Application of willow uridine diphosphate glucose-4-epimerase gene SpUGE1 in plant cell wall component remodeling, organelle cadmium content reduction and cadmium resistance improvement

Abstract

The invention belongs to the field of gene engineering, and particularly relates to application of a willow uridine diphosphate glucose-4-epimerase gene SpUGE1 in plant cell wall component remodeling, organelle cadmium content reduction and cadmium resistance improvement. According to the invention, the SpUGE1 gene in willow is extracted, and is transferred into arabidopsis thaliana by constructing a recombinant plasmid, so that the biological activity, Cd < 2 + > concentration and the like of wild arabidopsis thaliana and transgenic arabidopsis thaliana are compared. The result of the embodiment shows that the transgenic arabidopsis thaliana has certain tolerance to cadmium stress, the cell wall of the transgenic arabidopsis thaliana is obviously thickened, and the content of cadmium in organelles is obviously reduced.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and relates to the application of a willow UDP-glucose-4-epimerase gene SpUGE1 in plant cell wall component remodeling, organelle cadmium content reduction and cadmium resistance improvement. Background Art

[0002] Soil plays an important role in human production, life and survival. Heavy metal contamination of soil will pose serious risks to plants and human health. Cd is a non-essential element for plants. It has the characteristics of strong biological toxicity and wide distribution. It is often distributed in nature in the form of compounds and has strong mobility in ecosystems. It is one of the main heavy metal pollutions that affect plant growth. Studies have found that excessive accumulation of Cd in plant tissues can lead to slow plant growth, dwarfing of plants, browning of roots, yellowing and shedding of leaves, etc. The reduction of photosynthetic rate and chlorophyll content will also seriously affect photosynthesis, causing cell membrane damage and destroying cell structure, which will lead to a series of physiological and biochemical imbalances.

[0003] Plant cell walls are a major component of plant biomass and protect plant cells from stress attacks. Plant cell walls are highly dynamic structures that can remodel during plant growth and in response to various experimental stresses. Genetic modification of plant cell walls is considered a promising approach to improve plant growth and plant resistance to environmental stresses.

[0004] UDP-glucose 4-epimerase is a type of nucleotide sugar invertase that has been studied relatively clearly. It catalyzes the conversion between UDP-D-glucose (UDP-glucose, UDP-glc) and UDP-D-galactose (UDP-galactose, UDP-gal). UDP-D-galactose is the active form of galactose involved in the biosynthesis process. It is an important substance for plants to synthesize cell wall polysaccharides. There are a large number of galactose residues in plant cell wall pectin, hemicellulose, cellulose and cytoplasmic polysaccharides; UDP-D-galactose is also connected to the core oligosaccharides of various plant glycoproteins and participates in the cell signal transduction process; it is also the synthetic substrate of storage metabolites raffinose and stachyose. Therefore, UGE, as a key enzyme in the UDP-D-galactose synthesis pathway, plays a key regulatory role in maintaining the dynamic balance of UDP-D-galactose and UDP-D-glucose in cells.

[0005] Phytoremediation is the process of removing soil cadmium by means of plant fixation and extraction. It is environmentally friendly, can achieve in-situ restoration, and increase carbon sinks. Willow is a woody plant that absorbs cadmium efficiently and can effectively remove 30-50% of cadmium in the soil. It has been widely used in cadmium-contaminated soil remediation projects at home and abroad. However, in a high-cadmium site environment, how can hyperaccumulator willow improve resistance? The mechanism of cadmium adsorption is still unclear, and the key genes responsible for willow cell wall detoxification and their functions are still unclear. Therefore, exploring and analyzing the biological functions of the key genes responsible for willow cadmium absorption and detoxification can provide important genetic resources for using genetic engineering to improve willow's restoration capacity. Summary of the invention

[0006] The purpose of the present invention is to provide a UDP-glucose-4-epimerase gene SpUGE1 and its application in cadmium resistance. The present invention utilizes key genes in willow to improve the tolerance of transgenic plants to cadmium stress, which is of great significance to the cadmium-contaminated soil remediation project.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides a uridine diphosphate glucose-4-epimerase gene SpUGE1, and the coding sequence of the SpUGE1 gene is shown in the sequence table SEQ ID NO 1.

[0009] The present invention also provides a recombinant expression plasmid, and the plasmid can specifically express SpUGE1.

[0010] Preferably, the plasmid can improve the plant's resistance to cadmium.

[0011] The present invention also provides a transgenic plant resistant to cadmium pollution, characterized in that the transgenic plant is formed by transforming the above-mentioned recombinant expression plasmid into Agrobacterium tumefaciens EHA 105, and then introducing Agrobacterium tumefaciens EHA 105 into host cells for cultivation.

[0012] Preferably, the host cell is derived from Arabidopsis thaliana cell tissue.

[0013] The present invention also provides a method for constructing a cadmium-resistant recombinant plasmid, which specifically comprises the following steps:

[0014] S1, PCR amplify the coding sequence of SpUGE1 and purify the PCR product;

[0015] S2, the purified product was transformed into Escherichia coli TOP10 and sequenced to obtain the SpUGE1-pClone007-TOP10 strain;

[0016] S3. Using the SpUGE1-pClone007-TOP10 strain as a template, a CDS sequence containing two restriction sites, XbaI and BamHI, was obtained, and the SpUGE1-pCambia2301-KY recombinant expression plasmid was obtained by double enzyme digestion.

[0017] Preferably, the reaction solution of the PCR amplification process in step S1 is prepared as follows: 1 μL cDNA as template, 1.5 μL forward and reverse primers 10 μmol, 5 μL 2mM dNTPs, 3 μL 25mM MgSO4, 5 μL 10× PCR buffer, 1 μL KOD enzyme and 32 μL ddH2O.

[0018] Preferably, the PCR process is as follows: pre-denaturation: 95°C for 10 min; denaturation: 95°C for 50 s; annealing: 58°C for 50 s; extension: 72°C for 60 s, 35 cycles, extension at 72°C for 10 min.

[0019] The present invention also provides the use of the UDP-glucose-4-epimerase gene SpUGE1 or the recombinant expression plasmid or the transgenic plant in improving plant resistance to cadmium.

[0020] Beneficial effects of the present invention:

[0021] The present invention extracts the uridine diphosphate glucose-4-epimerase gene SpUGE1 from willow for the first time, which has the activity of transporting cadmium. The gene is used to construct transgenic Arabidopsis plants to improve the tolerance of plants to cadmium. The gene is applied in plant engineering and is of great significance to the remediation of cadmium-contaminated soil. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0023] Figure 1 This is a comparison of the lignin content of wild-type and transgenic Arabidopsis;

[0024] Figure 2 This is a comparison of the cellulose content of wild-type and transgenic Arabidopsis;

[0025] Figure 3 This is a comparison of the hemicellulose content of wild-type and transgenic Arabidopsis;

[0026] Figure 4 This is a comparison of the soluble sugar content of wild-type and transgenic Arabidopsis;

[0027] Figure 5 This is a diagram of the root growth status of wild-type and transgenic Arabidopsis thaliana after two weeks of CdCl2 treatment;

[0028] Figure 6 This is a comparison of the fresh weight of wild-type and transgenic Arabidopsis plants after two weeks of CdCl2 treatment;

[0029] Figure 7 This is a comparison of root lengths of wild-type and transgenic Arabidopsis plants after two weeks of CdCl2 treatment;

[0030] Figure 8 This is a comparison of root weights of wild-type and transgenic Arabidopsis plants after two weeks of CdCl2 treatment;

[0031] Fig. 9 The growth status of wild-type Arabidopsis and transgenic Arabidopsis;

[0032] Fig.10 Organelle Cd 2+ Concentration test results;

[0033] Fig.11 The results of total sugar content determination in wild-type Arabidopsis and transgenic Arabidopsis before and after CdCl2 treatment;

[0034] Fig.12 The results of polysaccharide content determination of wild-type Arabidopsis and transgenic Arabidopsis before and after CdCl2 treatment;

[0035] Fig.13 The results of SOD content determination in wild-type Arabidopsis and transgenic Arabidopsis before and after CdCl2 treatment;

[0036] Fig.14 The results of POD content determination in wild-type Arabidopsis and transgenic Arabidopsis before and after CdCl2 treatment;

[0037] Fig.15 These are the results of CAT content determination in wild-type and transgenic Arabidopsis before and after CdCl2 treatment.

[0038] Fig.16 The cell wall structures of wild-type and transgenic Arabidopsis thaliana before and after CdCl2 treatment;

[0039] Fig.17 This is a comparison of the cell wall thickness of wild-type and transgenic Arabidopsis before and after CdCl2 treatment;

[0040] Fig.18 The root status of wild-type and transgenic Arabidopsis plants before and after CdCl2 treatment;

[0041] Fig.19 This is a comparison of root length of wild-type and transgenic Arabidopsis before and after CdCl2 treatment;

[0042] Fig. 20 Figure 2 Cd in transgenic Arabidopsis organelles before and after CdCl2 treatment. 2+ Concentration test results. DETAILED DESCRIPTION

[0043] The present invention provides a uridine diphosphate glucose-4-epimerase gene SpUGE1, and the coding sequence of the SpUGE1 gene is shown in the sequence table SEQ ID NO 1.

[0044] Willow total RNA was extracted from willow and reversed to obtain willow cDNA. Using willow cDNA as a template, the CDS sequence of SpUGE1 was obtained by designed primers. The PCR product was purified to obtain the SpUGE1-pClone007 cloning vector, which was transformed into Escherichia coli TOP10 and sequenced to obtain the SpUGE1-pClone007-TOP10 strain. Using the SpUGE1-pClone007-TOP10 strain as a template, the CDS sequence containing two restriction sites XbaI and BamHI was obtained by designed primers. The SpUGE1-pCambia2301-KY recombinant expression plasmid was obtained by double enzyme digestion method, and the recombinant expression plasmid was transformed into Agrobacterium tumefaciens EHA105, and then transferred into Arabidopsis tissue to cultivate Arabidopsis transgenic plants.

[0045] Cellulose is a macromolecular polysaccharide composed of glucose and is the main component of plant cell walls. Hemicellulose is a heteropolymer composed of several different types of monosaccharides, which are bound to the surface of cellulose microfibrils and interconnected. These fibers form a hard network of interconnected cells. Lignin is an aromatic polymer composed of oxyphenylpropanol or its derivative structural units, forming a fiber scaffold and strengthening wood fibers. Soluble sugars play an important regulatory role in plant growth. Detecting their content can help understand the nutritional status and growth status of plants, and thus guide agricultural production and management. Cellulose, hemicellulose and lignin: The content and proportion of these three components in plant cell walls have an important influence on plant growth and development. Studying the interactions between them can help understand the formation and function of plant cell walls, and thus guide plant breeding and improvement.

[0046] SOD, POD and CAT are the main enzymes in the plant antioxidant system. They play an important antioxidant role in plants, helping to remove harmful free radicals and peroxides, thereby protecting plants from external environmental stress.

[0047] SOD (superoxide dismutase) is an important antioxidant enzyme that is widely present in various organisms, including animals, plants and microorganisms. Its main function is to convert superoxide anion free radicals (O 2- ) into hydrogen peroxide (H2O2) and oxygen (O2), thereby removing free radicals from the body. The level of SOD in an organism can reflect the aging and health status of the plant. A high level of SOD means that the plant has a strong antioxidant capacity and can fight against cell damage caused by free radicals12.

[0048] POD (peroxidase) is another important antioxidant enzyme that is widely present in plants. Its main function is to catalyze the decomposition of hydrogen peroxide (H2O2), converting it into water and oxygen, thereby removing hydrogen peroxide from the body. POD plays a key role in plant respiration, photosynthesis, and auxin oxidation.

[0049] CAT (catalase) is an enzyme scavenger, whose main function is to promote the decomposition of hydrogen peroxide (H2O2) into molecular oxygen and water, thereby removing hydrogen peroxide from the body. CAT plays an important role in the biological defense system and can protect cells from the toxicity of H2O2. The mechanism of action of CAT is to decompose hydrogen peroxide into harmless oxygen and water through the dismutation reaction of H2O2.

[0050] The antioxidant enzyme system maintains the free radical content in the plant at a steady state level through synergistic action, preventing changes in plant physiology and biochemistry caused by free radicals. When plants are subjected to external environmental stress, such as drought, high temperature, low temperature, etc., the reactive oxygen metabolism in the cells will be enhanced, producing a large amount of reactive oxygen species (ROS). These reactive oxygen species will damage cells at high concentrations, causing lipid peroxidation, protein oxidation, nucleic acid damage, and enzyme inactivation. The antioxidant enzyme system protects plants from oxidative stress by removing these harmful substances.

[0051] By detecting Cd in organelles of wild-type and transgenic Arabidopsis 2+ The results showed that the cell wall polysaccharide content in transgenic Arabidopsis plants increased, the cadmium content in transgenic Arabidopsis plants decreased, and the SpUGE1 gene increased the plant's resistance to cadmium.

[0052] Through the study of the growth phenotypes of wild-type and transgenic Arabidopsis, it was found that transgenic Arabidopsis has certain growth advantages over wild-type Arabidopsis, indicating that SpUGE1 can alleviate the toxic effects of cadmium pollution on transgenic Arabidopsis plants and promote the growth of Arabidopsis.

[0053]

[0054] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0055] RNA extraction kit and plant total RNA extraction kit were purchased from TIANGEN in Beijing; Evo M-MLV reverse transcription kit and SYBR Green MasterMix were purchased from Acre; PrimeScript TM II 1st Strand cDNA Synthesis Kit was purchased from Takara, Japan; KOD enzyme was purchased from TOYOBO, Japan; pClone007 BluntSimple Vector Kit was purchased from Tsingke, Beijing.

[0056] The various instruments, equipment, raw materials or reagents used in the embodiments of the present invention are not particularly limited in terms of their sources, and are all conventional products that can be purchased through regular commercial channels, or can be prepared according to conventional methods well known to those skilled in the art.

[0057] Example 1 SpUGE 1 gene extraction

[0058] Select willow branches with the same growth status, cut into pieces of about 15 cm, and place them in a conical bottle filled with 100 mL of sterile water. Incubate them in an incubator at 23°C, 74% humidity, and a photoperiod of 16h light / 8h dark for about 2 weeks. Treat the branches after they have taken root and grown new leaves.

[0059] Example 2 Construction of recombinant plasmid

[0060] Willow total RNA was extracted using the Plant Total RNA Extraction Kit and PrimeScript TM II 1st Strand cDNA Synthesis Kit was used to reverse the willow cDNA.

[0061] The CDS sequence of SpUGE1 was obtained using willow cDNA as a template using the designed primers.

[0062] SpUGE1-Fq:AACTTGGGAACAGGGAAAGG(SEQ ID NO 2)

[0063] SpUGE1-Rq:AGTTCCATTGATCCCTGCAC (SEQ ID NO 3)

[0064] The PCR reaction solution was prepared as follows: 1 μL cDNA as template, 1.5 μL forward and reverse primers (10 μmol), 5 μL 2 mM dNTPs, 3 μL 25 mM MgSO4, 5 μL 10× PCR buffer, 1 μL KOD enzyme and 32 μL ddH2O.

[0065] The PCR process was as follows: pre-denaturation: 95°C for 10 min; denaturation: 95°C for 50 s; annealing: 58°C for 50 s; extension: 72°C for 60 s, 35 cycles, and extension at 72°C for 10 min.

[0066] The PCR product was purified and the SpUGE1-pClone007 cloning vector was obtained using the pClone007 Blunt Simple Vector Kit. The Escherichia coli TOP10 was transformed and sequenced to obtain the SpUGE1-pClone007-TOP10 strain.

[0067] SpUGE1-pClone007-TOP10 strain was used as template, and the CDS sequence containing two restriction sites XbaI and BamHI was obtained by designed primers. The reaction process was the same as above. SpUGE1-pCambia2301-KY recombinant expression plasmid was obtained by double enzyme digestion method. Agrobacterium tumefaciens EHA105 was transformed and stored at -80°C for subsequent transformation of Arabidopsis thaliana.

[0068] Example 3: Verification experiment of Cd resistance of Arabidopsis transgenic plants

[0069] The transformed Agrobacterium tumefaciens EHA105 was transferred into Arabidopsis cell tissues, and the cultured Arabidopsis was screened and positively identified to obtain homozygous plants. Two strains with relatively high expression levels were screened by RT-qPCR and named T8 and T2.

[0070] The phenotypes of wild-type and transgenic Arabidopsis were analyzed, and the cellulose content, hemicellulose content, lignin content and soluble sugar content of wild-type and transgenic Arabidopsis were detected. Figure 1-4 As shown, the cellulose content, hemicellulose content, lignin content and soluble sugar content in transgenic Arabidopsis were significantly higher than those in the wild type. This indicates that SpUGE1 has an important effect on the growth and development of transgenic Arabidopsis, and the increase in cellulose content, hemicellulose content and lignin content can also promote the formation of cell walls in transgenic Arabidopsis.

[0071] Arabidopsis thaliana with the same growth status in different strains were selected for CdCl2 treatment. They were cultured on 1 / 2MS plates containing 0uM, 40uM, 60uM and 80uM CdCl2 concentrations, and the fresh weight, root length and root weight of wild-type and transgenic strains under different CdCl2 treatments were counted after 2 weeks of growth.

[0072] like Figure 5-8 As shown in the figure, the fresh weight, root length and root weight of transgenic Arabidopsis thaliana are better than those of wild type, and the fresh weight, root length and root weight of plants treated with 60uM and 80uM CdCl2 are significantly different from those of wild type. This example shows that the presence of SpUGE1 gene in transgenic Arabidopsis thaliana plants can improve the resistance of roots to Cd 2+ Has obvious antagonistic effect.

[0073] Wild-type and transgenic Arabidopsis were grown in the culture medium at the same time, and one month later, the wild-type and transgenic Arabidopsis were treated with 10 mM CdCl2.

[0074] The SOD, POD and CAT of wild-type and transgenic Arabidopsis were detected, and the Cd 2+ Concentration, total sugar content and polysaccharide content. All experiments were performed with three independent biological replicates.

[0075] By treating WT and transgenic Arabidopsis seedlings with CdCl2, it was found that the growth of transgenic Arabidopsis seedlings under CdCl2 treatment was better than that of WT, and they showed a certain tolerance to CdCl2 stress. In the later stage, the CdCl2 treatment concentration was increased to treat the seedlings.

[0076] The processing results show that Fig. 9 As shown in the figure, under the treatment of 1 Mm CdCl2, the leaves of WT showed obvious wilting and drying, and all leaves began to turn yellow. The leaves of T8 and T2 showed slight yellowing, and some leaves dried up. The growth status of T8 and T2 was significantly better than that of WT.

[0077] Through the cell organelle Cd 2+ Concentration detection found that Fig.10 As shown, Cd in cell wall, chloroplast, and mitochondria of T8 and T2 2+ The contents were significantly lower than that of WT.

[0078] like Figure 11-12 As shown in the results, in the detection of total sugar and polysaccharide contents, it was found that the contents of total sugar and polysaccharide in T8 and T2 were significantly higher than those in WT. After CdCl2 treatment, the contents of total sugar and polysaccharide showed a downward trend, but the contents of total sugar and polysaccharide in T8 and T2 were still significantly higher than those in WT.

[0079] In order to further study the effect of transgenic Arabidopsis on Cd2+ The results showed that after CdCl2 treatment, the SOD, POD and CAT contents of T8, T2 and WT were tested. Fig.13 As shown in Figure 2, the SOD content of T8 and T2 was significantly increased, while the SOD content of WT was significantly decreased. At the same time, the study found that after CdCl2 treatment, Figure 14-15 As shown, the POD and CAT contents in T8, T2 and WT showed an upward trend, but the POD and CAT contents in T8 and T2 were significantly higher than those in WT.

[0080] Through the study of the cell wall and root growth status of WT and transgenic Arabidopsis seedlings, it was found that Figure 16-17 As shown, the cell wall of transgenic Arabidopsis is significantly thicker than that of WT; Figure 18-19 As shown, the root length of transgenic Arabidopsis was significantly longer than that of WT.

[0081] Studies on transgenic Arabidopsis plants have shown that Fig. 20 As shown, Cd in chloroplasts, mitochondria and cell walls of transgenic Arabidopsis plants 2+ The content was significantly reduced.

[0082] In summary, the results of the embodiment show that the SpUGE1 gene can promote the synthesis of cell wall polysaccharide content in transgenic Arabidopsis plants, reduce the cadmium content in transgenic Arabidopsis plants, improve the plant's resistance to cadmium, and alleviate the toxic effects of cadmium pollution on transgenic Arabidopsis plants.

[0083] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Uridine diphosphate glucose-4-epimerase gene SpUGE1, characterized in that The coding sequence of the SpUGE1 gene is shown in the sequence listing as SEQ ID NO 1.

2. A recombinant expression plasmid, characterized in that: The plasmid can specifically express SpUGE1.

3. The plasmid according to claim 2, characterized in that The plasmid can improve the plant's resistance to cadmium.

4. A transgenic plant resistant to cadmium pollution, characterized in that: The transgenic plant is formed by transforming the recombinant expression plasmid described in claim 2 into Agrobacterium tumefaciens EHA 105, and then introducing Agrobacterium tumefaciens EHA 105 into host cells for cultivation.

5. The transgenic plant according to claim 4, characterized in that: The host cell is derived from Arabidopsis thaliana cell tissue.

6. A method for constructing a cadmium-resistant recombinant plasmid, characterized in that: The specific steps include: S1, PCR amplify the coding sequence of SpUGE1 and purify the PCR product; S2, the purified product was transformed into Escherichia coli TOP10 and sequenced to obtain the SpUGE1-pClone007-TOP10 strain; S3. Using the SpUGE1-pClone007-TOP10 strain as a template, a CDS sequence containing two restriction sites, XbaI and BamHI, was obtained, and the SpUGE1-pCambia2301-KY recombinant expression plasmid was obtained by double enzyme digestion.

7. The construction method according to claim 6, characterized in that: The reaction solution for the PCR amplification process in step S1 was prepared as follows: 1 μL cDNA as template, 1.5 μL forward and reverse primers 10 μmol, 5 μL 2 mM dNTPs, 3 μL 25 mM MgSO4, 5 μL 10× PCR buffer, 1 μL KOD enzyme and 32 μL ddH2O. The forward primer is shown in SEQ ID NO 2 in the sequence listing, and the reverse primer is shown in SEQ ID NO 3 in the sequence listing.

8. The PCR amplification process according to claim 7, characterized in that: The PCR process is as follows: pre-denaturation: 95°C for 10 min; denaturation: 95°C for 50 s; annealing: 58°C for 50 s; extension: 72°C for 60 s, 35 cycles, extension at 72°C for 10 min.

9. Use of the UDP-glucose-4-epimerase gene SpUGE1 according to claim 1, the recombinant expression plasmid according to any one of claims 2 to 3, or the transgenic plant according to any one of claims 4 to 5 in improving plant resistance to cadmium.

10. Use of the UDP-glucose-4-epimerase gene SpUGE1 according to claim 1 or the recombinant expression plasmid according to any one of claims 2 to 3 in reducing the cadmium content in plant cell walls.

Images