Application of RsNRAMP5 heavy metal transporter protein in cadmium absorption and active oxygen accumulation of radishes

Abstract

The invention discloses an application of RsNRAMP5 heavy metal transporter protein in cadmium absorption and active oxygen accumulation of radish, which comprises the following steps: (1) cloning RsNRAMP5 by using radish cDNA as a template, and the cDNA sequence of the RsNRAMP5 is as shown in SEQ ID NO.1; (2) the increase of Cd treatment time (6h, 12h, 24h) on the expression level of the RsNRAMP5 gene is obviously up-regulated; (3) overexpression of RsNRAMP5 significantly increases the absorption of Cd < 2 + > in yeast cells; (3) the activity of the RsNRAMP5 promoter in the radish cotyledons can be obviously induced through treatment of 100 [mu] M Cd; and (4) instantaneously transforming the radish cotyledons by using an agrobacterium injection method, analyzing the change of the content of H2O2, O2 <.-> and Cd in the radish cotyledons under the treatment of CdCl2 and the inhibition expression of RNAi, and discovering that the overexpressed RsNRAMP5 promotes the absorption of Cd and the accumulation of active oxygen in the radish cotyledons. The invention provides a theoretical basis for breeding low Cd accumulation radish germplasm by using a genetic engineering technology in future, and has a very high application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of radish RsNRAMP5 heavy metal transporter in promoting radish cadmium absorption and active oxygen accumulation. Background Art

[0002] Cadmium (Cd) is a heavy metal element with extremely strong biological toxicity and is highly mobile and hidden in the environment. Excessive absorption and accumulation of Cd in plants can lead to a decrease in the number of mitochondria in cells, damage the thylakoid membrane structure, inhibit photosynthesis and respiration, and cause a sharp decline in crop yield and quality. In addition, excessive Cd can enter the human body through the food chain, causing chronic damage to multiple organs in the human body. Therefore, how to effectively control the absorption and accumulation of Cd in plants is crucial to food safety and human health.

[0003] Radish (Raphanus sativus L.) is an important root vegetable of the genus Raphanus in the family Cruciferae. It is rich in nutrients, and its fleshy roots are prone to accumulate heavy metal ions, which can threaten human health through the food chain. The absorption and accumulation of heavy metal Cd has become an important limiting factor for the high-quality cultivation and safe production of radish. NRAMP (Natural Resistance-Associated Macrophage Protein) is an important class of metal ion transporters, which contains 10 to 12 transmembrane domains and can transport metal ions such as Cd, Pb, Zn, and Mn. In Arabidopsis, except AtNRAMP4, the other five AtNRAMPs are involved in the transport of Cd and Mn. AtNRAMP3, AtNRAMP4, and AtNRAMP6 are localized in the vacuole membrane and participate in Fe transport in the vacuole. In rice, OsNRAMP1 is involved in Fe and Cd absorption, while OsNRAMP3 and OsNRAMP4 are involved in Fe and Al transport, respectively. OsNRAMP 5 is a major heavy metal transporter responsible for Cd absorption and Fe and Mn transport in rice. The relevant research results provide an important theoretical basis and technical support for analyzing the biological function of the RsNRAMP5 gene in radish Cd absorption and accumulation and the genetic improvement of low Cd accumulation traits. Summary of the invention

[0004] The purpose of the present invention is to provide an application of radish RsNRAMP5 heavy metal transporter in radish Cd absorption and active oxygen accumulation.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] (1) Cloning the coding region and promoter sequence of the radish RsNRAMP5 gene. The nucleotide sequence is shown in the sequence listing SEQ ID NO: 1, and the promoter sequence is shown in the sequence listing SEQ ID NO: 2.

[0007] (2) RT-qPCR technology was used to verify that the RsNRAMP5 gene was upregulated under Cd stress.

[0008] (3) Using the homologous recombination method, the CDS sequence of the RsNRAMP5 gene was recombined into the pCAMBIA1300, pTCK303, and pYES2.0 vectors, respectively, to construct 35S::RsNRAMP5, RNAi::RsNRAMP5, and PYES2-RsNRAMP5 target gene recombinant plasmids.

[0009] (4) PYES2-RsNRAMP3, PYES2-RsNRAMP4, PYES2-RsNRAMP5 and pYES2 empty vector were integrated into yeast competent BY4741 by LiAc-PEG transformation method, and yeast cells were treated with CdCl2 (0 μM, 25 μM, 50 μM). Heterologous yeast expression analysis showed that RsNRAMP5 has the ability to transport Cd in yeast. 2+ and promote the growth of Cd in yeast 2+ absorption.

[0010] (5) In the dark, the Agrobacterium tumefaciens GV3101 carrying the proRsNRAMP5-GUS vector was injected into radish cotyledons and treated with 50 μM CdCl2 for 12 h. Then, the radish cotyledons were placed in β-glucosidase (GUS) dye and stained at 37°C for 24 h. The results showed that the promoter activity of RsNRAMP5 was significantly induced by Cd.

[0011] (6) The 35S::RsNRAMP5, RNAi::RsNRAMP5, and pCAMBIA1300 empty gene recombinant plasmids were transformed into Agrobacterium tumefaciens GV3101 and infiltrated into two-week-old radish seedlings using the Agrobacterium transient injection technique. The seedlings were treated with 50 μM CdCl2 and 1 / 2 Hoagland nutrient solution was used as a control. The radish cotyledons were stained with DAB and NBT, and the H2O2 and O2· - The determination of the content showed that overexpression of RsNRAMP5 could enhance the accumulation of reactive oxygen species in radish cotyledons.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The present study found that RsNRAMP5 has Cd transport activity and promotes Cd in yeast2+ Overexpression of RsNRAMP5 promoted Cd absorption and reactive oxygen accumulation in plants. The results of this study not only help to further elucidate the regulatory network of RsNRAMP5-mediated Cd absorption and transport in radish, but also provide new targets for the creation of low-Cd content radish germplasm and breeding of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The CDS sequence of the RsNRAMP5 gene was amplified. Lane 1 is the DL2000 molecular weight marker, and lanes 2 to 4 are the CDS fragments of the RsNRAMP5 gene.

[0015] Figure 2 The expression pattern of RsNRAMP5 gene at different time points (0h, 6h, 12h and 24h) under 50μM CdCl2 treatment. Duncan multiple comparison test was used, and different letters above the columns indicate significant differences among columns (P<0.05).

[0016] Figure 3 Analysis of Cd transport activity of RsNRAMP3, RsNRAMP4, and RsNRAMP5 in yeast cells. (A) Growth of yeast cells containing pYES2 empty load, PYES2-RsNRAMP3, PYES2-RsNRAMP4, and PYES2-RsNRAMP5 in YNB medium containing CdCl2 (0, 25, and 50 μM). (B) Determination of Cd content in yeast cells under the action of 50 μM CdCl2 (P < 0.01; P < 0.001).

[0017] Figure 4 Functional analysis of RsNRAMP5 in radish Cd absorption and reactive oxygen species accumulation. (A) RsNRAMP5 promoter activity in radish cotyledons under control and 50 μM CdCl2 treatment. (B) Relative GUS activity of RsNRAMP5 promoter. (C) and (D) represent NBT and DAB staining of empty vector (EV), RsNRAMP5-OE and RsNRAMP5-RNAi vector injected into radish cotyledons, respectively. (E) Cd content in radish cotyledons under 50 μM CdCl2 treatment. (F) H2O2, O2· - , MDA and proline content. *P<0.05; **P<0.01; ***P<0.001. DETAILED DESCRIPTION

[0018] The embodiment of the present invention discloses an application of radish RsNRAMP5 heavy metal transporter in radish Cd absorption and active oxygen accumulation. The unmentioned methods used in this embodiment are all conventional experimental methods, which will not be described here.

[0019] Example 1: Isolation and cloning of RsNRAMP5 gene

[0020] 1. Plant Materials

[0021] The surface of the seeds of the radish superior inbred line 'NAU-DY' was sterilized, and the germinated seeds were planted in nutrient pots containing vermiculite and peat (2:1). The radish seedlings were cultured in a solar greenhouse at the Weigang Campus of Nanjing Agricultural University for two weeks, with a photoperiod of 14h / 24℃ light and 10h / 16℃ dark. Then, the radish seedlings at the cracked cortex stage were transplanted into 1 / 2 Hoagland nutrient solution and renewed every three days.

[0022] 2. Total RNA Extraction and RT-qPCR Analysis

[0023] Total RNA was isolated and extracted from the control and Cd-treated fleshy root samples using the RNA simple Total RNA Kit (Tiangen, Beijing, China). cDNA was obtained using the reverse transcription kit III RT SuperMix for qPCR (NoviZan, Nanjing, China).

[0024] 3. RsNRAMP5 gene cloning

[0025] 'NAU-DY' radish fleshy root cDNA was used as a template and primers (RsNRAMP5-F1 / RsNRAMP5-R1) were used for PCR cloning.

[0026] The PCR reaction system is:

[0027]

[0028] The PCR reaction program is:

[0029]

[0030] 1.2% TAE agarose gel electrophoresis was used to detect the fragments, and the bands with the correct size were selected. DNA was recovered using the DNA Extraction Mini Kit (Novagen, Nanjing, China). OneStep Cloning Kit (NoviZan, Nanjing, China) was used for ligation, and the ligation product was transformed into Escherichia coli DH5α, evenly spread on the LB solid culture medium plate with corresponding resistance, and inverted cultured at 37°C for 14-16h. Single clones were picked and tested for bacterial liquid PCR. The corresponding correct bands were selected and sent to Qingke Biotechnology Co., Ltd. for sequencing. After the sequencing was correct, the bacteria were shaken and propagated. Plasmid was extracted using Plasmid Mini Kit (Novizan, Nanjing, China) to obtain the cDNA sequence of RsNRAMP5.

[0031] RsNRAMP5-F1 (SEQ ID NO: 3): ATGACGGATCCAACCGTTTCCCGCCA

[0032] RsNRAMP5-R1 (SEQ ID NO: 4):CGTCTCCGTGGAAACAACTCTCTGTGA

[0033] Example 2: Expression of RsNRAMP5 under heavy metal cadmium stress

[0034] 1. Plant materials and Cd treatment

[0035] The radish high-generation inbred line 'NAU-DY' was used as the material, and the culture method was the same as in Example 1. When the radish plants grew to the belly-breaking stage, radish seedlings with consistent growth were selected and placed in 1 / 2 Hoagland nutrient solution containing 50μM CdCl2 for 0h, 6h, 12h, and 24h. Three biological replicates were set for each treatment, and each replicate contained 6 radish plants. The radish fleshy roots were collected, rinsed with ddH2O 3 times, and immediately frozen in liquid nitrogen after draining the water, and stored in a -80℃ refrigerator.

[0036] 2. Total RNA Extraction and RT-qPCR Analysis

[0037] The total RNA extraction and reverse transcription methods were the same as those in Example 1. RT-qPCR reaction was performed using the 480 fluorescence quantitative system (Roche, Germany). Three biological replicates and three technical replicates were set for each sample. RsActin was used as an internal reference. -ΔΔC T The relative expression level of the target gene was calculated.

[0038] The sequences of the internal reference gene primers are as follows:

[0039] RsActin-F (SEQ ID NO: 5): 5′-GCATCACACTTTCTACAAC-3′

[0040] RsActin-R (SEQ ID NO: 6): 5′-CCTGGATAGCAACATACAT-3′

[0041] The target gene RT-qPCR primer sequences are as follows:

[0042] RsNRAMP5-F2 (SEQ ID NO: 7): 5′-AAACTAAGCCGAGCGGACAA-3′

[0043] RsNRAMP5-R2 (SEQ ID NO: 8): 5′-TGCACTAGAGCGGAATGCAA-3′

[0044] like Figure 2 As shown in the figure, under normal conditions (without Cd treatment), the expression level of RsNRAMP5 is very low. Under Cd treatment at three different time periods, the relative expression level of RsNRAMP5 gene increased. With the extension of Cd treatment time, the relative expression level of RsNRAMP5 gene gradually increased, and the relative expression level was the highest at 24h, which was 59.26 times that of the control plants.

[0045] Example 3: RsNRAMP5 has Cd transport activity in yeast

[0046] 1. Construction of PYES2-RsNRAMP3, PYES2-RsNRAMP4, and PYES2-RsNRAMP5 vectors

[0047] Using radish fleshy root cDNA as a template, the cds sequences of RsNRAMP3, RsNRAMP4 and RsNRAMP5 genes were amplified by the following primers, and connected to the PYES2 vector using the homologous recombination method.

[0048] pYES2-RsNRAMP3-F (SEQ ID NO: 9)

[0049] 5'-actatagggaatattaagcttATGTCACGGCTCGAGAACGA-3′

[0050] pYES2-RsNRAMP3-R (SEQ ID NO: 10)

[0051] 5'-ccctctagatgcatgctcgagTCATCGACTAGACTCTGCTTTAGAGC-3′

[0052] pYES2-RsNRAMP4-F (SEQ ID NO: 11):

[0053] 5'-actatagggaatattaagcttATGTCGGAGACGGAGAGAGGTC-3′

[0054] pYES2-RsNRAMP4-R (SEQ ID NO: 12):

[0055] 5'-ccctctagatgcatgctcgagTTACTCATCATCCCTCTGTGTCACTT-3′

[0056] pYES2-RsNRAMP5-F (SEQ ID NO: 13):

[0057] 5'-actatagggaatattaagcttATGACGGATCCAACCGTTTCC-3′

[0058] pYES2-RsNRAMP5-R (SEQ ID NO: 14):

[0059] 5'-ccctctagatgcatgctcgagCTACGTCTCCGTGGAAACAACTC-3′

[0060] PCR amplification, gel recovery, ligation transformation, bacterial liquid PCR and sequencing verification were performed according to the method of vector construction in Example 1 to extract the positive plasmid.

[0061] 2. RsNRAMP5 gene has Cd transport activity and promotes Cd uptake in yeast cells 2+ absorb

[0062] To analyze the heavy metal transport activity of the RsNRAMP5 gene, PYES2-RsNRAMP3, PYES2-RsNRAMP4, PYES2-RsNRAMP5 and the pYES2 empty vector were integrated into the yeast competent BY4741 using the LiAc-PEG method. The transformed yeast cells were suspended and spread on SD / -Ura solid medium. After 72 hours of culture, a single colony was transferred to SD / -Ura liquid medium using a sterile pipette tip and cultured at 28°C for 24 hours. Then, the OD of the yeast solution was adjusted to 1.0 using SD / -Ura liquid solution, and 5.0 μL was aspirated and spotted on YNB / -Ura / Gal solid medium containing 0, 25 and 50 μM CdCl2, respectively, and placed in a 30°C incubator for 3 days.

[0063] The yeast cells carrying PYES2-RsNRAMP5 and pYES2 empty vector were transferred into SD / -Ura liquid medium containing 2% galactose and 50 μM CdCl2, respectively. After 12 h of culture, the Cd content in yeast cells was determined using an inductively coupled plasma optical emission spectrometer (ICP-OES, iCAP7400, Thermo Fisher, USA).

[0064] In the medium containing galactose, no significant changes were detected in the growth of yeast cells expressing PYES2-RsNRAMP3, PYES2-RsNRAMP4, PYES2-RsNRAMP5 and pYES2 empty vector under control conditions. However, compared with yeast cells expressing the empty vector, overexpression of RsNRAMP5 significantly inhibited the growth of yeast cells under 25μM and 50μM CdCl2 treatment, and the Cd content in yeast cells overexpressing RsNRAMP5 was significantly higher than that in the control group (P < 0.01). However, under the same concentration of CdCl2 treatment, overexpression of RsNRAMP3 and RsNRAMP4 had no obvious effect on yeast cell growth. Related research results show that RsNRAMP5 has a strong Cd absorption activity and can promote Cd uptake in yeast cells. 2+ absorb.

[0065] Example 4: RsNRAMP5 gene promoter activity is induced by Cd

[0066] 1. Construction of proRsNRAMP5-GUS vector

[0067] To analyze whether the promoter activity of RsNRAMP5 is induced by Cd stress, the RsNRAMP5 promoter sequence (2000 bp upstream of the ATG start site) was fused with the pCAMBIA1391-GUS vector, and the RsNRAMP5 promoter sequence is shown in Sequence Table Seq 2. Using radish fleshy root DNA as a template, amplification was performed using a pair of primers (pRsNRAMP5-GUS-F / pRsNRAMP5-GUS-R) shown below, and PCR amplification, gel recovery, ligation transformation, bacterial liquid PCR and sequencing verification were performed using the vector construction method of Example 1, and the proRsNRAMP5-GUS recombinant plasmid was obtained by propagation.

[0068] pRsNRAMP5-GUS-F (SEQ ID NO: 15):

[0069] 5'-tggctgcaggtcgacggatccTGGCCACCACCACTTTGAGA-3′

[0070] pRsNRAMP5-GUS-R (SEQ ID NO: 16):

[0071] 5'-ggtggactcctcttagaattcGTTTTTTGTAACGGATTTTTTTTTT-3′

[0072] 2. RsNRAMP5 gene promoter activity is induced by Cd

[0073] The two-week-old radish cotyledons were infected with the bacterial solution of Agrobacterium tumefaciens strain GV3101 carrying proRsNRAMP5-GUS and placed in 1 / 2 Hoagland nutrient solution containing 50μM CdCl2 for 12h. Then, the radish cotyledons were placed in β-glucosidase (GUS) dye and stained at 37℃ for 24h. The GUS intensity was calculated using J1.50 imaging software. Under 50μM CdCl2 treatment, the GUS activity of radish cotyledons infiltrated with proRsNRAMP5-GUS was significantly stronger than that of radish cotyledons infiltrated with pCAMBIA1391 vector (P<0.05). The GUS staining results showed that the promoter activity of RsNRAMP5 was significantly induced by CdCl2.

[0074] Example 5: Overexpression of RsNRAMP5 enhances Cd absorption and reactive oxygen accumulation in radish

[0075] 1. Construction of 35S::RsNRAMP5 and RNAi::RsNRAMP5 vectors

[0076] Using radish fleshy root cDNA as a template, the CDS of the RsNRAMP5 gene was connected to the pCAMBIA1300 vector using GFP-RsNRAMP5-F / GFP-RsNRAMP5-R primers, and was connected to the pTCK303 vector using RNAi-NRAMP5-ZF / RNAi-NRAMP5-ZR and RNAi-NRAMP5-FF / RNAi-NRAMP5-R primers. PCR amplification, gel recovery, ligation transformation, bacterial liquid PCR and sequencing verification were performed using the method of vector construction in Example 1 to extract positive plasmids.

[0077] GFP-RsNRAMP5-F (SEQ ID NO: 17):

[0078] 5'-atacaccaaatcgactctagaATGACGGATCCAACCGTTTCCCGCCA-3′

[0079] GFP-RsNRAMP5-R (SEQ ID NO: 18):

[0080] 5'-gcccttgctcaccatggtaccCGTCTCCGTGGAAACAACTCTCTGTGA-3′

[0081] RNAi-NRAMP5-ZF (SEQ ID NO: 19):

[0082] 5'-caggtcgactctagaggatccTCGCTTCTGTGGCTTCTCTG-3′

[0083] RNAi-NRAMP5-ZR (SEQ ID NO: 20):

[0084] 5'-tctgtcgacctcgagggtaccTAGTTTCATTGAACATCCAAGCAAA-3′

[0085] RNAi-NRAMP5-FF (SEQ ID NO: 21):

[0086] 5'-gattttcagatcgatactagtTAGTTTCATTGAACATCCAAGCAAA-3′

[0087] RNAi-NRAMP5-FR (SEQ ID NO: 22):

[0088] 5'-cgatcggggaaattcgagctcTCGCTTCTGTGGCTTCTCTG-3′

[0089] 2. Overexpression of RsNRAMP5 gene promotes Cd absorption and reactive oxygen accumulation in radish cotyledons

[0090] To further analyze the key role of RsNRAMP5 gene in cadmium stress response, 35S::RsNRAMP5, RNAi::RsNRAMP5, pCAMBIA1300, and RNAi empty vector were transformed into Agrobacterium tumefaciens strain GV3101, which was then injected into two-week-old radish seedlings and placed in 1 / 2 Hoagland nutrient solution containing 50μM CdCl2 for 24h. Three biological replicates were set for each treatment, and 6 radish plants were set for each replicate. RT-qPCR analysis showed that RsNRAMP5 showed significant up-regulation and down-regulation in the cotyledons of RsNRAMP5-OE (P<0.001) and RsNRAMP5-RNAi, respectively (P<0.05).

[0091] After collecting radish cotyledons, the accumulation of ROS was evaluated by DAB (3,3′-diaminebenzidine) and NBT (nitro blue tetrazolium) histochemical staining methods. Furthermore, the hydrogen peroxide content assay kit (Cat: BC3595, SolarbioLife sciences, China) and the superoxide anion content assay kit (Cat: BC1290, Solarbio Lifesciences, China) were used to measure H2O2, O2· -Pro was extracted by the ninhydrin method and the absorbance value relative to the standard curve was measured at 520nm; MDA was extracted by the thiobarbituric acid method and the absorbance values ​​were measured at 450nm, 532nm and 600nm.

[0092] Compared with the control group, RsNRAMP5-OE radish cotyledons showed darker NBT and DAB staining under 50 μM CdCl2 treatment, while the NBT and DAB staining levels of RsNRAMP5-RNAi radish cotyledons were reduced. The Cd content in RsNRAMP5-OE radish cotyledons was significantly higher than that in the control group, while the Cd content in RsNRAMP5-RNAi radish cotyledons was significantly decreased. The results showed that overexpression of the RsNRAMP5 gene can enhance the Cd content in radish cotyledons. 2+ absorb.

[0093] Under 50μM CdCl2 treatment, H2O2, O2· - and MDA contents were significantly higher than those in the control group (P<0.05), but the Pro content in the cotyledons of RsNRAMP5-OE radish decreased (P<0.05). However, compared with the control, H2O2, O2· - , MDA content decreased, while Pro content increased significantly. The results showed that overexpression of RsNRAMP5 gene could enhance ROS accumulation in radish cotyledons and reduce cell membrane permeability.

Claims

1. The application of RsNRAMP5 heavy metal transporter in radish cadmium absorption and active oxygen accumulation is characterized in that the nucleotide sequence is shown in the sequence listing SEQ ID NO: 1, and the promoter sequence is shown in the sequence listing SEQ ID NO:

2.

2. A primer pair for amplifying the RsNRAMP5 gene according to cDNA claim 1, characterized in that the base sequence of the primer pair is as shown in SEQ ID NO: 3-SEQ ID NO:

4.

3. A fluorescent quantitative PCR analysis primer pair for the RsNRAMP5 gene according to claim 1, characterized in that the base sequence of the primer pair is as shown in SEQ ID NO: 7-SEQ ID NO:

8.

4. A primer pair for constructing the PYES2-RsNRAMP3, PYES2-RsNRAMP4, and PYES2-RsNRAMP5 recombinant plasmids as described in claim 1, wherein the base sequence of the primer pair is as shown in SEQ ID NO: 9 to SEQ ID NO:

14.

5. A primer pair for constructing the recombinant plasmid pRsNRAMP5-GUS according to claim 1, characterized in that the base sequences of the primer pair are shown as SEQ ID NO: 15-SEQ ID NO:

16.

6. A primer pair for constructing a recombinant plasmid for overexpression and inhibition of expression of the RsNRAMP5 gene according to claim 1, wherein the base sequence of the primer pair is as shown in SEQ ID NO: 17-SEQ ID NO:

22.

7. A method for verifying the function of the RsNRAMP5 gene according to claim 1, characterized in that PYES2-RsNRAMP3, PYES2-RsNRAMP4, PYES2-RsNRAMP5 and pYES2 empty vector are recombined into yeast competent cells BY4741 by LiAc-PEG transformation method, and the yeast cells are treated with 0μM, 25μM and 50μM CdCl2 respectively. Heterologous yeast expression analysis shows that RsNRAMP5 has the function of transporting Cd in yeast. 2+ and promote the growth of Cd in yeast 2+ absorb.

8. A method for verifying the function of the RsNRAMP5 gene according to claim 1, characterized in that the RsNRAMP5 promoter region (2000 bp) is fused with the pCAMBIA1391-GUS vector, the Agrobacterium tumefaciens GV3101 bacterial solution carrying the proRsNRAMP5-GUS vector is injected into radish cotyledons, and the radish cotyledons are treated with 50 μM CdCl2 for 12 hours. The radish cotyledons are placed in β-glucosidase (GUS) dye and stained at 37°C for 24 hours. The results show that the promoter activity of the RsNRAMP5 gene is significantly induced by Cd.

9. A method for verifying the function of the RsNRAMP5 gene according to claim 1, characterized in that 35S::RsNRAMP5, RNAi::RsNRAMP5, and pCAMBIA1300 empty recombinant plasmids are transformed into Agrobacterium tumefaciens GV3101, and the Agrobacterium is instantly injected into radish cotyledons to infiltrate the cotyledons of two-week-old radish seedlings, and 50 μM CdCl2 is used for treatment, and 1 / 2 Hoagland nutrient solution is used as a control, and the radish cotyledons are stained with DAB and NBT, and H2O2, O2· - The determination of Cd content in radish cotyledons showed that overexpression of RsNRAMP5 could enhance the 2+ Absorption and ROS accumulation.

10. Use of the RsNRAMP5 heavy metal transporter gene according to claim 1 in breeding, wherein the plant is radish.

Images