEV-E3E2E1-EGFP recombinant plasmid; Transfection and rescue were performed to obtain the VSV-WEEV recombinant virus.

3. The VSV-WEEV recombinant virus according to claim 2, characterized in that The pVSV-△G-EGFP vector was digested with EcoRI and then connected with the amplified product.

4. The VSV-WEEV recombinant virus according to claim 2, characterized in that The tool cells are DH5α competent cells.

5. A composition comprising the recombinant virus according to claim 1.

6. The composition according to claim 5, characterized in that The composition includes a pharmaceutically acceptable carrier or excipient.

7. A nucleic acid molecule comprising the genome of the recombinant virus of claim 1.

8. Use of the VSV-WEEV recombinant virus according to claim 1, the composition according to claim 5, or the nucleic acid molecule according to claim 7 in the preparation of a drug for resisting Western equine encephalitis virus infection.

9. The use according to claim 8, characterized in that: The medicine is a vaccine.

Images