Directional gene recombination method

Abstract

The invention discloses a directional gene recombination method, which comprises the steps of linear recombinant vector preparation, target gene preparation, gene recombination, gene repair and the like, a recombination system is simple, and only the recombinant vector, the target gene, a recombination primer and a gene amplification system thereof are needed; two ends of a linearized recombinant vector and a target gene have homologous sequences, in a gene amplification process, the target gene is introduced to the tail end of the recombinant vector, a recombination process is completed after gene repair, recombination does not need to require the vector to have a free single-chain sequence, the recombination connection efficiency is high, and the period is short; the method is suitable for various recombination operations capable of amplifying target genes in the field of conventional tests and engineering.

Description

Technical Field

[0001] The present invention relates to the field of gene recombination technology, and in particular to a directed gene recombination method. Background Art

[0002] Since the discovery of PCR technology and restriction endonucleases in the 1970s, gene recombination technology has formed a complete system, which mainly includes the isolation of target genes, restriction cutting of target genes and recombinant vectors, directional connection of target genes and recombinant vectors, transformation of host cells, screening of positive clones, etc. There are two ways to connect target genes and vectors, forward and reverse. Only genes connected forward can be expressed correctly. Therefore, directional connection based on double enzyme cutting is the core of traditional recombination technology.

[0003] At present, the transformation of directed recombination technology is mainly achieved through the following two methods:

[0004] 1. Simulate the principle of biological gene recombination under natural conditions.

[0005] 2. Achieve directed recombination by in vivo ligation.

[0006] All of the above implementation methods require the synthesis of special primers and specific tool enzymes, which are costly. The latter uses a conventional tool enzyme and has relatively low requirements for primer sequences. However, the above in vivo recombination technology requires that the vector must have a free single-stranded sequence. These free sequences are prone to base shedding during repeated freezing and thawing, which affects the connection efficiency, is not suitable for long-term application, and is difficult to commercialize. Summary of the invention

[0007] Therefore, based on the above background, the present invention provides a method for stereotyped gene recombination, in which the recombination does not require the vector to have a free single-stranded sequence, the recombination connection efficiency is high, and the operation cycle is short.

[0008] The technical solution provided by the present invention is:

[0009] A directed gene recombination method comprising the following steps:

[0010] S1: Prepare linear recombinant vector;

[0011] S2: Preparation of target gene

[0012] 1) Synthesize recombination primers;

[0013] 2) Amplify the target gene;

[0014] S3: Genetic recombination

[0015] Genetic recombination is performed using asynchronous recombination or synchronous recombination;

[0016] in:

[0017] Asynchronous recombination is to mix the target gene and the recombinant vector and add them into the gene amplification system for amplification;

[0018] Synchronous recombination is the process of adding a recombinant vector to the target gene amplification system and then amplifying it.

[0019] S4: Gene repair

[0020] It is carried out by automatic repair or manual repair;

[0021] in:

[0022] Auto-repair is to transform the recombinant product of step S3 into the host cell, and then perform recovery and screening;

[0023] Artificial repair is to add single-stranded specific nuclease to the amplified product, and then add DNA ligase to connect the target gene and the vector.

[0024] Furthermore, in step S1, the site in the vector where the target gene needs to be introduced is cut by a restriction endonuclease.

[0025] Furthermore, the vector selected in step S1 is one of plasmid, cosmid, artificial chromosome, phage or virus.

[0026] Furthermore, the upstream portion of the upstream primer in the recombination primer in step S2 is homologous to the upstream recombination sequence of the vector, and the downstream portion is homologous to the upstream terminal sequence of the target gene;

[0027] The upstream part of the downstream primer is homologous to the downstream recombination sequence of the vector, and the downstream part is homologous to the downstream terminal sequence of the target gene.

[0028] Furthermore, there are two sites where the target gene needs to be introduced.

[0029] Furthermore, in the asynchronous recombination in step S3, the target gene and the recombinant vector are mixed in a quantitative ratio of 1:10 to 10:1.

[0030] Furthermore, in the asynchronous recombination in step S3, the target gene and the recombinant vector are mixed in a quantitative ratio of 1:1 to 3:1.

[0031] Furthermore, the gene amplification system in step S3 is composed of DNA polymerase, nucleoside triphosphates, and reaction buffer.

[0032] Furthermore, the DNA polymerase is a heat-resistant DNA polymerase.

[0033] The above technical solution has the following beneficial effects:

[0034] The recombination system of the present invention is simple and only requires a recombination vector, a target gene, a recombination primer and a gene amplification system thereof. The linearized recombination vector and the two ends of the target gene have homologous sequences. During the gene amplification process, the target gene is introduced at the end of the recombination vector, and the recombination process is completed after gene repair. The recombination does not require the vector to have a free single-stranded sequence, the recombination connection efficiency is high, the cycle is short, and the system is suitable for various recombination operations that can amplify target genes in conventional experiments and engineering fields. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] The technical solution of the present invention:

[0037] A directed gene recombination method comprising the following steps:

[0038] S1: Prepare linear recombinant vector;

[0039] In this step, the site (recombination site) where the target gene is to be introduced is cut by restriction endonuclease in the vector, and the above process is the vector linearization process. The sequence near the upstream of the recombination site is called the upstream recombination sequence, and the sequence near the downstream is called the downstream recombination sequence.

[0040] The vector is selected from plasmid, cosmid, artificial chromosome, phage or virus.

[0041] There are two sites (recombination sites) where the target gene needs to be introduced in this step.

[0042] S2: Preparation of target gene

[0043] 1) Synthesize recombination primers;

[0044] In this step, the upstream part of the upstream primer in the recombination primers is homologous to the upstream recombination sequence of the vector, and the downstream part is homologous to the upstream terminal sequence of the target gene; the upstream part of the downstream primer is homologous to the downstream recombination sequence of the vector, and the downstream part is homologous to the downstream terminal sequence of the target gene.

[0045] 2) Amplify the target gene;

[0046] In this step, the target gene is amplified according to conventional methods and then recovered for later use.

[0047] S3: Genetic recombination

[0048] Genetic recombination is performed using asynchronous recombination or synchronous recombination;

[0049] in:

[0050] Asynchronous recombination is to mix the target gene and the recombinant vector, add them to the gene amplification system and amplify them according to the routine method; the number of amplification cycles is 3 to 30 times: the amplified product is renatured after thermal denaturation and recovered for future use.

[0051] In this step, the target gene and the recombinant vector are mixed at a quantitative ratio of 1:10 to 10:1. Preferably, the target gene and the recombinant vector are mixed at a quantitative ratio of 1:1 to 3:1.

[0052] Synchronous recombination is to add the recombinant vector to the target gene amplification system, complete the amplification by conventional methods, and then renature the amplified product after thermal denaturation and recover it for future use.

[0053] In this step, the gene amplification system is composed of DNA polymerase, nucleoside triphosphates, and reaction buffer.

[0054] The DNA polymerase is a heat-resistant DNA polymerase, and preferably, the DNA polymerase is a high-fidelity heat-resistant DNA polymerase.

[0055] S4: Gene repair

[0056] It is carried out by automatic repair or manual repair;

[0057] in:

[0058] Automatic repair is to transform the recombinant product of step S3 into the host cell, and then perform recovery and screening by conventional methods; that is, the gene is automatically repaired in the cell.

[0059] Artificial repair is to add single-strand specific nuclease to the amplified product, and after conventional treatment, add DNA ligase to connect the target gene and the vector. The nuclease treatment process and the connection process can be carried out in the same system.

[0060] The gene repair process in this step includes two processes: residual base elimination and gene connection. As mentioned above, the repair process can be completed outside the cell by a tool enzyme, or it can be completed automatically with the help of an intracellular repair system, or it can be completed jointly by a tool enzyme and an intracellular repair system. It is preferably, but not limited to, completed automatically with the help of an intracellular repair system.

[0061] In this embodiment, the target gene introduced in step S3 can be a gene amplification product or an original gene;

[0062] In the present invention, the sequences at both ends of the target gene are target gene recombination sequences, wherein the upstream is homologous to the vector gene sequence of the corresponding recombination site in the recombinant vector, and the downstream is homologous to the recombination sequence corresponding to the target gene to be introduced.

[0063] Example 2: This example takes a certain original gene as the target gene and uses directional cloning into a certain vector as an example to specifically illustrate the technology, and the method used is synchronous recombination automatic repair.

[0064] 1. The multiple cloning site of a certain vector is as follows: 5'-CTCTAGAGTCGACGATATCCTGCAGGCATGC-3SEQ ID NO: 1;

[0065] The endonuclease was EcoRV;

[0066] The terminal sequence of a certain original gene is as follows: 5'-ATGCGCAAATTTGGCG.....CGCCGGCGTTCAATAA-3' SEQ ID NO: 2;

[0067] 2. Primer upstream primer CTCTAGAGTCGACGATATGCGCAAATTTGGCG SEQ ID NO: 3;

[0068] Downstream primer CATGCCTGCAGGATTTATTGAACGCCGCG SEQ ID NO:4.

[0069] 3. Operation process

[0070] PfU DNA polymerase, dNTP, primers, template and reaction buffer were added to a 60 μl reaction system according to conventional operation methods. At the same time, 2 μl of carrier solution (2 μg / μl) was added to the reaction system. 15 cycles of denaturation at 90 degrees Celsius for 20 minutes and renaturation at room temperature for 15 minutes were performed in the conventional manner.

[0071] Competent E. coli were transformed by conventional methods and selected after recovery.

[0072] The present invention and its implementation methods are described above, and such description is not restrictive, and the actual methods are not limited thereto. In short, if ordinary technicians in the field are inspired by it, without departing from the purpose of the invention, they can design implementation methods and embodiments similar to the technical solution without creativity, which should all fall within the protection scope of the present invention.

Claims

1. A directed gene recombination method, characterized in that: It includes the following steps: S1: Prepare linear recombinant vector; S2: Preparation of target gene 1) Synthesize recombination primers; 2) Amplify the target gene; S3: Genetic recombination Genetic recombination is performed using asynchronous recombination or synchronous recombination; in: Asynchronous recombination is to mix the target gene and the recombination vector and add them into the gene amplification system for amplification; Synchronous recombination is the process of adding a recombinant vector to the target gene amplification system and then amplifying it. S4: Gene repair It is carried out by automatic repair or manual repair; in: Auto-repair is to transform the recombinant product of step S3 into the host cell, and then perform recovery and screening; Artificial repair is to add single-stranded specific nuclease to the amplified product, and then add DNA ligase to connect the target gene and the vector.

2. A directed gene recombination method according to claim 1, characterized in that: In step S1, the site where the target gene needs to be introduced in the vector is cut by restriction endonuclease.

3. A directed gene recombination method according to claim 1, characterized in that: The vector selected in step S1 is one of plasmid, cosmid, artificial chromosome, bacteriophage or virus.

4. A directed gene recombination method according to claim 1, characterized in that: The upstream part of the upstream primer in the recombination primer in step S2 is homologous to the upstream recombination sequence of the vector, and the downstream part is homologous to the upstream terminal sequence of the target gene; The upstream part of the downstream primer is homologous to the downstream recombination sequence of the vector, and the downstream part is homologous to the downstream terminal sequence of the target gene.

5. A directed gene recombination method according to claim 2, characterized in that: There are two sites where the target gene needs to be introduced.

6. A directed gene recombination method according to claim 1, characterized in that: In step S3, the target gene and the recombinant vector are mixed in the asynchronous recombination at a quantitative ratio of 1:10 to 10:

1.

7. A directed gene recombination method according to claim 6, characterized in that: In step S3, the target gene and the recombinant vector are mixed in the asynchronous recombination at a quantitative ratio of 1:1 to 3:

1.

8. A directed gene recombination method according to claim 1, characterized in that: The gene amplification system in step S3 is composed of DNA polymerase, nucleoside triphosphates, and reaction buffer.

9. A directed gene recombination method according to claim 8, characterized in that: The DNA polymerase is a heat-resistant DNA polymerase.