Lipase mutant and application thereof in purification of natural vitamin E

Abstract

The invention relates to the technical field of gene engineering and protein modification, in particular to a lipase mutant. According to the invention, on the basis of wild type lipase TLS, a lipase mutant which respectively contains T136W single-point mutation, G113V / T136W two-point mutation and G113V / T136W / I277P three-point mutation is provided. Compared with a wild type, the lipase mutant has the advantage that the tolerance of the lipase mutant to an acidic condition is obviously enhanced. After the mutant is treated for 15 minutes under the condition of pH 3.0, the enzyme activity residual rate of the mutant can still reach 30.20%-44.33% and is far higher than that of a wild type. The lipase mutant can remarkably promote methyl esterification of free fatty acid, and the conversion rate is up to 72.40%-89.23%; wherein the lipase mutant containing G113V / T136W / I277P three-point mutation has the highest methyl ester conversion rate which reaches 89.23%, and an unexpected technical effect is achieved. The lipase mutant can be widely applied to purification of natural vitamin E.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and protein engineering transformation, and specifically relates to a lipase mutant and application thereof in the purification of natural vitamin E. Background Art

[0002] Deodorized distillate is an important raw material for extracting natural vitamin E. As a by-product of oil refining, its main components are free fatty acids, glycerides, natural vitamin E, sterols, sterol esters and other oxidative decomposition products. However, since the physical and chemical properties of each component are similar and natural vitamin E is easily oxidized, it is often difficult to directly extract high-content natural vitamin E from deodorized distillate, and the raw materials need to be pretreated to improve the selectivity of the separation process.

[0003] Domestic natural vitamin E manufacturers mainly use the esterification-cold separation-molecular distillation process. Generally, the free fatty acids and glycerides in the deodorized distillate are first subjected to methyl esterification reaction with methanol to convert them into fatty acid methyl esters with lower boiling points. At the same time, the viscosity of the entire system is reduced, which is beneficial to the subsequent separation of plant sterols, thereby achieving the purpose of purifying natural vitamin E.

[0004] The traditional chemical pretreatment process of deodorized distillate usually uses concentrated sulfuric acid as a catalyst, which has a short reaction time and high esterification efficiency, but the reaction temperature is high, and the production equipment must have strong corrosion resistance. At the same time, the production process produces a large amount of waste acid water, which pollutes the environment.

[0005] In order to overcome the shortcomings of chemical methods, bioenzymatic methyl esterification has been a research hotspot in recent years. Lipase can catalyze a variety of reaction types, including esterification, transesterification and hydrolysis. The enzyme reaction conditions are mild, efficient and specific, with low energy consumption, high yield, and easy product separation and purification, which conforms to the concept of green environmental protection and sustainable development. However, due to the presence of fatty acids in the deodorized distillate, the initial pH is low, the activity of the enzyme is greatly inhibited, and the catalytic efficiency is greatly reduced. Adjusting the pH by alkaline solution can easily cause the destruction of the active structure of vitamin E. Although the immobilization of lipase improves the tolerance of the enzyme to acidic environments, it will cause cost increases. Therefore, it is urgent to develop an acid-resistant lipase strain with high catalytic activity to improve production efficiency and reduce production costs. Summary of the invention

[0006] The present invention solves the problems of the prior art and provides a lipase mutant and its application in the purification of natural vitamin E. Based on lipase TLS, the present invention screens a large number of mutations to finally obtain a lipase mutant with significantly improved acid resistance, which has good catalytic activity, can improve production efficiency during application, reduce the use of chemical reagents, and reduce production costs.

[0007] The present invention provides a lipase mutant, wherein the amino acid sequence of the lipase is SEQ ID NO: 1, and the 136th amino acid is changed from Thr to Trp.

[0008] The amino acid sequence of the lipase mutant is SEQ ID NO: 3, and the nucleic acid sequence of a coding gene thereof is SEQ ID NO: 4.

[0009] In one aspect, the present invention provides a lipase mutant, wherein the lipase having the amino acid sequence of SEQ ID NO: 3 has its 113th amino acid changed from Gly to Val.

[0010] The amino acid sequence of the lipase mutant is SEQ ID NO:5, and the nucleic acid sequence of a coding gene thereof is SEQ ID NO:6.

[0011] In one aspect, the present invention provides a lipase mutant, wherein the lipase having an amino acid sequence of SEQ ID NO: 5 has its amino acid position 277 changed from Ile to Pro.

[0012] The present invention also relates to a DNA molecule encoding the above lipase mutant.

[0013] The present invention also includes a recombinant expression vector carrying the above DNA molecule.

[0014] The present invention also provides a host cell comprising the above recombinant expression vector.

[0015] The host cell is Pichia pastoris.

[0016] The present invention is based on the wild-type lipase TLS, and provides lipase mutants respectively comprising T136W single point, G113V / T136W two points, and G113V / T136W / I277P three point mutations. Compared with the wild type, the tolerance of the lipase mutant to acidic conditions is significantly enhanced. After being treated for 15 minutes under pH 3.0 conditions, the residual enzyme activity rate of the mutant can still reach 30.20%-44.33%, which is much higher than that of the wild type; among them, the residual enzyme activity rate of the lipase mutant comprising the G113V / T136W / I277P three point mutations is the highest, reaching 44.33%. The lipase mutant can significantly promote the methyl esterification of free fatty acids, with a conversion rate of up to 72.40%-89.23%; among them, the methyl ester conversion rate of the lipase mutant comprising the G113V / T136W / I277P three point mutations is the highest, reaching 89.23%, achieving unexpected technical effects. The lipase mutant can be widely used in the purification of natural vitamin E. DETAILED DESCRIPTION

[0017] The present invention is further described below in conjunction with specific implementation cases, and those skilled in the art can better understand and grasp the present invention. The experimental conditions and methods not specifically described in the present embodiment can refer to "Molecular Cloning: Laboratory Guide" (Sambrook et al., Cold Spring Harbor Laboratory Press, 1989) or are carried out according to the conditions recommended by the manufacturer. For the usage and dosage of reagents, unless otherwise specified, they are used according to conventional usage and dosage. The non-creative improvements made by those skilled in the art on the basis of the principles of the present invention are all regarded as protection scope of the present invention.

[0018] Experimental materials and reagents:

[0019] Experimental strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, and vector pPIC9k were purchased from Invitrogen.

[0020] Main reagents: PCR enzyme and ligase were purchased from Takara, restriction endonuclease was purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0021] Culture medium formula:

[0022] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0023] LB+Amp medium: LB medium plus 100 μg / mL ampicillin;

[0024] LB+Kana medium: LB medium plus 50 μg / mL kanamycin;

[0025] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0026] Yeast screening medium (MD medium): 2% glucose, 1.34% YNB, 4×10 -5 % biotin, 2% agar powder;

[0027] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;

[0028] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;

[0029] The present invention is described in detail below with reference to the embodiments.

[0030] Example 1 Synthesis of lipase gene and acquisition of recombinant plasmid

[0031] The lipase (named TLS) gene sequence shown in SEQ ID NO: 2 was used as a reference, and the gene was artificially synthesized at Shanghai Jierui Biotechnology Co., Ltd., and its encoded amino acid sequence is SEQ ID NO: 1.

[0032] The primer sequences are as follows:

[0033] 5' primer TLS-F: GGC GAATTC GGCCAGTCCTATTCGTCGAG (the underline is the restriction endonuclease EcoRI recognition site),

[0034] 3' primer TLS-R:ATA GCGGCCGC TACCCATTTCCACGCAGGTC (the underline indicates the recognition site of restriction endonuclease NotI).

[0035] The synthesized lipase TLS gene was used as a template and the above primers were used for PCR amplification. The PCR amplification system was: template 1 μL, upstream primer 1 μL, downstream primer 1 μL, 5×PSBuffer 10 μL, dNTPs (2.5 mM) 4 μL, Primer-Star DNA polymerase 1 μL, ddH2O 32 μL, and the total reaction system was 50 μL. The PCR cycle program was: 95°C pre-denaturation 5 min, 30 cycles: 94°C 30 sec, 55°C 30 sec, 72°C 2 min, 72°C 10 min; the PCR product was recovered by gel, and after EcoRI and NotI were treated with enzymes, it was connected with the pPIC-9k vector that had been similarly cut at 16°C overnight and transformed into Escherichia coli DH5a, coated on LB+Amp plates, and inverted at 37°C. After the transformants appeared, the positive clones were verified by colony PCR, and the correct recombinant plasmid pPIC9K-TLS was finally obtained after sequencing verification.

[0036] Example 2 Lipase mutant screening

[0037] Under the premise of not destroying the secondary structure and active center of the protein, in order to improve the enzymatic activity of the above-mentioned lipase under acidic conditions, a large number of mutation sites of the gene were further screened. Lipase TLS was used as a template and the above-mentioned primers were used to perform PCR amplification using the GeneMorph II random mutation PCR kit (Stratagene). The PCR product was recovered by gel recovery, and after restriction digestion, it was connected with the pET-28a vector that had been digested with the same enzymes, and transformed into Escherichia coli BL21 (DE3), coated on LB+Kana plates, and inverted cultured at 37°C. After the transformants appeared, they were picked up one by one with a toothpick to a 96-well plate, and 150ul of LB+Kana medium containing 0.1mM IPTG was added to each well. The cells were cultured at 37°C and 220rpm for about 6h, and the supernatant was discarded by centrifugation. The bacteria were resuspended in buffer and repeatedly frozen and thawed to break the cell wall to obtain Escherichia coli cell lysate containing lipase.

[0038] 40ul of lysate was taken out to two new 96-well plates, and the lipase activity was measured after 15 minutes of reaction at pH 3.0 and pH 5.0. The results showed that some mutants did not change the enzyme activity under acidic conditions; some mutations even made their acid resistance or enzyme activity worse; and some mutations, although they could improve the pH tolerance of lipase TLS, had significant changes in the enzyme activity after mutation, which did not meet the requirements. Finally, the mutation sites that could significantly improve the acid resistance of lipase TLS without affecting its enzyme activity and original enzymatic properties were obtained: G113V, T136W, and I277P.

[0039] The lipase mutant containing the T136W single point mutation was named TLS-M1, and its amino acid sequence was SEQ ID NO: 3. A coding nucleotide sequence was synthesized with reference to the sequence and was SEQ ID NO: 4.

[0040] The lipase mutant containing the two point mutations G113V / T136W was named TLS-M2, and its amino acid sequence was SEQ ID NO: 5. A coding nucleotide sequence was synthesized with reference to the sequence and was SEQ ID NO: 6.

[0041] The lipase mutant containing the three-point mutations G113V / T136W / I277P was named TLS-M3, and its amino acid sequence was SEQ ID NO: 7. A coding nucleotide sequence was synthesized with reference to the sequence and was SEQ ID NO: 8.

[0042] Example 3 Construction of Pichia pastoris engineered strains

[0043] 3.1 Recombinant plasmid construction

[0044] The above-mentioned lipase TLS and its mutant genes were used as templates for amplification, and the PCR products were recovered by gel recovery. After being digested with EcoRI and NotI, they were connected with the pPIC-9k vector that had been digested with the same enzymes at 16°C overnight and transformed into Escherichia coli DH5a. The plates were spread on LB+Amp plates and inverted at 37°C. After the transformants appeared, the positive clones were verified by colony PCR, and the correct recombinant plasmid was finally obtained after sequencing verification.

[0045] 3.2 Preparation of competent yeast

[0046] The Pichia pastoris GS115 strain was activated on a YPD plate and cultured at 30°C for 48 h. After that, the activated GS115 single clone was inoculated into 5 mL YPD liquid medium. After culturing at 30°C and 220 rpm for about 18 h, the bacterial solution was transferred to a 50 ml In a conical flask containing YPD liquid culture medium, culture at 30℃ and 220rpm for about 5h, and detect the bacterial density with a UV spectrophotometer. When the OD600 value is in the range of 1.1-1.3, centrifuge at 4℃ and 6000rpm for 3min, collect 5ml of bacteria into sterilized EP tubes, gently discard the supernatant, absorb the remaining supernatant with sterilized filter paper, and resuspend the bacteria with 2mL of precooled sterile water, centrifuge at 4℃ and 6000rpm for 3min, gently discard the supernatant, and resuspend the bacteria with 2mL of precooled sorbitol (1mol / L); centrifuge at 4℃ and 6000rpm for 3min, gently discard the supernatant, and gently resuspend the bacteria with 100-150μl of precooled sorbitol (1mol / L).

[0047] 3.3 Transformation and screening

[0048] The recombinant plasmids of the lipase TLS and its mutants constructed above were linearized with Sac I, and the linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation, and the recombinant strains of Pichia pastoris were screened on MD plates. A single transformant was picked and transferred to BMGY medium, and after shaking culture at 30°C and 250rpm for 1 day, it was transferred to BMMY medium and shaken at 30°C and 250rpm, and 0.5% methanol was added every day. After induced expression for 3 days, the supernatant was obtained by centrifugation to remove the bacteria and measure the activity of lipase.

[0049] The results showed that the enzyme activity of lipase in the fermentation supernatant of the Pichia pastoris engineered strain expressing the recombinant lipase TLS and its mutants constructed by the present invention was 176-225 U / ml.

[0050] Lipase activity assay

[0051] (1) Definition of enzyme activity unit

[0052] Referring to GB / T23535-2009, the amount of enzyme required to produce 1 μmol of fatty acid per minute at a temperature of 40°C and a pH of 7.5 is defined as one enzyme activity unit, expressed as U.

[0053] (2) Measurement method

[0054] Olive oil and 4% (w / v) polyvinyl alcohol (PVA) were mixed in a ratio of 1:3 (v / v), and treated twice with a high-speed homogenizer, with an interval of 5 minutes, and each treatment was 3 minutes, to obtain a milky white PVA emulsion, and the emulsified olive oil was used as a lipase hydrolysis substrate. Take two 100mL beakers, add 4mL of olive oil emulsion and 5mL of citric acid-phosphate buffer to the blank cup (A) and the sample cup (B), then add 15mL of 95% ethanol to cup A, preheat in a 40℃ water bath for 5 minutes, then add 1mL of the enzyme solution to be tested to cups A and B, mix and time immediately, and after an accurate reaction of 15 minutes, immediately add 15mL of 95% ethanol to cup B to terminate the reaction, and take it out; place the beaker on a magnetic stirrer, and titrate with 0.05mol / L sodium hydroxide standard solution while stirring until it turns slightly red and does not fade for 30 seconds as the titration end point, and record the volume of sodium hydroxide standard solution consumed.

[0055] Enzyme activity calculation formula:

[0056]

[0057] Where: X D is the enzyme activity of the sample, U / mL; V1 is the volume of sodium hydroxide standard solution consumed when titrating the sample, mL; V2 is the volume of sodium hydroxide standard solution consumed when titrating the blank, mL; c is the concentration of sodium hydroxide standard solution, mol / L; 50 means 1mL of 0.05mol / L sodium hydroxide solution is equivalent to 50μmol of fatty acid; n1 is the dilution multiple of the sample; 0.05 is the conversion coefficient of the sodium hydroxide standard solution concentration; 1 / 15 is the reaction time of 15min.

[0058] Example 4 Acid resistance analysis of lipase mutants

[0059] The Pichia yeast fermentation supernatant of the recombinant lipase and its mutants constructed above was added to a pH 3.0 citric acid-phosphate buffer, and the residual activity of the lipase was detected after 15 minutes. The relative enzyme activity was calculated with the initial enzyme activity as 100% (see Table 1).

[0060] Table 1 Analysis of acid resistance of lipase mutants

[0061] Lipase Mutation site Residual enzyme activity after treatment at pH 3.0 for 15 min Wild-type TLS - 3.20％ Mutant TLS-M1 T136W 30.20％ Mutant TLS-M2 G113V / T136W 38.80％ Mutant TLS-M3 G113V / T136W / I277P 44.33％

[0062] From the results in Table 1, it can be seen that compared with the wild-type lipase TLS, the tolerance of the lipase mutant provided by the present invention to acidic conditions is greatly enhanced. After being treated for 15 minutes under pH 3.0 conditions, the residual enzyme activity rate of the mutant can still reach 30.20%-44.33%, which is much higher than that of the wild type. Among them, the residual enzyme activity rate of the lipase mutant containing the G113V / T136W / I277P triple mutation is the highest, reaching 44.33%, achieving unexpected technical effects.

[0063] Example 5 Application of lipase mutants in the purification of natural vitamin E

[0064] Deodorizer distillates are mixtures of fractions obtained during the deodorization of vegetable oils, which mainly contain a large amount of free fatty acids, vitamin E, glycerides and other components. Based on the easy separation of vitamin E and fatty acid monoesters, free fatty acids and neutral oils in deodorizer distillates are generally converted into fatty acid monoesters, and then vitamin E and the above-mentioned fatty acid monoesters are further separated. Lipase can be used for the methyl esterification of free fatty acids in deodorizer distillates of vegetable oils, which is conducive to the purification of vitamin E.

[0065] 1. Enzyme solution:

[0066] The fermentation supernatant of the Pichia pastoris engineered strain expressing the recombinant lipase TLS and its mutants constructed in Example 3.

[0067] 2. Esterification process

[0068] 20 μL of enzyme solution was taken, mixed with 80 μL of water, 300 μL of soybean oil deodorization distillate, and 40 μL of methanol (5 μL was added every half an hour, for a total of 8 times), placed on an oscillator, reacted at 40°C and 1000 rpm for 12 hours, and centrifuged at 12000 rpm for 3 minutes. The acid value of the upper oil phase was determined according to the hot ethanol method in accordance with the national standard GB5009.229-2016, and the methyl ester conversion rate was calculated according to the following formula:

[0069]

[0070] Wherein: C is the methyl ester conversion rate, %; X0 is the initial acid value of the soybean deodorization distillate reaction, mgKOH / g; X1 is the acid value of the upper oil phase after the reaction, mgKOH / g.

[0071] Table 2 Effect of lipase mutants on free fatty acid methyl ester conversion

[0072] Lipase Mutation site Methyl ester conversion Wild-type TLS - 13.22％ Mutant TLS-M1 T136W 72.40％ Mutant TLS-M2 G113V / T136W 80.58％ Mutant TLS-M3 G113V / T136W / I277P 89.23％

[0073] From the results in Table 2, it can be seen that compared with the wild-type lipase TLS, the lipase mutant provided by the present invention can significantly promote the methyl esterification of free fatty acids, with a conversion rate as high as 72.40%-89.23%; among them, the lipase mutant containing the G113V / T136W / I277P triple mutation has the highest methyl ester conversion rate, reaching 89.23%, achieving unexpected technical effects.

[0074] The lipase mutant provided by the present invention has strong acid resistance and can be widely used in the methyl esterification of free fatty acids, thereby improving the conversion efficiency and further facilitating the purification of vitamin E.

[0075] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A lipase mutant, characterized in that: The amino acid sequence of the mutant is SEQ ID NO:

7.

2. A gene encoding the lipase mutant according to claim 1.

3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is SEQ ID NO:

8.

4. A recombinant expression plasmid comprising the gene according to claim 2 or 3.

5. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 4; the host cell is a non-plant cell.

6. The host cell according to claim 5, characterized in that The host cell is Pichia pastoris ( Pichia pastoris ).

7. Use of the lipase mutant according to claim 1 in the purification of natural vitamin E.

Images