Nucleic acid aptamer for detecting burkholderia gladioli and preparation method of detection reagent

Abstract

The invention discloses a burkholderia gladioli aptamer and a screening method thereof, and belongs to the technical field of food safety. The DNA (deoxyribonucleic acid) sequence of the burkholderia gladioli aptamer is as shown in SEQ ID No: 1. According to the screening method, computer-aided design is utilized, aptamer candidate sequences highly specifically bound with bacterial membrane protein are rapidly screened from a large-scale nucleic acid sequence library through a molecular docking technology, and the aptamer with excellent affinity and specificity is finally obtained through in-vitro experimental verification and optimization. The method overcomes the defects that a traditional aptamer screening method is long in time consumption, high in cost, complex in operation and the like, and a new way is provided for rapidly and efficiently screening the burkholderia gladioli specific recognition aptamer. The obtained aptamer is combined with fluorescent nano-enzyme for the first time, forms a double-probe structure with concanavalin A (ConA)-loaded magnetic beads, can be used for constructing a burkholderia gladioli rapid detection system, and has a wide application prospect in the fields of food safety monitoring, pathogenic bacterium detection and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular docking, and particularly relates to a preparation method of a nucleic acid aptamer and a detection reagent for detecting gladiolus Burkholderia. Background Art

[0002] Burkholderia gladioli is a Gram-negative bacillus that mainly exists as a plant pathogen and can also cause conditional disease in humans. Under suitable conditions, the bacterium will produce a toxin called fumonisin, which is extremely heat-resistant and cannot be destroyed by boiling or high-pressure cooking. Therefore, once contaminated in food, it may cause serious food poisoning after consumption.

[0003] To date, the most commonly used method for detecting gladiolus Burkholderia is GB4789.29–2020, which is a conventional microbial culture method that requires at least one week to detect gladiolus Burkholderia. In addition, many techniques have been proposed to identify gladiolus Burkholderia, such as polymerase chain reaction (PCR), RPA-CRISPR / Cas12a assay, and loop-mediated isothermal amplification (LAMP), which show more advantages than traditional methods, with rapidity, high sensitivity, and specificity. However, the application of these techniques is limited to laboratory environments, involving multiple pairs of primers, and false positive results caused by residual contamination may sometimes confuse people, and the results have poor reproducibility, making them unsuitable for on-site food safety monitoring. In order to quickly detect gladiolus Burkholderia contamination, it is very necessary to develop specific recognition molecules for this bacterium. Aptamers are oligonucleotide fragments that can bind to specific targets with high affinity and specificity. Compared with traditional antibodies, aptamers have high affinity and specificity, good chemical stability, simple synthesis and easy modification. At present, there are no specific aptamers for this bacterium. Common aptamer screening methods mainly include Cell-SELEX technology, electrophoretic migration method and in vitro evolution technology, but these methods usually require a lot of experimental verification and optimization. Therefore, the development of a simple and efficient aptamer screening method is of great significance for the rapid detection of gladiolus Burkholderia. Summary of the invention

[0004] Aiming at the problem that the existing detection technology of gladiolus Burkholderia in food lacks effective recognition elements, the present invention provides a nucleic acid aptamer for gladiolus Burkholderia detection and a method for preparing a detection reagent for gladiolus Burkholderia detection.

[0005] The DNA sequence of a nucleic acid aptamer for detecting Burkholderia gladiolus is shown in SEQ ID No: 1.

[0006] A method for preparing a detection reagent for detecting gladiolus Burkholderia based on a nucleic acid aptamer with a DNA sequence such as SEQ ID No. 1, the operation steps comprising: (1) preparing an activation mixture, (2) preparing a magnetic separation probe, (3) preparing a fluorescent nanozyme probe, wherein the fluorescent nanozyme probe is a yellow fluorescent nanozyme probe obtained by amidation covalent coupling of an amino-containing yellow fluorescent nanozyme (Pt-OCDs) and a nucleic acid aptamer with a carboxyl-containing DNA sequence such as SEQ ID NO. 1; (4) preparing a detection reagent;

[0007] The detection reagent is a dual-probe detection reagent combining a magnetic separation probe and a fluorescent nanozyme probe; the magnetic separation probe is a combination of carboxylated magnetic beads and amino-rich concanavalin A (ConA), and the fluorescent nanozyme probe is a nucleic acid aptamer combined with a modified carboxyl group; the specific preparation operation is as follows:

[0008] In step (1), 10 mM 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide are mixed at a volume ratio of 1:1, and vortexed in a vortex machine to obtain an activated mixed solution, which is stored in a refrigerator at 4°C for later use.

[0009] In step (2), 500 μl of 5 mg / mL carboxyl magnetic beads and 200 μl of the activated mixed solution are vortex-mixed, incubated on a shaker at a speed of 200 rpm and room temperature for 30 min, the supernatant is removed by magnetic separation, washed twice with a phosphate buffer (1×PBS) with a pH value of 7.4, and resuspended to 800 μl; 200 ul of 1 mg / mL concanavalin A (ConA) is added, and the mixture is incubated in a blood mixer at a temperature of 4°C, protected from light, and at a low speed of 20 rpm for 5-6 h, and the supernatant is removed by magnetic separation; 50 μl of 5% bovine serum albumin (BSA) is added, and the mixture is incubated in a blood mixer at a temperature of 4°C, protected from light, and at a low speed of 20 rpm for 2-3 h, and washed three times with a phosphate buffer (1×PBS) with a pH value of 7.4 to obtain a magnetic separation probe.

[0010] In step (3), 20 μL of 100 mM nucleic acid aptamer represented by DNA sequence SEQ ID NO.1 was vortexed and mixed with 80 μL activation mixture, and incubated on a shaker at 200 rpm and room temperature for 30 min; 400 μL of 100 ug / mL yellow fluorescent nanozyme was added and vortexed, and incubated on a shaker at 180 rpm and 37°C for 2.5 h to obtain a yellow fluorescent nanozyme probe.

[0011] In step (4), 100 μL of magnetic separation probe, 50 μL of yellow fluorescent nanozyme probe and 250 μL of phosphate buffer solution (1×PBS) with a pH value of 7.4 are mixed evenly at room temperature to prepare a detection reagent for the detection of Burkholderia gladiolus.

[0012] The beneficial technical effects of the present invention are embodied in the following aspects:

[0013] 1. Compared with the traditional detection method, the nucleic acid aptamer of the present invention can complete sample analysis in a shorter time, greatly improve the detection efficiency, and is suitable for rapid response to the needs of food safety monitoring. It has been determined that the binding rate of gladiolus Burkholderia flow cells is 80.3%, and the result of the affinity constant determination is 19.24nM. At the same time, the binding rates of gladiolus Burkholderia flow cells with Staphylococcus aureus ATCC 29213, Listeria monocytogenes ATCC 43251, Escherichia coli ATCC 25922, Salmonella ATCC 14028 and Pseudomonas aeruginosa ATCC 15442 are 9.2%, 7.8%, 26.3%, 22.7%, and 20.5%, respectively. Therefore, the effect of the nucleic acid aptamer obtained is feasible and meets the use requirements. In addition, when gladiolus Burkholderia is at a low concentration, the affinity constant is low, thereby bringing a more stable binding state. In addition, the aptamer screening process greatly reduces the reliance on complex instruments, allowing operators to conduct experiments more easily, improving laboratory work efficiency and reducing testing costs.

[0014] 2. The correlation coefficient of the linear fit of the detection reagent based on the nucleic acid aptamer of the present invention is as high as 0.9819, with a detection limit as low as 7.37CFU / mL, the detection time is controlled within 1h, and has good specificity. In addition, the present invention adopts the detection of the dual-modal signal of colorimetric signal-fluorescence signal, and substitutes the obtained ultraviolet absorption intensity value-fluorescence intensity value into the obtained linear regression equation respectively, and the dual-modal signals verify each other, play an internal proofreading role, and improve the accuracy of the detection result; the linear regression equation established by the present invention under the standard environment can be directly applied to the detection of the soaked Tremella sample, without the need to re-cultivate bacteria to establish a standard curve, and only the established linear regression equation needs to be directly applied, which saves time and is suitable for rapid estimation of the preliminary concentration of gladiolus Burkholderia in food samples under emergency conditions. For example, the test results show that, after calculation, in the environment of artificial inoculation of gladiolus Burkholderia in the soaked Tremella, the concentrations of gladiolus Burkholderia measured by colorimetry and fluorescence dual channels are 0.93×10 5 CFU / mL, 1.10×10 5 CFU / mL, almost the same as its actual concentration 10 5The CFU / mL are close, which shows that even if the corresponding standard curve and linear regression equation are not established in the environment of soaked Tremella samples, the standard curve and linear regression equation established in PBS buffer solution can still have good versatility and can be quickly applied to different sample detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 is a secondary structure diagram of the gladiolus Burkholderia aptamer of the present invention;

[0016] Figure 2 A three-dimensional structural diagram of the membrane protein matched by molecular docking of the gladiolus Burkholderia aptamer in the present invention;

[0017] Figure 3 is a potential diagram of the magnetic separation probe prepared in the present invention;

[0018] Figure 4 X-ray photoelectron spectrum of the fluorescent nanozyme-loaded aptamer prepared in the present invention; (A. Full spectrum of fluorescent nanozyme-loaded aptamer, B. X-ray photoelectron spectrum of Pt element, X-ray photoelectron spectrum of CC element, X-ray photoelectron spectrum of DN element, X-ray photoelectron spectrum of EO element, X-ray photoelectron spectrum of FP element).

[0019] Figure 5 The ultraviolet absorption graph of different concentrations of Burkholderia gladiolus in the present invention and the corresponding standard curve graph;

[0020] Figure 6 The fluorescence spectra of different concentrations of Burkholderia gladiolus in the present invention and the corresponding standard curve diagram;

[0021] Figure 7 This is a specific detection diagram of Burkholderia gladiolus in the present invention. DETAILED DESCRIPTION

[0022] The present invention is described in detail below in conjunction with specific embodiments.

[0023] Unless otherwise defined, technical and scientific terms used in the following examples have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0024] The raw materials used in the following examples are all conventional biochemical reagents unless otherwise specified; the experimental methods are all conventional methods unless otherwise specified; the quantitative tests in the following examples are all repeated three times, and the results are averaged; the % in the following examples are all mass percentages unless otherwise specified.

[0025] In the following examples, the synthesized aptamers were purchased from Shanghai Biotechnology Co., Ltd.; unless otherwise specified, other raw materials used were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0026] It should be noted that the phosphate buffer used in this application is a sterile PBS buffer with a pH value of 7.4 and a 0.1 M buffer.

[0027] It should be noted that all strain numbers used in this application are consistent with those of the American Type Culture Collection ； Among them, the number of Burkholderia gladiolus is ATCC 33664, the number of Staphylococcus aureus is ATCC 29213, the number of Listeria monocytogenes is ATCC 43251, the number of Escherichia coli is ATCC 25922, the number of Salmonella is ATCC 14028, and the number of Pseudomonas aeruginosa is ATCC 15442.

[0028] It should be noted that the instruments, equipment, raw materials, reagents or steps used in this application are ensured to be handled under sterile conditions.

[0029] It should be noted that the instruments, equipment, raw materials, reagents or method steps not mentioned in this application are conventional or well-known technical methods for those skilled in the art and will not be described in detail in this application.

[0030] Example 1

[0031] The DNA sequence of the nucleic acid aptamer used for detecting Burkholderia gladiolus is shown in SEQ ID No:1.

[0032] The characterization information of the nucleic acid aptamer is as follows:

[0033] like Figure 1 As shown, its secondary structure is shown in the RNAStructure analysis diagram.

[0034] The binding test refers to the "aptamer binding test" and "affinity constant determination" involved in "Screening and identification of aptamers for Vibrio parahaemolyticus based on whole-bacteria SELEX technology_Lou Xiuqin", and the same test is performed by replacing this bacterium. The flow cell binding rate is 80.3%, and the result of the affinity constant determination is 19.24nM. At the same time, the flow cell binding rates of Staphylococcus aureus ATCC29213, Listeria monocytogenes ATCC 43251, Escherichia coli ATCC 25922, Salmonella ATCC 14028 and Pseudomonas aeruginosa ATCC 15442 are 9.2%, 7.8%, 26.3%, 22.7%, and 20.5%, respectively. Therefore, the effect of the nucleic acid aptamer we obtained is feasible and meets the use requirements. In addition, when the gladiolus Burkholderia is at a low concentration, the affinity constant is low, resulting in a more stable binding state.

[0035] The screening method of nucleic acid aptamers for the detection of Burkholderia gladiolus is as follows:

[0036] (1) Construction of a membrane protein model of Burkholderia gladiolus

[0037] Obtain the three-dimensional model structure of the membrane protein DedA protein of Burkholderia gladiolus (such as Figure 2 As shown in the figure, the data is saved in .pdb format, and then converted using the Open Babel tool to obtain a membrane protein file in .pdbqt format, which contains the three-dimensional structure information of the protein and ligand, as well as the information of partial charge and atomic type, so as to facilitate the calculation of molecular interactions. The command executed by the Open Babel tool is as follows: "obabel input.pdb-O output.pdbqt".

[0038] (2) Construction of a nucleic acid aptamer library for Burkholderia gladiolus

[0039] Use Matlab language to design a random 14 A library of short-chain oligo DNA fragments, wherein the length of the short-chain oligo DNA fragments ranges from 30 bp to 80 bp. The corresponding implementation code is as follows:

[0040]

[0041] Next, the secondary structure of the aptamers in the short-chain oligo DNA fragment library was predicted using RNAstructure. The results are as follows: Figure 1 As shown, the sequence of the nucleic acid aptamer of SEQ ID NO. 1 is taken as an example. Then RNAComposer is used to process the tertiary structure and output the nucleic acid aptamer file in .pdbqt format.

[0042] (3) High-throughput virtual simulation docking

[0043] Import the membrane protein file and nucleic acid aptamer file in .pdbqt format into Discovery Studio software respectively, and then perform the following operations:

[0044] Preparing receptor and ligand files

[0045] Use "File"-"Import Molecule" to import the membrane protein receptor file and nucleic acid aptamer ligand file.

[0046] In the "Dock Ligands" module, select membrane protein as receptor and aptamer as ligand.

[0047] Defining docking sites

[0048] Select the “Define and Edit Binding Site” tool to define the docking site.

[0049] A spherical region centered on the ligand can be selected, and the docking range can be controlled by adjusting the radius of the sphere.

[0050] Alternatively, key residues can be manually specified to select specific amino acid residues on the receptor as docking sites.

[0051] Set the connection parameters

[0052] In the "Dock Ligands" module, select an appropriate docking algorithm, such as CDOCKER.

[0053] Set the number of docking conformations (Poses) generated. The default value is 10, which can be increased as needed.

[0054] Select scoring functions. Commonly used ones include LibDockScore, PLP, PMF, etc.

[0055] Other parameters such as conformational sampling method and accuracy can be used at default settings or optimized.

[0056] Perform molecular docking calculations

[0057] Click the “Run” button to start the docking calculation.

[0058] The software will automatically search for the optimal binding mode of the ligand in the receptor binding site and give a scoring ranking.

[0059] After the calculation is completed, the docking results can be viewed in the "Results Viewer", as shown in Table 1, which shows the docking score values ​​of the first 20 successfully docked nucleic acid aptamer sequences, taking the LibDockScore function as an example.

[0060] Table 1 Docking results

[0061]

[0062]

[0063]

[0064] (4) Analysis of virtual simulation docking results

[0065] For the docking results obtained in step 2.2.3, the improved particle swarm algorithm model is combined to optimize the above docking results, where the algorithm formula of the model is as follows:

[0066]

[0067]

[0068] In the formula, represents the j-dimensional component of the velocity of particle i in generation t+1, represents the velocity of the j-dimensional component of particle i in generation t, c1 represents random acceleration, r1 represents a random number in the range of 0-1, represents the optimal weight value of the binding free energy of a single particle i, represents the composition of particle i at position t+1 of the j-dimensional space, c2 represents random acceleration, r2 represents a random number in the range of 0-1, and Gbest represents the optimal weight value of the global particle binding free energy. Represents the composition of particle i at position t+1 of the j-dimensional space. The corresponding implementation code of the improved particle swarm algorithm model is as follows:

[0069]

[0070]

[0071]

[0072] Table 2 Example of optimization results

[0073]

[0074] According to the results of the optimization process, as shown in Table 2, by comparing The short-chain oligo DNA fragment corresponding to the best particle i determined by Gbest is used to obtain the matching nucleic acid aptamer of gladiolus Burkholderia. Taking the nucleic acid aptamer sequence of SEQ ID NO.1 as an example, by comparing the Pbest and Gbest values, we can see that the Pbest value (-9.2) of SEQ ID NO.1 is equal to the Gbest value (-9.2), which indicates that the short-chain oligo DNA fragment sequence "CAAGAAGTCAGCACTTGGCGTGCCATGCCTGTGGATTTTTCCCTGCATCAAATTT AGTTAACCAGTTA" corresponding to SEQ ID NO.1 is likely to be the best nucleic acid aptamer. This sequence will be considered as the best matching nucleic acid aptamer of gladiolus Burkholderia because it shows the strongest binding ability in the simulation.

[0075] Example 2

[0076] The preparation steps of the dual probe detection reagent for the detection of Burkholderia gladiolus are as follows:

[0077] (1) Preparation of activation mixture

[0078] 10 mM 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide were mixed in a volume ratio of 1:1, and vortexed in a vortex machine to obtain an activated mixed solution, which was stored in a refrigerator at 4°C for later use.

[0079] (2) Preparation of magnetic separation probe

[0080] 500 μl of 5 mg / mL carboxyl magnetic beads were vortexed with 200 μL of activation mixture, incubated on a shaker at 200 rpm and room temperature for 30 min, the supernatant was removed by magnetic separation, washed twice with phosphate buffer (1×PBS) at pH 7.4, resuspended to 800 μL, 200 ul of 1 mg / mL concanavalin A (Con A) was added, incubated in a blood mixer at 4°C, protected from light, and at a low speed of 20 rpm for 5 h, and the supernatant was removed by magnetic separation. 50 μL of 5% bovine serum albumin (BSA) was added, incubated in a blood mixer at 4°C, protected from light, and at a low speed of 20 rpm for 3 h, and washed 3 times with phosphate buffer (1×PBS) at pH 7.4 to obtain a magnetic separation probe.

[0081] The magnetic bead potential of the magnetic separation probe prepared in Example 2 is as follows Figure 3 As shown, when the zeta potential of the magnetic beads increased from -21.37 mV to -6.19 mV, it indicated that concanavalin A (ConA) in the magnetic separation probe was successfully modified onto the magnetic beads.

[0082] (3) Preparation of fluorescent nanozyme probes

[0083] The yellow fluorescent nanozyme probe is obtained by amidation covalently coupling the amino-containing yellow fluorescent nanozyme with the carboxyl-containing gladiolus Burkholderia aptamer SEQ ID NO.1, and the specific operation is as follows:

[0084] 20 μL of 100 mM nucleic acid aptamer shown in DNA sequence SEQ ID NO.1 was vortexed and mixed with 80 μL activation mixture, and incubated on a shaker at 200 rpm and room temperature for 30 min; then 400 μL of 100 ug / mL yellow fluorescent nanozyme was added and vortexed, and incubated on a shaker at 180 rpm and 37°C for 2.5 h to obtain a yellow fluorescent nanozyme probe.

[0085] The X-ray photoelectron spectrum of the yellow fluorescent nanozyme probe prepared in Example 2 is as follows: Figure 4 As shown, the main elements of the yellow fluorescent nanozyme probe loaded with the nucleic acid aptamer shown in the DNA sequence SEQ ID NO.1 are Pt, C, N, O, and P, and an amide bond is formed, indicating that the nucleic acid aptamer and the yellow fluorescent nanozyme are successfully amidated and covalently coupled.

[0086] (4) Preparation of detection reagents

[0087] 100 μL of magnetic separation probe, 50 μL of yellow fluorescent nanozyme probe and 250 μL of phosphate buffer (1×PBS) with a pH value of 7.4 were mixed evenly at room temperature to prepare a detection reagent for the detection of Burkholderia gladiolus.

[0088] Example 3

[0089] Construction of linear regression equation for colorimetric-fluorescence dual-modal signal detection of Burkholderia gladiolus

[0090] The prepared dual-probe detection reagent was used to establish a linear regression equation for detecting Burkholderia gladiolus. The operation steps are as follows:

[0091] (1) Pretreatment

[0092] First, a test solution of a non-bacterial test sample was prepared, and the test solution was artificially contaminated with Burkholderia gladiolus, and a linear gradient dilution of the bacterial solution was set; the concentrations of 10 0 CFU / mL, 10 1 CFU / mL, 10 2 CFU / mL, 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 106 CFU / mL, 10 7 CFU / mL, 10 8 CFU / mL, 10 9 The CFU / mL bacteria-containing solution is ready for use.

[0093] (2) Detection of colorimetric signals

[0094] 50 μL of the supernatant obtained after magnetic separation was taken, and 420 μL of acetic acid-sodium acetate buffer was added, wherein the acetic acid-sodium acetate buffer was as follows: acetic acid-sodium acetate buffer with a pH value of 4.5 was purchased from Shanghai Yuanye Biotechnology Co., Ltd., and its product number was R27435-500ml, and 3,3',5,5'-tetramethylbenzidine with a concentration of 1 mM and a hydrogen peroxide solution with a concentration of 0.2 mM were added, and the mixture was reacted at 35°C for 15 min to obtain a colorimetric signal detection solution, and an ultraviolet spectrophotometer was used to detect the ultraviolet absorption intensity value generated at 653 nm, the read ultraviolet absorption intensity value was selected as the ordinate, and the logarithmic value of the bacterial concentration of the test solution was used as the abscissa, a standard curve was drawn, and the correlation coefficient and the detection limit were obtained according to the linear regression equation; Figure 5 As shown, see Figure 5 A in the figure, from top to bottom, are: Curve 1 to Curve 10, which represent the bacterial concentration of 10 0 CFU / mL-10 9 CFU / mL UV absorption curve; at the same time, combined with Figure 5 From the perspective of B in the above Figure 5 The ultraviolet absorption intensity value of 653 on each ultraviolet absorption curve in A is taken as the ordinate, and the logarithm of the bacterial concentration corresponding to each ultraviolet absorption curve is taken as the abscissa. It is found that when the bacterial concentration is 10 1 CFU / mL-10 8 CFU / mL shows a certain linearity, so see Figure 5 C, its linear regression equation is y = -0.09533x + 1.04309, its detection limit is 7.37 CFU / mL, and its R 2 The value is 0.9802.

[0095] (3) Detection of fluorescence signals

[0096] The supernatant obtained by magnetic separation was used to obtain a fluorescent signal detection solution. The fluorescence intensity value generated at an excitation wavelength of 440 nm was detected using a fluorescence spectrophotometer. The read fluorescence intensity value was selected as the ordinate, and the logarithm of the bacterial concentration of the detected solution was used as the abscissa to draw a standard curve. The correlation coefficient and the detection limit were obtained according to the linear regression equation; Figure 6 As shown, see Figure 6A in the figure, from top to bottom, are: Curve 1 to Curve 10, which represent the bacterial concentration of 10 0 CFU / mL-10 9 CFU / mL fluorescence spectrum curve; at the same time, combined with Figure 6 From the perspective of B in the above Figure 6 The fluorescence intensity value at 541 nm on each fluorescence spectrum curve in A is taken as the ordinate, and the logarithm of the bacterial concentration corresponding to each fluorescence spectrum curve is taken as the abscissa. It is found that when the bacterial concentration is 10 1 CFU / mL-10 8 CFU / mL shows a certain linearity, so see Figure 6 The linear regression equation of C in is y=-0.09354x+1.06421, and its detection limit is 9.16 CFU / mL. 2 The value is 0.9819.

[0097] Example 4

[0098] Basically the same as Example 3, except that:

[0099] The Burkholderia gladiolus was replaced with Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Salmonella and Pseudomonas aeruginosa, respectively.

[0100] See also Figure 7 A and Figure 7 In B, the ultraviolet absorption intensity and fluorescence intensity of the test solution after adding the Burkholderia gladioli numbered "1" in the figure are 0.1943 and 0.2606 respectively, the ultraviolet absorption intensity and fluorescence intensity of the test solution after adding the Staphylococcus aureus numbered "2" in the figure are 1.0033 and 0.9281 respectively, the ultraviolet absorption intensity and fluorescence intensity of the test solution after adding the Listeria monocytogenes numbered "3" in the figure are 0.9672 and 0.9452 respectively, and the ultraviolet absorption intensity and fluorescence intensity of the test solution after adding the Escherichia coli numbered "4" in the figure are 0.1943 and 0.2606 respectively. The ultraviolet absorption intensity value and fluorescence intensity value of the test solution of Bacillus are 0.9049 and 0.9551 respectively, the ultraviolet absorption intensity value and fluorescence intensity value of the test solution after adding Salmonella numbered "5" in the figure are 0.88772 and 1.0000 respectively, and the ultraviolet absorption intensity value and fluorescence intensity value of the test solution after adding Pseudomonas aeruginosa numbered "6" in the figure are 0.9189 and 0.9856 respectively. This shows that the dual-probe composition prepared by the present invention has good specificity for Burkholderia gladiolus.

[0101] Example 5

[0102] Testing of real samples

[0103] The dual-probe detection reagent prepared in Example 2 and the linear regression equation constructed in Example 3 were used to detect real food samples, and the soaked Tremella samples were selected for testing:

[0104] In order to verify whether the linear regression equation constructed according to Example 3 can be effectively applied to the determination under soaked Tremella fuciformis, this Example 5 is carried out by artificial quantitative bacterial infection to explore the difference between the number of bacteria detected by the dual-probe composition in the soaked Tremella fuciformis sample, so as to find out that even in real food samples, the dual-probe composition established in this application can be effectively detected under the influence of actual samples with nutrients.

[0105] The soaked Tremella was inoculated with Burkholderia gladiolus, and the inoculation amount was 10 5 CFU / mL, the spiked Tremella was homogenized by a homogenizer for 2 minutes, allowed to stand for 5 minutes, and the supernatant was taken as the test solution. In combination with Example 3, the colorimetric-fluorescence dual-modal signal was detected, and the obtained ultraviolet absorption intensity value-fluorescence intensity value was substituted into the obtained linear regression equation to obtain the concentration of Burkholderia gladiolus in the real sample.

[0106] The experimental results show that, according to calculations, in the environment where Burkholderia gladioli was artificially inoculated in soaked Tremella fuciformis, the concentrations of Burkholderia gladioli measured by colorimetry and fluorescence dual channels were 0.93×10 5 CFU / mL, 1.10×10 5 CFU / mL, almost the same as its actual concentration 10 5 The CFU / mL are close. It can be seen that even if the corresponding standard curve and linear regression equation are not established in the environment of soaked Tremella samples, the standard curve and linear regression equation established in 1×PBS buffer solution can still have good versatility. It can be seen that the aptamers screened by the present invention and the dual probes prepared using the aptamers have good versatility and can be quickly applied to different sample detections.

[0107] The present invention proposes a nucleic acid aptamer for gladiolus Burkholderia and a screening method thereof, which has the following technical advantages and innovations: Technical advantages: Improved detection sensitivity: By introducing specific aptamers, the detection sensitivity of gladiolus Burkholderia is significantly improved, so that it can be accurately identified even in low-concentration samples, effectively reducing the occurrence of false negative results. Shortened detection time: Compared with traditional detection methods, aptamer-based detection technology can complete sample analysis in a shorter time, greatly improve detection efficiency, and is suitable for rapid response to food safety monitoring needs. Reduced detection costs: The nucleic acid aptamers used are easy to synthesize and modify, which reduces the demand for experimental materials and equipment, thereby reducing the overall detection cost and making the technology more economical in practical applications. Enhanced ease of operation: Compared with traditional methods, the aptamer-based detection process is more simplified, reducing dependence on complex instruments, allowing operators to conduct experiments more easily and improving laboratory work efficiency. Wide applicability: The aptamers in the present invention can be designed and optimized for a variety of targets, not only limited to gladiolus Burkholderia, but also extended to the detection of other pathogenic microorganisms or pollutants, providing broad application prospects for food safety, environmental monitoring and other fields. Innovation: Combining computer-aided design with traditional experimental methods, the aptamer screening process is optimized through molecular docking and other technologies, which promotes the development and innovation of food safety detection technology. Using molecular docking technology, according to the structural characteristics of bacterial membrane proteins, high-affinity and specific aptamer candidate sequences are quickly screened from a large-scale nucleic acid sequence library, greatly shortening the screening cycle and reducing experimental costs. The molecular docking results are optimized using an improved particle swarm algorithm model, and the most matching nucleic acid aptamer sequence is determined by comparing the individual optimal value and the global optimal value, thereby improving the screening accuracy and efficiency. The obtained aptamers can be used to construct a rapid detection system for gladiolus Burkholderia, providing new technical means for food safety monitoring and pathogen detection. In summary, the present invention innovatively combines computer-aided design and experimental optimization to develop a highly targeted and efficient gladiolus Burkholderia nucleic acid aptamer and its screening method, which is expected to significantly improve the detection ability of foodborne pathogens and is of great significance for ensuring food safety. At the same time, the screened aptamer is combined with the yellow fluorescent nanozyme for the first time, and a dual-probe structure is formed with the magnetic beads loaded with concanavalin A to identify the target bacteria. The colorimetric-fluorescence dual-modal signal can be obtained simultaneously in one test, which not only enhances the sensitivity of the detection, but also can be mutually corrected to avoid misjudgment caused by operational errors.

[0108] It will be easily understood by those skilled in the art that the above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A nucleic acid aptamer for detecting Burkholderia gladiolus, characterized in that: The DNA sequence of the nucleic acid aptamer is shown in SEQ ID No:

1.

2. A method for preparing a detection reagent for detecting Burkholderia gladiolus based on the nucleic acid aptamer according to claim 1, wherein the detection reagent is a dual-probe detection reagent combining a magnetic separation probe and a fluorescent nanozyme probe; the magnetic separation probe is a combination of carboxylated magnetic beads and amino-rich concanavalin A, and the fluorescent nanozyme probe is a nucleic acid aptamer modified with a carboxyl group; the specific preparation steps include: (1) preparing an activation mixture, (2) preparing a magnetic separation probe, (3) preparing a fluorescent nanozyme probe, and (4) preparing a detection reagent to obtain a detection reagent for detecting Burkholderia gladiolus; characterized in that: in step (3), the fluorescent nanozyme probe is a yellow fluorescent nanozyme probe, which is obtained by amidation covalent coupling of an amino-containing yellow fluorescent nanozyme and a nucleic acid aptamer represented by a carboxyl-containing DNA sequence SEQ ID NO.

1.

3. The preparation method according to claim 2, characterized in that: In step (1), 10 mM 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide are mixed at a volume ratio of 1:1, and vortexed in a vortex machine to obtain an activated mixed solution, which is stored in a refrigerator at 4°C for later use.

4. The preparation method according to claim 2, characterized in that: In step (2), 500 μl of 5 mg / mL carboxyl magnetic beads and 200 μl of the activated mixed solution are vortex-mixed, incubated on a shaker at a speed of 200 rpm and room temperature for 30 min, the supernatant is removed by magnetic separation, washed twice with a phosphate buffer having a pH value of 7.4, and resuspended to 800 μl; 200 ul of 1 mg / mL concanavalin A is added, and the mixture is incubated in a blood mixer at a temperature of 4°C, protected from light, and at a low speed of 20 rpm for 5-6 h, and the supernatant is removed by magnetic separation; 50 μl of 5% bovine serum albumin is added, and the mixture is incubated in a blood mixer at a temperature of 4°C, protected from light, and at a low speed of 20 rpm for 2-3 h, and washed three times with a phosphate buffer having a pH value of 7.4 to obtain a magnetic separation probe.

5. The preparation method according to claim 2, characterized in that: In step (3), 20 μL of 100 mM nucleic acid aptamer represented by DNA sequence SEQ ID NO.1 was vortexed and mixed with 80 μL activation mixture, and incubated on a shaker at 200 rpm and room temperature for 30 min; 400 μL of 100 ug / mL yellow fluorescent nanozyme was added and vortexed, and incubated on a shaker at 180 rpm and 37°C for 2.5 h to obtain a yellow fluorescent nanozyme probe.

6. The preparation method according to claim 2, characterized in that: In step (4), 100 μL of magnetic separation probe, 50 μL of yellow fluorescent nanozyme probe and 250 μL of phosphate buffer with a pH value of 7.4 are mixed evenly at room temperature to prepare a detection reagent for the detection of Burkholderia gladiolus.

Images