Visual RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) detection method and kit for liquid wax A virus

Abstract

The invention discloses a visual RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) detection method and a kit for LVA (Lipowax A virus). According to the visual RT-LAMP detection method, total RNA (Ribonucleic Acid) of clove leaves extracted in advance is used for synthesizing cDNA (Complementary Deoxyribose Nucleic Acid), an LAMP detection system is established by taking the cDNA as a template, the LVA in a plant RNA sample can be specifically detected only by using four primers, and special instruments and equipment are not needed in a reaction process, so that the detection efficiency is high, and the detection cost is low. Only one constant-temperature water bath heating kettle is needed, and the reaction result can be observed after the reaction is performed for 30 minutes. According to the detection primer group and the RT-LAMP detection technology for the hydroxavirus A of the carnation latent virus, a rapid, sensitive, specific and accurate detection method is provided for detection of the virus in plants, so that effective guidance is provided for diagnosis, prevention and control of clove plant virus diseases.

Description

Technical Field

[0001] The invention belongs to the field of plant pathology applications, and in particular relates to a method and a kit for visualizing RT-LAMP of LAVA virus (LVA) infecting lilac. Background Art

[0002] Syringa oblata Lindl is a plant of the genus Syringa Linn, Oleaceae. It is one of the unique ornamental flowers and trees in my country and has a cultivation history of more than 1,000 years. It is distributed in Jilin, Liaoning, Inner Mongolia, Hebei and other regions. In recent years, obvious mosaic symptoms have been found on lilac, suspected to be a virus disease.

[0003] The LVA virus (LVA) involved in the present invention belongs to the genus Carlavirus of the family Betaflexiviridae and is a linear RNA virus. The leaves of infected plants show symptoms of ring-shaped chlorotic spots. There are reports about this virus in Beijing, Shenyang, South Korea and other regions.

[0004] At present, plant virus detection technology mainly relies on sophisticated instruments and equipment, and problems such as high reaction cost, complex reaction conditions and long time consumption are gradually exposed. Woody plants have excellent inhibitory effects on viruses, and the virus content is often relatively low, and their symptoms are not obvious. At the same time, it is difficult to detect woody plant viruses because it is difficult to artificially inoculate woody plant viruses through friction inoculation. LAMP detection technology has the characteristics of high sensitivity, simple operation, short reaction time and low cost. It only requires 4 specific primers. Under constant temperature conditions, the test results can be observed by the naked eye, which solves the above problems very well. LAMP technology is becoming more and more important in plant virus detection methods. Summary of the invention

[0005] The purpose of the present invention is to provide a visualized RT-LAMP detection method and kit for LVA. The present invention establishes a loop-mediated isothermal amplification detection method for rapid detection of LVA, using the CP region sequence of the virus as a template, designing specific primers for amplification, and observing the detection results through the color change of the acid-base indicator in the system.

[0006] Another object of the present invention is to provide a primer set, a kit and applications thereof for rapid detection of parasite A virus by visualized RT-LAMP.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] A visualized RT-LAMP detection method for LVA virus A (LVA) is disclosed. Specific primers are designed using the CP gene region sequence of the LVA virus as the target gene for loop-mediated isothermal amplification. The detection result is directly observed by the naked eye through the color change of the acid-base indicator in the amplification product.

[0009] Furthermore, the nucleotide sequence of the CP gene of the water wax virus A is shown in Sequence 1.

[0010] Further, the specific primers include FIP-LVA, BIP-LVA, F3-LVA and B3-LVA, and the sequences are as follows:

[0011] FIP-LVA:GCGCTACGTTTCTCCACGCAATAACGTTGTCGAAACTCGGC

[0012] BIP-LVA:AATGCCTGTTTGGAAATCGGCCCAGATTCGATGGATCTCCGC

[0013] F3-LVA:AAGGCACCAACCAATGGC

[0014] B3-LVA:TCCGTAGAAGGTCGGTTGAA

[0015] Wherein, the FIP-LVA and BIP-LVA are synthesized by polymerization of F2-LVA and F1c-LVA, B2-LVA and B1c-LVA respectively:

[0016] F2-LVA:TAACGTTGTCGAAACTCGGC

[0017] F1c-LVA:GCGCTACGTTTCTCCACGCAA

[0018] B2-LVA: CAGATTCGATGGATCTCCGC

[0019] B1c-LVA: AATGCCTGTTTGGAAATCGGCC

[0020] In the second aspect, the specific primer set is a specific primer designed with the CP gene region sequence of the water wax A virus as the target gene, including FIP-LVA, BIP-LVA, F3-LVA and B3-LVA:

[0021] FIP-LVA:GCGCTACGTTTCTCCACGCAATAACGTTGTCGAAACTCGGC

[0022] BIP-LVA:AATGCCTGTTTGGAAATCGGCCCAGATTCGATGGATCTCCGC

[0023] F3-LVA:AAGGCACCAACCAATGGC

[0024] B3-LVA:TCCGTAGAAGGTCGGTTGAA

[0025] In a specific embodiment of the present invention, the 25 μL reaction system of the loop-mediated isothermal amplification is: BstⅡDNA Polymerse 1 μL, 2.5x pH Sensitive LAMP Reaction Mix 10 μL, FIP / BIP (10 μM) 4 μL, F3 / B3 (10 μM) 1 μL, RNase-free Water 1.5 μL, N-Red Stain 1.5 μL, plant cDNA or recombinant plasmid sample 1 μL.

[0026] A method for visualizing RT-LAMP detection of water wax A virus, using the above primer set to perform RT-LAMP amplification on the sample to be tested, using electrophoresis detection or direct observation with the naked eye to detect whether the sample contains the virus, and the above loop-mediated isothermal amplification product is obtained by the following steps:

[0027] 1. Select the CP gene sequence in the viral genome as a template, design primers using the online website PrimerExplorer V5, and select a set of primers with the highest comprehensive score for loop-mediated isothermal amplification;

[0028] 2. Use the Reverse Transcriptase M-MLV (RNase H-) kit (purchased from Bao Bioengineering (Dalian) Co., Ltd.) to synthesize cDNA. The reaction system (total amount 10 μL) is as follows: template RNA (1 ng-1 μg), Specific Primer 006-C12VACPR8080 (10 μM) 1 μL, dNTPs (10 mM) 0.5 μL, 5X Reverse Transcriptase M-MLV Buffer 2 μL, RNase Inhibitor (40 U / μl) 0.25 μL, Reverse Transcriptase M-MLV (RNaseH-) (200 U / μl) 0.25 μL, RNase free H2O (up to 10 μl).

[0029] 3. The reaction system (25 μL) of loop-mediated isothermal amplification is as follows: BstⅡDNA Polymerse 1 μL, 2.5x pHSensitive LAMP Reaction Mix 10 μL, FIP / BIP (10 μM) 4 μL, F3 / B3 (10 μM) 1 μL, RNase-free Water 1.5 μL, N-Red Stain 1.5 μL, plant cDNA or recombinant plasmid sample 1 μL; reaction conditions: 65°C for 30 min;

[0030] 4. Determine whether the plant RNA sample contains viruses and the product amplification status based on the color change of the N-Red Stain acid-base indicator. Yellow indicates a positive reaction and red indicates a negative reaction, thus achieving visual loop-mediated isothermal amplification of the virus;

[0031] 5. Perform gel electrophoresis on the amplified product and further observe the product amplification results through the electrophoresis diagram.

[0032] The present invention has the following advantages:

[0033] 1. The primers provided by the present invention are the best LAMP amplification primers in terms of Tm value, dG, GC content, distance between primers, secondary structure, etc. Only four specific primers are used, and whether the sample contains viruses can be detected under the reaction conditions of 65°C for 30 minutes. It has the advantages of simplicity, rapidity, sensitivity, high specificity, and visualization of detection results. The reaction process can be completed in only half an hour, and LAMP amplification is carried out under isothermal conditions, only a water bath is needed, and no complicated instruments and expensive molecular reagents are required.

[0034] 2. The present invention directly observes the test results through the change of the indicator color, that is, red is a negative reaction and yellow is a positive reaction. It can quickly diagnose whether the suspected diseased plant carries the virus. Experiments have shown that the detection sensitivity is 200 times higher than that of conventional PCR, which is more accurate for early diagnosis of the virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The electrophoretic diagram of the LAMP results of the water wax A virus under different reaction temperature conditions: M is Marker, 1 is the no-template control, 2 is 60℃, 3 is 61℃, 4 is 62℃, 5 is 63℃, 6 ​​is 64℃, 7 is 65℃, 8 is 66℃, and 9 is 67℃.

[0036] Figure 2 These are the results of LAMP visualization reaction of water wax A virus under different reaction temperature conditions: 1 is the no-template control, 2 is 60℃, 3 is 61℃, 4 is 62℃, 5 is 63℃, 6 ​​is 64℃, 7 is 65℃, 8 is 66℃, and 9 is 67℃.

[0037] Figure 3 The electrophoretic diagram of the LAMP results of water wax A virus under different reaction time conditions: M is Marker, 1 is 30min, 2 is 40min, 3 is 50min, 4 is 60min, and 5 is 70min.

[0038] Figure 4 These are the results of LAMP visualization reaction of water wax A virus under different reaction time conditions: 1 is 30 min, 2 is 40 min, 3 is 50 min, 4 is 60 min, and 5 is 70 min.

[0039] Figure 5A-5C This is a comparison chart of LAMP and PCR sensitivity and a visualization of the reaction results: Figure 5A The electrophoretic diagram of LAMP reaction under different recombinant plasmid concentrations: M is Marker, 1 is no-template control, 2 is 1 copy / μL, 3 is 10 copies / μL, 4 is 20 copies / μL, 5 is 50 copies / μL, and 6 is 100 copies / μL; Figure 5B The electrophoresis diagram of PCR reaction under different recombinant plasmid concentrations: M is Marker, 1 is no-template control, 2 is 100 copies / μL, 3 is 200 copies / μL, 4 is 500 copies / μL, and 5 is 1000 copies / μL; Figure 5C These are the results of LAMP visualization reaction at different plasmid concentrations: 1 is the no-template control, 2 is 1 copies / μL, 3 is 10 copies / μL, 4 is 20 copies / μL, 5 is 50 copies / μL, and 6 is 100 copies / μL. DETAILED DESCRIPTION

[0040] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0041] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0042] The present invention uses the gene region sequence of the coat protein of the water wax virus A as the target gene to design specific primers for loop-mediated isothermal amplification, and the reaction result can be directly observed by observing the change of the indicator color in the loop-mediated isothermal amplification product with the naked eye. The present invention uses the total RNA of lilac leaves extracted in advance to synthesize cDNA, and establishes a LAMP detection system with cDNA as a template. The water wax virus A in the plant RNA sample can be specifically detected with only 4 primers, and no special instruments and equipment are required during the reaction process. Only a constant temperature water bath heating pot is required, and the reaction result can be observed after 30 minutes of reaction.

[0043] The primer set for detecting the water wax A virus of the genus Carnation latent virus and the RT-LAMP detection technology established by the present invention provide a rapid, sensitive, specific and accurate detection method for detecting the virus in plants, thereby providing effective guidance for the diagnosis and prevention of viral diseases of lilac plants.

[0044] The present invention uses the CP gene region sequence of the water wax A virus as the target gene to design specific primers for loop-mediated isothermal amplification, and directly observes the reaction results by observing the color change of the indicator in the loop-mediated isothermal amplification product with the naked eye. The detection process is short in time, high in sensitivity, and strong in specificity. The following reagents were purchased from Beijing Quanshijin Biotechnology Co., Ltd. and Baoriyi Biotechnology (Beijing) Co., Ltd.

[0045] A method for visualizing RT-LAMP detection of LVA virus (LVA), and optimization of LAMP reaction conditions of LVA virus, the steps are as follows:

[0046] (1) Extraction of total RNA from clove leaves

[0047] Total RNA was extracted from lilac leaves using HiPure Plant RNAMini Kit (Meiji Biotechnology) and DNase On Column Kit (Meiji Biotechnology). The required reagents include: Buffer PRC1, Bufer PRC2, Buffer RW1, BufferRW2, RNase Free Water, DNase Buffer, DNase l. The specific method is described in the instructions.

[0048] (2) Design of primers for LAMP of Adenovirus

[0049] According to the CP gene sequence (nucleotide sequence see sequence 1), primers were designed using the online website PrimerExplorer V5. Multiple pairs of primers provided by the software were compared based on parameters such as Tm value, dG, GC content, distance between primers, and secondary structure, and a set of primers with the highest comprehensive score was selected. The sequence is as follows:

[0050] FIP-LVA:GCGCTACGTTTCTCCACGCAATAACGTTGTCGAAACTCGGC

[0051] BIP-LVA:AATGCCTGTTTGGAAATCGGCCCAGATTCGATGGATCTCCGC

[0052] F3-LVA:AAGGCACCAACCAATGGC

[0053] B3-LVA:TCCGTAGAAGGTCGGTTGAA

[0054] (3) cDNA synthesis

[0055] Preparation of reaction system (total volume 6 μL): template RNA (1 ng-1 μg), specific primer 006-C12VACPR8080 (10 μM) 1 μL (see sequence 6), dNTPs (10 mM) 0.5 μL (Takara), RNase-free water H2O (up to 6 μl).

[0056] After the system is prepared, keep it at 65℃ for 5 minutes, then quickly cool it on ice for more than 2 minutes. After centrifugation, continue to add: 2μL of 5X M-MLV pseudo-transcriptase buffer, 0.25μL of RNase inhibitor (40U / μl), 0.25μL of M-MLV reverse transcriptase (RNase H-) (200U / μl), and RNase-free water H2O (up to 10μl). After the configuration is completed, keep it at 42℃ for 1 hour and 70℃ for 15 minutes to obtain cDNA.

[0057] (4) Preparation of LAMP system

[0058] BstⅡDNA polymerase 1μL, 2.5xpH sensitive LAMP buffer Mix 10μL, primer FIP / BIP (10μM) 4μL, primer F3 / B3 (10μM) 1μL, RNase-free water 1.5μL, neutral red staining solution 1.5μL, plant cDNA sample or recombinant plasmid sample 1μL.

[0059] (5) Temperature gradient experiment of water wax A virus LAMP

[0060] The suitable reaction temperature of BstⅡDNA polymerase is between 60 and 65°C, and its specific reaction temperature is determined by the primer Tm value. In view of this, the present invention conducts an optimization test on the LAMP reaction temperature.

[0061] The reaction system was added in the amount of Example ⑵, and the system was kept in constant temperature for 1 hour at 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, and 67°C. The amplified product was loaded and electrophoresed on a 1% agarose gel. According to the LAMP electrophoresis diagram and the reaction visualization result diagram ( Figure 1 , Figure 2 ), under the same reaction system conditions, the wax avirus A involved in the present invention has product amplification at the above reaction temperature, and the band is clearest at 65°C, indicating that the optimal temperature of the wax avirus A LAMP detection method is 65°C.

[0062] (6) Time gradient experiment of LAMP of water wax virus

[0063] There are reports that confirm that the amplification product can be detected when the LAMP reaction time is less than 1 hour. The present invention uses the LAMP reaction system in step (2) to amplify the sample, the reaction temperature is the temperature of 65°C optimized in step (3), and the amplification reaction time is set to 30min, 40min, 50min, 60min, and 70min, respectively. According to the LAMP reaction visualization result diagram and electrophoresis diagram ( Figure 3 , Figure 4 ), when the reaction time is 30 min, there is already an amplification product, and the amount of the amplification product does not change much with the extension of the reaction time, so the reaction time of the water wax A virus LAMP is 30 min.

[0064] (7) Comparison of sensitivity of LAMP and PCR for Adenovirus

[0065] by Zero Cloning Vector (Beijing Quanshijin Biological Co., Ltd.) was used as a vector to insert the CP gene of the water wax A virus recombinant plasmid as a template, and the samples of different concentrations were amplified according to the LAMP reaction system in step ⑵. The reaction temperature was the temperature optimized in step ⑶, 65°C, and the reaction time was the time optimized in step ⑷, 30min. The concentrations of the amplified samples were 1 copies / μL, 10 copies / μL, 20 copies / μL, 50 copies / μL, and 100 copies / μL. Then, PCR amplification was performed using the recombinant plasmid of different dilution concentrations as a template, and 2 μL of LAMP amplification products and PCR amplification products were loaded and electrophoresed on 1% agarose gel.

[0066] The results are as follows Figure 5A-5C , the concentration that the LAMP method can detect is 1 copy / μL, and the concentration that PCR can detect is 200 copies / μL, that is, LAMP is 200 times more sensitive than PCR.

[0067] A visual RT-LAMP detection kit for LVA virus (LVA), comprising:

[0068] Contains the following sequence:

[0069] FIP-LVA:GCGCTACGTTTCTCCACGCAATAACGTTGTCGAAACTCGGC

[0070] BIP-LVA:AATGCCTGTTTGGAAATCGGCCCAGATTCGATGGATCTCCGC

[0071] F3-LVA:AAGGCACCAACCAATGGC

[0072] B3-LVA:TCCGTAGAAGGTCGGTTGAA

[0073] The system also includes:

[0074] Template RNA (1 ng-1 μg), specific primer 006-C12 VACPR8080 (10 μM) 1 μL, dNTPs (10 mM) 0.5 μL, RNase free H2O (to 6 μl).

[0075] 5X Reverse transcriptase, M-MLVBuffer 2μL, RNase inhibitor (40U / μl) 0.25μL, Reverse transcriptase M-MLV (RNase H-) (200U / μl) 0.25μL, RNase free H2O (up to 10μl).

[0076] BstⅡDNA Polymerse 1μL, 2.5xpH Sensitive LAMP Reaction Mix10μL, FIP / BIP (10μM) 4μL, F3 / B3 (10μM) 1μL, RNase-free Water 1.5μL, N-Red Stain1.5μL, plant cDNA or recombinant plasmid sample 1μL.

[0077] The CP gene region sequence of the water wax A virus CP-LVA is as shown in SEQ ID NO.1:

[0078] ATGTCGAATCCACCGGAAGGAGGAAAACCAGCACCCCAGCCAGCTCCAGC

[0079] TGCGAATCCACAAGGCAATCAACCGCACCTGAGGCAGAGACCACCACCTG

[0080] CTGAACGCACGGGGCCAGAAGCTGTCATTGAGGGTCGCCTAATGAGCTTA

[0081] AAAGAAGCATTACGTAGCGAACGTAGTGCAATTGAGGTAACCAATGCTTGT

[0082] CTAGAAACTGGAAGGCCGAATTTGCAGCCAACGCCTGACATGCGTGGCGA

[0083] TCCCACCAATTTATATAACAGGCCATCGACTGACATCCTTTGGGGCATCAAG

[0084] CCAAAAATGATTTCTAACAACATGGCGACTGCTGAGGAAATGATGCGGATT

[0085] GCAGTCAAGCTGGAAGGTCTGGGCGTGCCCACTGAACAAGTTACCAATGT

[0086] TATTATCCAATTTGTGTGCTACTGTGCAAGTGCAAGCAGTTCCTCTTATCAG

[0087] GATCCGCGCGGCACTTTTGAGTTCACTGGGGGTGCCATCATGGCTGATGAC

[0088] GTGTTGGGTACTATCAAAGAACTTGCAGGCGTGAGAAGGGTGTGCCGTCTT

[0089] TATGCACCAATTGCTTGGAACTATATGCACCTGCACAATAAGCCACCTTCTG

[0090] ATTGGGCCGCTATGGGTTTCAACTACAACACGAGATATGCTGCATTTGACTT

[0091] TTTCGATTATGTCGAGAATGAGGCAGCTGTGAAACCAAATGGGGGAATTGT

[0092] GCCTAGGCCTACTAGGGCTGAGTACGTTGCATTCAATACCTACCAACGCCTT

[0093] GCTCTCGATAAGGCTAACAACAATGATACGTACGGCAATTTCAATGCAGCA

[0094] ATAACCGGTGGTCGCATGGGTCCTGAAATTGAACGAAACTTCAACAATGCGAATAACAAGAAGCAGTGA.

[0095] The FIP-LVA sequence is SEQ ID NO.2:

[0096] GCGCTACGTTCTCCACGCAATAACGTTGTCGAAACTCGGC

[0097] The sequence of BIP-LVA is SEQ ID NO.3:

[0098] AATGCCTGTTTGGAAATCGGCCCAGATTCGATGGAT CTCCGC

[0099] The sequence of F3-LVA is SEQ ID NO. 4: AAGGCACCAACCAATGGC

[0100] The sequence of B3-LVA is SEQ ID NO.5: TCCGTAGAAGGTCGGTTGAA.

[0101] The specific Primer006-C12VACPR8080 sequence is SEQ ID NO.6:

[0102] 5'-CGTTCAATTTCAGGACCCATGCGACC-3'.

Claims

1. A method for detecting water wax A virus by visual RT-LAMP, characterized in that: Specific primers were designed with the CP gene region sequence of the wax aphid A virus as the target gene, and loop-mediated isothermal amplification was performed. The detection result was directly observed with the naked eye through the color change of the acid-base indicator in the amplification product. The CP gene region sequence CP-LVA of the wax aphid A virus is SEQ ID NO.

1.

2. The detection method of the water wax A virus visualization RT-LAMP according to claim 1 is characterized in that: The specific primers include a pair of inner primers FIP-LVA and BIP-LVA and a pair of outer primers F3-LVA and B3-LVA, and the sequences are as follows: The FIP-LVA sequence is SEQ ID NO.2; the BIP-LVA sequence is SEQ ID NO.3; The F3-LVA sequence is SEQ ID NO.4; the B3-LVA sequence is SEQ ID NO.

5.

3. The detection method of the water wax A virus visualization RT-LAMP according to claim 1 is characterized in that: The cDNA reaction system in the loop-mediated isothermal amplification system: template RNA (1ng-1μg), specific primer 006-C12VACPR8080 (10μM) 1μL, dNTPs (10mM) 0.5μL, RNase-free water H2O; 5X M-MLV pseudo-transcriptase buffer, 40U / μl RNase inhibitor, 200U / μl M-MLV reverse transcriptase, RNase-free water H2O.

4. The detection method of the water wax A virus visualized RT-LAMP according to claim 3: the primer sequence of the specific primer 006-C12VACPR8080 is SEQ ID NO.

6.

5. The detection method of the water wax A virus visualization RT-LAMP according to claim 2 is characterized in that: Loop-mediated isothermal amplification system: BstⅡ DNA polymerase 1μL, 2.5x pH sensitive LAMP buffer Mix 10μL, 10μM primer FIP-LVA, 10μM primer BIP-LVA, 10μM primer F3-LVA, 10μM primer B3-LVA, 1.5μL RNase-free water, 1.5μL neutral red staining solution, cDNA sample or recombinant plasmid sample.

6. The detection method of the water wax A virus visualized RT-LAMP according to claim 2 is characterized in that: The loop-mediated isothermal amplification conditions are 65° C. and 30 min.

7. The method for detecting the Adenovirus A visualized RT-LAMP according to any one of claims 1 to 7, characterized in that: The steps are as follows ⑴ Synthesize cDNA samples, the reaction system is as follows: reaction system: template RNA (1ng-1μg), specific primer 006-C12VACPR8080 (10μM) 1μL, dNTPs (10mM) 0.5μL, RNase-free water H2O; 5X M-MLV pseudo-transcriptase buffer, 40U / μl RNase inhibitor, 200U / μl M-MLV reverse transcriptase, RNase-free water H2O. After the configuration is completed, keep it at 42℃ for 1 hour and keep it at 70℃ for 15 minutes to obtain the cDNA sample; (2) Loop-mediated isothermal amplification reaction, 25 μL reaction system is as follows: BstⅡDNA polymerase 1 μL, 2.5xpH sensitive LAMP buffer Mix 10 μL, 10 μM primer FIP-LVA, 10 μM primer BIP-LVA, 10 μM primer F3-LVA, 10 μM primer B3-LVA, 1.5 μL RNase-free water, 1.5 μL neutral red staining solution, cDNA or recombinant plasmid sample; reaction conditions: 65°C, reaction time 30 min; ⑶ According to the color change of N-Red Stain acid-base indicator, judge whether the plant RNA sample contains viruses and the product amplification situation. Yellow is a positive reaction and red is a negative reaction, which can be used to identify whether it contains Adenovirus A.

8. A detection kit for Adenovirus Visualization RT-LAMP, characterized in that: Including specific primers and reaction system: The specific primers include a pair of inner primers FIP-LVA and BIP-LVA and a pair of outer primers F3-LVA and B3-LVA, and the sequences are as follows: The FIP-LVA sequence is SEQ ID NO.2; the BIP-LVA sequence is SEQ ID NO.3; The F3-LVA sequence is SEQ ID NO.4; the B3-LVA sequence is SEQ ID NO.5; The system also includes: 10μM specific primer 006-C12 VACPR8080 such as SEQ ID NO.6, 10mM dNTPs, RNase free H2O; 5XReverse transcriptase, M-MLV Buffer 2μL, 40U / μl RNase inhibitor, 200U / μl Reverse transcriptase M-MLV, RNase free H2O; 1 μL of BstⅡ DNA polymerase, 10 μL of 2.5x pH sensitive LAMP buffer Mix, 10 μM primer FIP-LVA, 10 μM primer BIP-LVA, 10 μM primer F3-LVA, 10 μM primer B3-LVA, 1.5 μL of RNase-free water, and 1.5 μL of neutral red staining solution.

Images