High-throughput wheat pre-harvest sprouting resistant molecular marker KASP5D3041 and application thereof in breeding

Abstract

The invention discloses a high-throughput wheat pre-harvest sprouting resistance molecular marker KASP5D3041 and application thereof in breeding, and relates to the technical field of wheat breeding, the molecular marker has obvious influence on the pre-harvest sprouting resistance of wheat, marker-assisted selection is carried out according to a result in combination with pre-harvest sprouting phenotype, and the wheat pre-harvest sprouting resistance molecular marker KASP5D3041 has high throughput. The excellent germplasm containing the pre-harvest sprouting resistant site is screened for wheat pre-harvest sprouting resistant breeding, the breeding efficiency is improved, and the wheat pre-harvest sprouting resistant breeding process is accelerated.

Description

Technical Field

[0001] The invention relates to the technical field of wheat breeding, and in particular to a high-throughput wheat ear sprout resistance molecular marker and an application thereof in breeding. Background Art

[0002] Wheat is one of the three major grain crops in my country and has made important contributions to ensuring national food security. Ensuring high and stable wheat yields is the key to ensuring national food security. Pre-harvest Sprouting (PHS) can lead to reduced wheat yield and deterioration of quality. It occurs in major wheat-producing areas around the world, causing losses of about US$1 billion each year, posing a serious threat to wheat production. The harm of pre-harvest sprouting to crops is mainly reflected in three aspects: first, after pre-harvest sprouting, the stored materials in the grains are continuously hydrolyzed and consumed, resulting in a decrease in bulk density and thousand-grain weight, which seriously affects crop yields; second, pre-harvest sprouting weakens seed germination potential, resulting in small and weak seedlings, and even causing a serious decrease in germination rate, causing significant economic losses to farmers and seed operators; third, pre-harvest sprouting reduces the content of nutrients in seeds, resulting in reduced dough extensibility, elasticity and water retention capacity, and changes in starch gelatinization, gelatinization and regeneration properties, which significantly affects the quality of rice noodles, noodles, cakes and bread.

[0003] Mining anti-ear sprouting genes / sites, developing functional markers that can quickly and high-throughput detect anti-ear sprouting genes / sites, screening excellent germplasm with excellent anti-ear sprouting genes / sites, cultivating wheat varieties with anti-ear sprouting and promoting planting are effective means to alleviate the harm of wheat ear sprouting. At present, in the 47 (about 40 populations) reported anti-ear sprouting QTL mapping studies, more than 250 QTLs related to ear sprouting resistance or seed dormancy characteristics distributed on 21 chromosomes of wheat have been detected. With the development of sequencing technology and molecular markers, genome-wide association analysis has become a new means to discover anti-ear sprouting QTLs. In the reported GWAS studies, a total of about 1,100 SNP markers (Marker-trait association SNP, MTAS) associated with wheat ear sprouting resistance and related traits have been detected. By analyzing the physical positions of these MTAS, it was found that many MTAS are located within the anti-ear sprouting site interval located by QTL mapping. Summarizing the reported QTLs, it was found that only 29 QTLs can explain high phenotypic variation and are stably inherited in multiple environments, of which 22 are distributed in the second, third and fourth homologous groups. Through map-based cloning, only TaMFT / TaPHS1, TaMKK3-A, Myb10-D, TaVp-1, TaSdr, TaQsd and TaDOG1L1 have been cloned so far, and there are few rapid, efficient and high-throughput molecular markers developed, which cannot meet the current needs of molecular breeding for ear sprout resistance. In addition, no ear sprout resistance gene has been reported on the short arm of chromosome 5D so far. Summary of the invention

[0004] The present invention aims to provide a high-throughput wheat ear sprout resistance molecular marker KASP5D3041 and application thereof in breeding.

[0005] The present invention protects a high-throughput wheat ear sprout resistance molecular marker KASP5D3041, the physical position of the corresponding ear sprout resistance main effect site QPhs-5DS is at 7018543bp on the short arm of wheat 5D chromosome, and the molecular marker is T or C.

[0006] The present invention also protects a primer pair for amplifying the above molecular marker, which is a KASP high-throughput SNP marker, including 2 forward primers and 1 reverse primer; the primer sequences are as follows:

[0007] KASP5D3041FAM:

[0008] 5'GGTCCTTCCCTTTCCACTCTTG 3', the nucleotide sequence of which is shown in SEQ ID NO. 1: ggtccttccctttccactct tg;

[0009] KASP5D3041HEX:

[0010] 5'GGTCCTTCCCTTTCCACTCTTC 3', the nucleotide sequence of which is shown in SEQ ID NO.2: ggtccttccctttccactct tc;

[0011] KASP5D3041R:

[0012] 5'GGGCAGACTACAGCACAAGA 3', the nucleotide sequence of which is shown in SEQ ID NO.3: ggtccttccctttccactct tc.

[0013] The present invention also protects a detection kit containing the primer pair for identifying KASP molecular markers related to wheat ear sprout resistance traits.

[0014] The present invention also protects the use of the above primer pair or the above detection kit in molecular marker-assisted wheat ear sprout resistance selection breeding, and the specific operation is:

[0015] Using the DNA of the wheat sample to be tested as a template, PCR amplification is performed on the template using the primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively;

[0016] Omega FLUO star was used to perform genotyping on the amplified PCR products, and the distribution results of SNPs in wheat were collected. The judgment criteria were the color of the points and the position on the horizontal or vertical axis: if the signal was orange, it was clustered near the horizontal axis and clustered with the anti-ear sprout control parent, and was determined to be an anti-ear sprout genotype; if the signal was blue, it was clustered with the vertical axis and the susceptible ear sprout control parent, and was determined to be a susceptible ear sprout genotype.

[0017] The molecular marker KASP5D3041 provided by the present invention has a significant effect on the ear sprout resistance of wheat. According to the result, marker-assisted selection is performed in combination with the ear sprout phenotype to screen excellent germplasm containing ear sprout resistance sites for wheat ear sprout resistance breeding, thereby improving breeding efficiency and accelerating the wheat ear sprout resistance breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the result of genome-wide linkage analysis;

[0019] Figure 2 This is the genotyping map of molecular marker KASP5D3041 in 264 wheat varieties;

[0020] Figure 3 This is a multiple comparison diagram of the genotyping results of the molecular marker KASP5D3041 in 264 wheat varieties. DETAILED DESCRIPTION

[0021] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively below in conjunction with the accompanying drawings and specific embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present invention more thoroughly understood.

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The technical scheme of the present invention is described more clearly and completely below in conjunction with specific embodiments and comparative examples.

[0023] Note: The wheat varieties (lines) used in the embodiments of the present invention are all parent groups or varieties (lines) constructed from conventional parent varieties, and can be obtained from the market or other public channels.

[0024] 1. Linkage analysis of the ear sprout resistance locus QPhs-5DS

[0025] Based on the ear sprout resistance of 179 P82×LM21 recombinant inbred line populations under three environments and a high-density genetic map constructed from 4462 SNP populations, whole-genome linkage mapping for ear sprout resistance was performed. The specific steps are as follows.

[0026] a) Identify the ear sprout resistance of 179 P82×LM21 recombinant inbred lines in eight environments;

[0027] b) Genotyping of the parental populations using the 55K wheat gene chip yielded 4462 SNPs;

[0028] c) constructing a high-density genetic map in the parental population using Joinmap V5.0;

[0029] d) The composite interval mapping method in Windows QTL Cartographer V2.5 was used for genome-wide linkage analysis. The anti-ear sprouting locus QPhs-5DS on the short arm of wheat chromosome 5D was located in all seven environments of the parental populations. The physical position was 1419112-7018570 bp, and the physical interval was about 5.6 Mb. Figure 1 .

[0030] 2. Development of high-throughput molecular detection markers

[0031] Using the wheat reference genome, a SNP marker AX-109913041 was found at 7018543bp within the ear sprouting resistance site QPhs-5DS. The marker was polymorphic between parents and tightly linked to both QPhs-5DS and wheat ear sprouting resistance. It was converted into a KASP marker for detecting the ear sprouting resistance site QPhs-5DS.

[0032] 3. Extraction of Wheat Genomic DNA

[0033] 1) At the three-leaf stage of wheat, young wheat leaves were selected, numbered, and placed in corresponding 2 mL 96-well plates. They were dried using a freeze dryer and ground into powder using a high-throughput tissue grinder.

[0034] 2) Add 800 μL of CTAB solution and place in a 65°C water bath for 60 minutes, shaking gently 3-5 times;

[0035] 3) Add 800 μL of chloroform-isoamyl alcohol (volume ratio 24:1) and shake gently for 10 minutes (operate in a fume hood);

[0036] 4) After centrifugation at 12000 RPM for 10 min, 600 μL of supernatant was extracted and placed in a new 96-well plate with the corresponding serial number, and an equal volume of isopropanol and 1 / 10 volume of 3M sodium acetate were added to the supernatant;

[0037] 5) After centrifugation at 12000 RPM for 15 min, discard the supernatant and wash twice with ice ethanol (70%);

[0038] 6) After drying until there is no ethanol smell, add 200 μL of double distilled water, and store in a -20℃ refrigerator after it is completely dissolved.

[0039] 4. Primer Dilution and Assay Primer Mixing

[0040] The three primers were diluted to 100 μM with ultrapure water and then mixed in a volume ratio of KASP5D3041FAM:KASP5D3041HEX:KASP5D3041R:ultrapure water = 6:6:15:23. The mixed assay primers were stored in a -20°C refrigerator for later use.

[0041] 5. PCR Amplification

[0042] The PCR amplification system was prepared with the following ratios: 3 μL DNA template, 3 μL 2×Master Mix (LGC group UK) and 0.0825 μL KASP primer mixture (synthesized by Shanghai Sangon Biotechnology Co., Ltd.).

[0043] The KASP marker PCR amplification procedure is:

[0044] 1) 95°C for 15 min;

[0045] 2) 94°C for 1 min;

[0046] 3) 65°C-57°C for 30s; step 2) to step 3) for 10 cycles;

[0047] 4) 94°C for 1 min;

[0048] 5) 57°C for 30 seconds, step 4) to step 5) for 30 cycles;

[0049] 6) Store at 4℃.

[0050] 6. Results Analysis

[0051] Omega FLUO star was used to perform genotyping on the amplified PCR products and collect the distribution results of SNPs in wheat, such as Figure 2 As shown, the judgment standard is determined by the color of the points and the position on the horizontal or vertical axis: the signal is orange, clustered near the horizontal axis and clustered together with the resistant ear sprouting control parent, and is judged as the resistant ear sprouting genotype; the signal is blue, clustered together with the vertical axis and the susceptible ear sprouting control parent, and is judged as the susceptible ear sprouting genotype.

[0052] VII. Verification of the effect of ear sprout resistance locus QPhs-5DS / molecular marker KASP5D3041 in wheat ear sprout resistance breeding

[0053] The molecular markers provided by the present invention were used to detect 264 wheat varieties, and 90 wheat varieties with ear sprout resistance genotypes (consistent with the genotype of the control ear sprout resistance parent P82) and 174 wheat varieties with ear sprout sensitivity genotypes (consistent with the control ear sprout sensitivity parent LM21) were obtained. The ear germination rate of the wheat varieties containing the ear sprout resistance genotype was significantly lower than that of the wheat varieties containing the ear sprout sensitivity genotype, indicating that the ear sprout resistance site QPhs-5DS has a significant effect on the ear sprout resistance of wheat (refer to Figure 3 ). Based on the results and combined with the ear sprout phenotype, marker-assisted selection is performed to screen excellent germplasm containing ear sprout resistance loci for wheat ear sprout resistance breeding, improve breeding efficiency, and accelerate the wheat ear sprout resistance breeding process.

[0054] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A high-throughput wheat ear sprout resistance molecular marker KASP5D3041, characterized in that: The physical position of the molecular marker corresponding to the main effect site QPhs-5DS of ear sprout resistance is 7018543bp on the short arm of wheat chromosome 5D, and the molecular marker is T or C.

2. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The marker is a KASP high-throughput SNP marker, including 2 forward primers and 1 reverse primer; the primer sequences are as follows: KASP5D3041FAM: 5'GGTCCTTCCCTTTCCACTCTTG 3', the nucleotide sequence of which is shown in SEQ ID NO.1; KASP5D3041HEX: 5'GGTCCTTCCCTTTCCACTCTTC 3', the nucleotide sequence of which is shown in SEQ ID NO.2; KASP5D3041R: 5'GGGCAGACTACAGCACAAGA 3', the nucleotide sequence of which is shown in SEQ ID NO.

3.

3. A detection kit containing the primer pair according to claim 2 for identifying KASP molecular markers related to wheat ear sprout resistance traits.

4. Use of the primer pair according to claim 2 or the detection kit according to claim 3 in molecular marker-assisted wheat ear sprout resistance selection breeding.

5. The use according to claim 5, characterized in that: The specific operations are: Using the DNA of the wheat sample to be tested as a template, PCR amplification is performed on the template using the primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively; Omega FLUO star was used to perform genotyping on the amplified PCR products and collect the distribution results of SNPs in wheat. The judgment criteria were the color of the points and the positions of the points on the horizontal or vertical axis: if the signal was orange, clustered near the horizontal axis and clustered with the anti-ear sprout control parent, it was judged as the anti-ear sprout genotype; The signal is blue and clustered with the vertical axis and the susceptible ear germination control parent, and is determined to be the susceptible ear germination genotype.

Images