Composition for rapidly detecting dog-derived components in meat products and application of composition
By using specific primer combinations and probe compositions in meat products for real-time fluorescence detection, the problem of long time and high false positive rate detection in the prior art is solved, and rapid, sensitive and strong specificity is achieved detection effect.
Patent Information
- Application Number
- CN202411664498.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-20
- Publication Date
- 2025-01-07
AI Technical Summary
The prior art requires the detection of dog-derived ingredients in meat products to rely on expensive and complex temperature variable instruments, which is complex, time-consuming, and is prone to false positives.
Using a composition including a forward primer set, a back primer set and a probe, a 30s/cycle and 40 cycle amplification reaction is carried out through a real-time fluorescence detection system under conditions of 33°C to 43°C, using a specific Primer combinations and probe sequences (such as RAA-cytb-F2 and RAA-cytb-R1) to improve detection efficiency and specificity.
It has achieved amplification within 30 minutes, with high detection efficiency, strong sensitivity, strong specificity, simple operation, no need for expensive temperature change instruments, and is suitable for remote areas or at the grassroots level to detect, reducing the possibility of false positives.
Smart Images
Figure CN119265319A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of food technology, and in particular to a composition for rapidly detecting dog-derived components in meat products and an application thereof. Background Art
[0002] Dog meat has been known as "fragrant meat" and "white dog" since ancient times, and traditional medical records show that it has certain nourishing effects.
[0003] With the continuous development of science and technology, more and more molecular biology techniques are being applied to the detection of meat-derived ingredients, mainly including: two detection technologies based on exogenous proteins and exogenous nucleic acids. Compared with proteins, deoxyribonucleic acid (DNA) is the genetic material of most organisms and has higher stability and specificity. Therefore, DNA-based PCR detection technology is usually used as the preferred method for meat identification, including: traditional PCR, molecular beacon real-time PCR (Molecular beacon-based real-time PCR, MB-rtPCR), real-time fluorescence PCR, restriction fragment length polymorphism PCR (restriction fragment length polymorphism PCR, PCR-RFLP) and digital PCR (Digital PCR, dPCR), etc. The existing technology mainly uses PCR technology to identify the adulteration of animal-derived ingredients. However, although traditional PCR technology is low-cost and easy to operate, the detection process is complicated and time-consuming; although MB-rtPCR has high specificity and low background signal, it is complex in design and easily affected by temperature; real-time fluorescence PCR and dPCR can be used for both qualitative and quantitative detection, but they rely on variable temperature instruments and are complicated to operate, which affects their application in remote areas or grassroots detection; PCR-RFLP is simple to operate, but has high requirements for specific enzymes and is prone to false positives. Summary of the invention
[0004] In view of the above-mentioned deficiencies in the prior art, the purpose of the present application is to provide a composition for rapid detection of dog-derived components in meat products and its application, so as to solve the problems that the prior art relies on expensive and complex temperature-changing instruments, the detection process is complicated, time-consuming, and prone to false positives.
[0005] In order to solve the above technical problems, this application adopts the following technical solutions:
[0006] A composition for rapid detection of dog-derived components in meat products, the composition comprising a forward primer set, a backward primer set and a probe; the forward primer set comprises any one of the following primers:
[0007] RAA-cytb-F1: TATATGCACGCAAATGGCGCTTCCATATTC;
[0008] RAA-cytb-F2:AACTACGGCTGAATTATCCGCTATATGCAC;
[0009] RAA-cytb-F3:ACATCTGCCGAGACGTTAACTACGGCTGAA;
[0010] The backward primer set includes any one of the following primers:
[0011] RAA-cytb-R1: ATGGCAGAGAGAAGATTAGTGATTACAGTTG;
[0012] RAA-cytb-R2:ACAGTTGCTCCTCAAAATGATATTTGTCCTC;
[0013] RAA-cytb-R3: CTCTGCCATCCCTTATATCGGAACTGACTTA;
[0014] The sequence of the probe is as follows:
[0015] RAA-cytb-P:TAGGACGAGGCCTATATTACGGATCCTATG-FAMdT-THF-T-BHQ1dT-CATAGAAACATGAAAC-C3 Spacer.
[0016] Preferably, the primer set is as follows:
[0017] RAA-cytb-F2:AACTACGGCTGAATTATCCGCTATATGCAC;
[0018] RAA-cytb-R1: ATGGCAGAGAGAAGATTAGTGATTACAGTTG;
[0019] RAA-cytb-P:TAGGACGAGGCCTATATTACGGATCCTATG-FAMdT-THF-T-BHQ1dT-CATAGAAACATGAAAC-C3 Spacer.
[0020] Preferably, the composition is used for detecting dog-derived components in meat products.
[0021] The present application provides a kit for rapidly detecting dog-derived components in meat products, the kit comprising the composition according to claim 1 or 2.
[0022] Preferably, it also includes a hydration buffer, a MgAc buffer, a target DNA template and ddH2O; in the amplification system of the kit, the concentration of the forward primer is 40-280nmol / L, the concentration of the backward primer is 40-280nmol / L, and the concentration of the probe is 40-280nmol / L.
[0023] The present application provides a method for rapid detection of dog-derived ingredients in meat products, the specific steps of which are as follows:
[0024] Step 1: Obtain a sample to be tested, and extract genomic DNA from the sample for standby use;
[0025] Step 2: amplify the DNA extracted in step 1 using the kit according to claim 4; wherein the amplification reaction system comprises: in the amplification system of the kit, the concentration of the forward primer is 40-280 nmol / L, the concentration of the backward primer is 40-280 nmol / L, and the concentration of the probe is 40-280 nmol / L; hydration buffer, MgAc buffer, target DNA template; the reaction system is amplified at 33°C to 43°C for 30s / cycle and 40 cycles;
[0026] Step 3: The real-time fluorescence detection system records the change in the fluorescence signal intensity of the amplified product, obtains the fluorescence curve, determines the number of amplification cycles required to reach the set threshold within the set time, and determines whether the sample to be tested contains dog-derived components.
[0027] Preferably, the concentration of the forward primer is 200 nmol / L, the concentration of the backward primer is 160 nmol / L, and the concentration of the probe is 160 nmol / L.
[0028] Preferably, the amplification reaction temperature is 39°C.
[0029] Preferably, the sample to be tested is a meat product. The meat product mentioned in this application refers to various foods made from livestock and poultry meat as the main raw material after processing. For example, dog meat, cat meat, fox meat, mink meat, beef, mutton, pork, chicken, duck meat, horse meat, goose meat, donkey meat, camel meat, rabbit meat, red deer meat and sika deer meat and other mammalian meat products.
[0030] Compared with the prior art, this application has the following beneficial effects:
[0031] The present application constructs an Rt-RAA detection method based on the conserved sequence in the cytb gene; the present application further finds that among the primer sets, there are significant differences in the amplification time of different primer sets, and there are also differences in the amplification effects. Finally, the present application finds that the amplification starts earlier than the primer set F2R1 (RAA-cytb-F2 and RAA-cytb-R1) of other combinations. On this basis, the present application further optimizes the amplification conditions, significantly improving the detection efficiency of dog-derived components, so that the amplification can be completed within 30 minutes. The entire detection method is highly practical, highly sensitive, has high detection throughput, and has strong specificity. It is also simple to operate, does not require reliance on expensive and complex variable temperature instruments, and can well adapt to the detection needs of remote or grassroots areas, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 The results of screening different primer combinations and probe concentrations; wherein A is a graph showing the results of using the primer-probe combination F1R1 to F3R3 for amplifying dog-derived DNA, B is a fluorescence curve graph showing the amplification of dog-derived DNA using different probe concentrations, and C is a fluorescence curve graph showing the amplification of dog-derived DNA using different primer concentrations.
[0033] Figure 2 The amplification curve diagram at different reaction temperatures of the method described in the present application and the correlation between the temperature gradient and the Ct value; wherein A is the amplification reaction curve at 33°C; B is the amplification reaction curve at 35°C; C is the amplification reaction curve at 37°C; D is the amplification reaction curve at 39°C; E is the amplification reaction curve at 41°C; F is the amplification reaction curve at 43°C; and G is the correlation between the temperature gradient and the Ct value.
[0034] Figure 3 This is a diagram for validating the specificity of the detection method described in this application.
[0035] Figure 4 It is a comparison chart of the detection sensitivity of different detection methods for dog meat-derived components; wherein A is a fluorescence curve chart of the method described in this application detecting samples of dog-derived components with different mass ratios, and B is a fluorescence curve chart of the real-time fluorescence PCR method detecting samples of dog-derived components with different mass ratios.
[0036] Figure 5 Graphs showing the repeatability test results of the method described in the present application; wherein A is an amplification fluorescence curve graph of a sample with a mass ratio of 1% dog-derived components; B is an amplification fluorescence curve graph of a sample with a mass ratio of 0.5% dog-derived components; C is an amplification fluorescence curve graph of a sample with a mass ratio of 0.2% dog-derived components; and D is the average Ct value of 10 repeated experiments of samples with different mass ratios of dog-derived components. DETAILED DESCRIPTION
[0037] This application will combine the drawings in the embodiments of this application to clearly and completely describe the technical solutions in the embodiments of this application. Obviously, the described embodiments are only part of the embodiments of this application, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on this application belong to the scope of protection of this application.
[0038] Unless otherwise indicated in specific cases in this application, the numerical ranges listed herein include the upper and lower limits, as well as all integers and fractions within the range, and are not limited to the specific values listed when defining the range.
[0039] 1. A composition for rapid detection of dog-derived ingredients in meat products
[0040] The composition described in the present application includes a forward primer set, a backward primer set and a probe; the forward primer set includes any one of the following primers:
[0041] RAA-cytb-F1: TATATGCACGCAAATGGCGCTTCCATATTC;
[0042] RAA-cytb-F2:AACTACGGCTGAATTATCCGCTATATGCAC;
[0043] RAA-cytb-F3:ACATCTGCCGAGACGTTAACTACGGCTGAA;
[0044] The backward primer set includes any one of the following primers:
[0045] RAA-cytb-R1: ATGGCAGAGAGAAGATTAGTGATTACAGTTG;
[0046] RAA-cytb-R2:ACAGTTGCTCCTCAAAATGATATTTGTCCTC;
[0047] RAA-cytb-R3: CTCTGCCATCCCTTATATCGGAACTGACTTA;
[0048] The sequence of the probe is as follows:
[0049] RAA-cytb-P:TAGGACGAGGCCTATATTACGGATCCTATG-FAMdT-THF-T-BHQ1dT-CATAGAAACATGAAAC-C3 Spacer.
[0050] This application takes into account the problems existing in the detection of dog-derived components by the existing traditional PCR and its derivative detection technology, and conceives to construct a detection method for Rt-RAA to solve the problems existing in the prior art. To this end, this application is based on the conserved sequence in the cytb gene, combined with the working principle of Rr-RAA, and synthesized to obtain primer sets and probes for amplification of the target fragment. However, after further research on the primer sets and probes after combining these primers, this application found that there were differences in the amplification effects of these primer sets. Only 5 pairs of primer combinations can quickly reach the amplification plateau at a relatively low cycle threshold (cyclethreshold, Ct value), indicating that these 5 pairs of primer combinations have a very high amplification efficiency for the target DNA, can quickly identify and bind to the target DNA, so that the amplification reaction can be carried out quickly, so that a significant increase in fluorescence signals can be detected within a small number of cycles. This also means that these 5 pairs of primer combinations have good specificity and high amplification efficiency. However, other primer combinations can only reach the amplification plateau at a higher cycle threshold, indicating that the amplification efficiency of other primer combinations is low and the binding efficiency with the target DNA is not high. This further proves that even if the design is based on existing primer design principles, the resulting primer combinations may not always achieve the desired effect.
[0051] In some embodiments of the present application, the combination of forward primers, backward primers and probes in the composition includes: F1R1, F1R2, F1R3, F2R1, F2R2, F2R3, F3R1, F3R2 and F3R3. Since there is only one set of probes in the present application, the aforementioned primer combinations all use probes RAA-cytb-P. Among them, F1 refers to RAA-cytb-F1, F2 refers to RAA-cytb-F2, F3 refers to RAA-cytb-F3, R1 refers to RAA-cytb-R1, R2 refers to RAA-cytb-R2, and R3 refers to RAA-cytb-R3. All of the above primer combinations can detect dog-derived components, but there are obvious differences in detection rates. F2R1, F2R2, F1R1, F2R3 and F3R3 can quickly reach the amplification plateau at a relatively low cycle threshold. At the same time, the present application further found that the starting amplification point of F2R1 is significantly higher than all other primer combinations, which indicates that F2R1 has better primer specificity than other primer combinations. The primer combination can more accurately identify and bind to the target DNA sequence, reducing the possibility of nonspecific binding; and avoiding the formation of secondary structures or primer dimers. These factors all help the primer combination to better bind to the target DNA, thereby improving the amplification efficiency. Therefore, in the present application, the composition is further preferably RAA-cytb-F2, RAA-cytb-R1 and RAA-cytb-R3.
[0052] 2. A kit for rapid detection of dog-derived ingredients in meat products
[0053] The kit comprises the above composition.
[0054] In some embodiments of the present application, a hydration buffer, a MgAc buffer, a target DNA template and ddH2O are also included; in the amplification system of the kit, the concentration of the forward primer is 40-280nmol / L, the concentration of the backward primer is 40-280nmol / L, and the concentration of the probe is 40-280nmol / L. The reaction system also includes: 25μL hydration buffer, 2.5μL MgAc buffer solution with a concentration of 280mmol / L, and 1μL target DNA template with a concentration of 10-20ng / μL, and finally ddH2O is used to fill up to 50μL.
[0055] 3. A method for rapid detection of dog-derived ingredients in meat products
[0056] Step 1: Obtain a sample to be tested, and extract genomic DNA from the sample for standby use;
[0057] Step 2: amplify the DNA extracted in step 1 using the above kit; wherein the amplification reaction system comprises: in the amplification system of the kit, the concentration of the forward primer is 40-280 nmol / L, the concentration of the backward primer is 40-280 nmol / L, and the concentration of the probe is 40-280 nmol / L; hydration buffer, MgAc buffer, target DNA template; the reaction system is amplified at 33°C to 43°C for 30s / cycle and 40 cycles;
[0058] Step 3: The real-time fluorescence detection system records the change in the fluorescence signal intensity of the amplified product, obtains the fluorescence curve, determines the number of amplification cycles required to reach the set threshold within the set time, and determines whether the sample to be tested contains dog-derived components.
[0059] In some embodiments of the present application, the concentration of the forward primer is 40-280nmol / L, the concentration of the backward primer is 40-280nmol / L, and the concentration of the probe is 40-280nmol / L. The concentration of the forward primer refers to the concentration of a single forward primer in the amplification system, and so on. Different concentrations of primers and probes will affect the Rt-RAA signal response. Considering the lower Ct value, the concentration of the forward primer can be controlled to be 40nmol / L, 80nmol / L, 120nmol / L, 160nmol / L, 200nmol / L, 240nmol / L, 280nmol / L, etc., preferably 200nmol / L, or in the numerical range consisting of any two of the above specific values as endpoints; the concentration of the backward primer can be 40nmol / L, 80nmol / L, 120nmol / L, 160nmol / L, 200nmol / L, 240nmol / L, 280nmol / L, etc. / L, 240nmol / L, 280nmol / L, etc., preferably 200nmol / L, or a numerical range consisting of any two of the above specific values as endpoints; the concentration of the probe can be 40nmol / L, 80nmol / L, 120nmol / L, 160nmol / L, 200nmol / L, 240nmol / L, 280nmol / L, etc., preferably 160nmol / L, or a numerical range consisting of any two of the above specific values as endpoints; it should be understood that in the implementation scheme, any of the above ranges can be combined with any other ranges.
[0060] In some embodiments of the present application, the amplification reaction temperature is 33°C to 43°C, and the target sequence (such as Figure 2 AF), with the increase of amplification temperature in the range of 33℃~39℃, the Ct value of detecting dog-derived components gradually decreased ( Figure 2 G). At 41°C, a delay in the amplification start point begins ( Figure 2 E). Although the efficiency of Rt-RAA amplification reaction was improved when the reaction was carried out at 43°C, it was still higher than the Ct value of amplification at 39°C ( Figure 2 G). Therefore, the amplification reaction temperature can be 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, etc., preferably 39°C, or a numerical range consisting of any two of the above specific values as endpoints; it should be understood that, in the embodiments, any of the above ranges can be combined with any other ranges.
[0061] In some embodiments of the present application, the sample to be tested is a meat product. The meat product mentioned in the present application refers to various foods made from livestock and poultry meat as the main raw material after processing. For example, dog meat, cat meat, fox meat, mink meat, beef, mutton, pork, chicken, duck meat, horse meat, goose meat, donkey meat, camel meat, rabbit meat, red deer meat, sika deer meat and other mammalian meat products.
[0062] 4. Embodiment
[0063] 1. Materials and reagents
[0064] Live mice were purchased from Guangdong Medical Experimental Animal Center. Quality control of fresh meat of dogs, cats, foxes and minks was provided by Dongguan Yuanjia Experimental Technology Co., Ltd. Cattle, sheep, pigs, chickens, ducks, horses, geese, donkeys and camels were positive samples for meat quality testing in this laboratory. Rabbits, red deer and sika deer were purchased online and authenticated by GB / T 38164-2019 "Real-time fluorescence PCR method for detection of common livestock and poultry animal-derived ingredients", and the results all met the requirements. The nucleic acid amplification kit was provided by Zhongce (Hangzhou) Biotechnology Co., Ltd.
[0065] 2. Instruments and equipment
[0066] CFX96 Touch Fluorescence Quantitative PCR Instrument: BIO-RAD, USA;
[0067] GR85DA high pressure sterilizer: Zhiwei (Xiamen) Instrument Co., Ltd.;
[0068] ME403 1 / 1000 electronic balance: METTLER TOLEEDO, Canada;
[0069] Nanodrop ONEc ultra-micro-volume spectrophotometer: Thermo Scientific, USA.
[0070] 3. Methods
[0071] (1) Sample pretreatment
[0072] Since foxes and minks are canines like dogs, their detection is usually susceptible to interference. In order to ensure the practicability of the established Rt-RAA method in detection, fox meat and mink meat were crushed and mixed in equal proportions as the base meat used in this example. Dog meat and base meat were mixed into samples of different mass percentages to determine the detection limit of dog-derived components.
[0073] (2) Sample DNA extraction
[0074] According to the instructions of the DNA extraction kit provided by Chengdu TaKaRa, about 50 mg of fresh dog meat sample was taken and fully ground and mixed with the lysis solution. In order to improve the quality of the extracted DNA, a certain amount of protease and RNase were added to react for 2 hours, and then adsorbed and filtered through an adsorption column to obtain the target DNA. It was evaluated by an ultra-micro spectrophotometer, and the target DNA with an absorbance ratio of A260nm and A280nm of 1.7 to 1.9 was diluted to 10 ng / μL and stored at -20°C for subsequent experiments.
[0075] (3) Rt-RAA primers and probes
[0076] The relevant sequences are shown in Table 1. The designed primer and probe sequences were sent to Sangon Biotech Co., Ltd. for synthesis.
[0077] Table 1: Primer and probe sequences described in this application
[0078]
[0079] 4. Embodiment
[0080] To detect the optimal reaction conditions for Rt-RAA, experiments were conducted on different primer combinations, probe concentrations and reaction temperatures.
[0081] (1) Example 1: Screening of different primer combinations
[0082] The primers were combined as follows: F1R1, F1R2, F1R3, F2R1, F2R2, F2R3, F3R1, F3R2 and F3R3; the probes used in the above combinations were all RAA-cytb-P.
[0083] Step 1: Obtain a sample to be tested, and extract genomic DNA from the sample for standby use;
[0084] Step 2: amplify the DNA extracted in step 1 using the above kit; wherein the amplification reaction system includes: in the amplification system of the kit, the concentration of the forward primer is 200nmol / L, the concentration of the backward primer is 200nmol / L, and the concentration of the probe is 160nmol / L; hydration buffer, MgAc buffer, target DNA template; the reaction system is amplified at 39°C for 30s / cycle and 40 cycles;
[0085] Step 3: The real-time fluorescence detection system records the change in the fluorescence signal intensity of the amplified product, obtains the fluorescence curve, determines the number of amplification cycles required to reach the set threshold within the set time, and determines whether the sample to be tested contains dog-derived components.
[0086] This is used to determine the detection effect of different primer combinations.
[0087] The experimental results showed that all combinations were effectively amplified and presented a typical "S" curve. However, only 5 primer combinations quickly reached the amplification plateau at a relatively low cycle threshold (Ct value), among which the primer combination F2R1 (RAA-cytb-F2 and RAA-cytb-R1) had an earlier amplification starting point than the other combinations ( Figure 1 A), so the subsequent examples continued to conduct experiments using the primer combination F2R1 (RAA-cytb-F2 and RAA-cytb-R1) and probe.
[0088] (2) Example 2: Effect of different primer and probe concentrations on detection results
[0089] The primer combination, final primer concentration and specific steps described in Example 1 were used to explore the effects of different probe concentrations on the Rt-RAA signal response from 40 nmol / L to 280 nmol / L. Figure 1 As shown in Figure B, the fluorescence intensity and reaction efficiency gradually increase with the increase of probe concentration, up to 160 nmol / L. Therefore, a probe concentration of 160 nmol / L was selected as the ideal concentration for all subsequent examples.
[0090] The probe concentration was 160 nmol / L as the applicable range of primer concentration. The F2R1 primers were diluted to the same concentration at the same time, and the concentration range was 40 nmol / L to 280 nmol / L for amplification ( Figure 1 C), it gradually increased with the increase of primer concentration, but when the primer concentration was 240nmol / L and 280nmol / L, secondary amplification occurred, and the primer concentration of 200nmol / L was selected as the ideal concentration for subsequent experiments.
[0091] (3) Example 3: Optimization of reaction temperature
[0092] The method was adjusted based on Example 1, except that the primer combination F2R1 (RAA-cytb-F2 and RAA-cytb-R1) and the probe were used, the concentration of each primer was 200 nmol / L, and the concentration of the probe was 160 nmol / L. The experiment was carried out at 33°C, 35°C, 37°C, 39°C, 41°C, and 43°C.
[0093] The results showed that the target sequence could be effectively amplified within this temperature range ( Figure 2 AF), with the increase of amplification temperature in the range of 33℃~39℃, the Ct value of the detection dog gradually decreased ( Figure 2 G). At 41°C, a delay in the amplification start point begins ( Figure 2E). Although the efficiency of Rt-RAA amplification reaction was improved when the reaction was carried out at 43°C, it was still higher than the Ct value of amplification at 39°C ( Figure 2 G). Therefore, 39°C was used as the experimental reaction temperature to achieve the best effect of the Rt-RAA method.
[0094] (4) Example 4: Specificity test
[0095] The primer combination F2R1 (RAA-cytb-F2 and RAA-cytb-R1) and the probe were used, the concentration of each primer was 200 nmol / L, the concentration of the probe was 160 nmol / L, and the amplification was performed at 39° C. The other operation steps were consistent with those in Example 1.
[0096] Dog meat, cat meat, fox meat, mink meat, beef, mutton, pork, chicken, duck meat, horse meat, goose meat, donkey meat, camel meat, rabbit meat, red deer meat and sika deer meat are used as samples to be tested. At the same time, the extracted DNA of dog meat, cat meat, fox meat, mink meat, beef, mutton, pork, chicken, duck meat, horse meat, goose meat, donkey meat, camel meat, rabbit meat, red deer meat and sika deer meat is evaluated and determined to ensure that the quality of the extracted DNA will not cause misjudgment of the specificity verification and to perform amplification detection according to the method described in this application.
[0097] The results showed that only the dog sample DNA showed a typical "S"-shaped amplification curve, and no fluorescence changes were detected in other meats and blank controls ( Figure 3 ). This shows that the detection method described in the present application has high specificity and can distinguish the target gene from other daily meat genes, effectively avoiding the occurrence of false positives.
[0098] (5) Example 5: Detection sensitivity
[0099] The primer combination F2R1 (RAA-cytb-F2 and RAA-cytb-R1) and the probe were used, the concentration of each primer was 200 nmol / L, the concentration of the probe was 160 nmol / mL, and the amplification was performed at 39° C. The other operation steps were consistent with those in Example 1.
[0100] DNA was extracted from test samples containing dog meat at different mass ratios (calculated by mass percentage, the mass percentage of dog meat in fox meat is: 0, 0.1%, 0.2%, 0.5%, 1%, 2%, 5%, 10%, 25%, 50%, 100%), and the concentration was diluted to the same concentration (10 ng / μL) to evaluate the detection sensitivity of the method described in the present application and the traditional real-time fluorescence PCR detection method.
[0101] The results showed that as the dog meat mass ratio decreased, the detected Ct value gradually decreased ( Figure 4). Among them, the method described in the present application can detect the lowest dog meat mass ratio as low as 0.2%, and the amplified fluorescence intensity can be detected within a Ct value of 20 ( Figure 4 A). The minimum mass ratio of dog meat detected by traditional real-time fluorescence PCR is 0.5%, and the amplified fluorescence can only be captured by the instrument when the Ct value is above 30 ( Figure 4 B). This indicates that the method described in the present application has significantly better sensitivity in detecting dog-derived components than the traditional real-time fluorescence PCR detection method, and provides a more sensitive and rapid new method for detecting dog-derived components with lower mass ratios.
[0102] (6) Example 6: Stability
[0103] In order to verify the stability of the method described in this application, 10 repetitive experiments were carried out using the dog meat mass ratio of 1%, 0.5% and 0.2% in Example 5 ( Figure 5 AC).
[0104] The results showed that dog-derived components of different mass ratios could all show amplification curves in repeated experiments, but there were slight differences between repeated samples, and the test results with a mass ratio of 0.2% had the greatest difference. Figure 5 D shows that as the mass ratio decreases, the average Ct value measured gradually increases. The RSDs of 10 repetitive experiments measured at mass ratios of 1%, 0.5%, and 0.2% were 7.68%, 8.26%, and 10.90%, respectively. This shows that the detection method described in this application has acceptable stability and can be applied to actual detection scenarios.
[0105] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present application rather than to limit the technical solution. Ordinary technicians in this field should understand that those modifications or equivalent substitutions of the technical solution of the present application that do not depart from the purpose and scope of the technical solution of the present application should be included in the scope of the claims of the present application.
Claims
1. A composition for rapid detection of dog-derived components in meat products, characterized in that: The composition comprises a forward primer set, a backward primer set and a probe; the forward primer set comprises any one of the following primers: RAA-cytb-F1: TATATGCACGCAAATGGCGCTTCCATATTC; RAA-cytb-F2:AACTACGGCTGAATTATCCGCTATATGCAC; RAA-cytb-F3:ACATCTGCCGAGACGTTAACTACGGCTGAA; The backward primer set includes any one of the following primers: RAA-cytb-R1: ATGGCAGAGAGAAGATTAGTGATTACAGTTG; RAA-cytb-R2:ACAGTTGCTCCTCAAAATGATATTTGTCCTC; RAA-cytb-R3: CTCTGCCATCCCTTATATCGGAACTGACTTA; The sequence of the probe is as follows: RAA-cytb-P:TAGGACGAGGCCTATATTACGGATCCTATG-FAMdT-THF-T-BHQ1dT-CATAGAAACATGAAAC-C3 Spacer.
2. The composition according to claim 1, characterized in that The primer sets are as follows: RAA-cytb-F2:AACTACGGCTGAATTATCCGCTATATGCAC; RAA-cytb-R1: ATGGCAGAGAGAAGATTAGTGATTACAGTTG; RAA-cytb-P:TAGGACGAGGCCTATATTACGGATCCTATG-FAMdT-THF-T-BHQ1dT-CATAGAAACATGAAAC-C3 Spacer.
3. The composition according to claim 1 or 2, characterized in that The composition is used for detecting dog-derived components in meat products.
4. A kit for rapid detection of dog-derived ingredients in meat products, characterized in that: The kit comprises the composition according to claim 1 or 2.
5. The kit according to claim 4, characterized in that: It also includes a hydration buffer, a MgAc buffer, a target DNA template and ddH2O; in the amplification system of the kit, the concentration of the forward primer is 40 to 280 nmol / L, the concentration of the backward primer is 40 to 280 nmol / L, and the concentration of the probe is 40 to 280 nmol / L.
6. A method for rapid detection of dog-derived ingredients in meat products, characterized in that: The specific steps are as follows: Step 1: Obtain a sample to be tested, and extract genomic DNA from the sample for standby use; Step 2: amplify the DNA extracted in step 1 using the kit according to claim 4; wherein the amplification reaction system comprises: in the amplification system of the kit, the concentration of the forward primer is 40-280 nmol / L, the concentration of the backward primer is 40-280 nmol / L, and the concentration of the probe is 40-280 nmol / L; hydration buffer, MgAc buffer, target DNA template; the reaction system is amplified at 33°C to 43°C for 30s / cycle and 40 cycles; Step 3: The real-time fluorescence detection system records the change in the fluorescence signal intensity of the amplified product, obtains the fluorescence curve, determines the number of amplification cycles required to reach the set threshold within the set time, and determines whether the sample to be tested contains dog-derived components.
7. The method according to claim 6, characterized in that: The concentration of the forward primer is 200 nmol / L, the concentration of the backward primer is 160 nmol / L, and the concentration of the probe is 160 nmol / L.
8. The method according to claim 6, characterized in that: The amplification reaction temperature was 39°C.
9. The method according to claim 6, characterized in that: The sample to be tested is a meat product.