Application of miR-1303 and / or miR-4521 in thin endometrium

Abstract

The invention relates to an application of miR-1303 (micro Ribonucleic Acid) and / or miR-4521 (micro Ribonucleic Acid) in a thin endometrium. The invention provides an application of a miR-1303 inhibitor and / or a miR-4521 inhibitor in preparation of a product for preventing and / or treating thin endometrium. According to the application, it is found that by inhibiting transcription expression of miR-1303 and miR-4521, the thin endometrium is treated by promoting differentiation of HucMSC to EEC and / or promoting proliferation and migration of HucMSC, and a new thought is provided for diagnosis, prevention and treatment of the thin endometrium.

Description

Technical Field

[0001] The present application relates to the field of biomedicine, and specifically to the application of miR-1303 and / or miR-4521 in thin endometrium. Background Art

[0002] Thin endometrium usually refers to the endometrial thickness of less than 7-8 mm measured by ultrasound during the assisted reproductive technology (ART) cycle, when the follicles are mature or under the action of sufficient exogenous estrogen. One of the pathophysiological characteristics of thin endometrium is damage to the endometrial basal layer, increased uterine artery blood flow resistance and vascular dysplasia. The ischemic and hypoxic environment causes slow growth of endometrial cells, reduced glandular number and endometrial fibrosis, which ultimately causes endometrial regeneration disorders, affects endometrial receptivity, and reduces clinical pregnancy rate and live birth rate.

[0003] Human umbilical cord mesenchymal stem cells (HucMSCs) regulate biological processes such as angiogenesis, immune response, cell proliferation and apoptosis, inflammatory response and fibrosis. They have the advantages of simple material collection, rapid proliferation, low immunogenicity and tumorigenicity. Their effectiveness in treating thin endometrium has been confirmed, but the specific mechanism has not yet been clarified. The paracrine effect of HucMSCs plays an important role in the repair of damage. Exosomes (-ex) are important carriers of paracrine secretion. The micro messenger ribonucleic acid (miRNA) carried in them participates in tissue damage repair and may benefit thin endometrium.

[0004] Therefore, this application deeply explored the effect and regulatory mechanism of miRNA levels on HucMSCs, providing ideas for the treatment of thin endometrium. Summary of the invention

[0005] Based on this, it is necessary to provide, in one embodiment of the present application, the use of a miR-1303 inhibitor and / or a miR-4521 inhibitor in the preparation of a product for preventing and / or treating thin endometrium.

[0006] The technical solutions include the following:

[0007] Use of a miR-1303 inhibitor and / or a miR-4521 inhibitor in preparing a product for preventing and / or treating thin endometrium.

[0008] In one embodiment, the type of thin endometrium is thin endometrium caused by hypoxic damage to endometrial cells.

[0009] In one embodiment, the product comprises a drug.

[0010] In one embodiment, the drug comprises an active ingredient and a pharmaceutically acceptable excipient, wherein the active ingredient comprises a miR-1303 inhibitor and / or a miR-4521 inhibitor.

[0011] In one embodiment, the drug further comprises exosomes secreted by hypoxia-damaged endometrial glandular epithelial cells.

[0012] Use of miR-1303 inhibitor and / or miR-4521 inhibitor in the preparation of biological preparations for promoting the differentiation of HucMSC into EEC.

[0013] Use of miR-1303 inhibitor and / or miR-4521 inhibitor in preparing biological preparations for promoting HucMSC proliferation and / or migration.

[0014] In one embodiment, the miR-1303 inhibitor includes a substance that inhibits the expression or function of miR-1303, and / or the miR-4521 inhibitor includes a substance that inhibits the expression or function of miR-4521.

[0015] In one embodiment, the substance comprises siRNA.

[0016] It is understandable that in other embodiments, those skilled in the art may select other substances capable of inhibiting the expression of miR-1303 and / or substances capable of inhibiting the expression of miR-4521, such as gene editing systems, etc. Any substance capable of achieving the purpose of inhibiting the expression or function of miR-1303 and / or miR-4521 of the present application is within the scope of protection of the present application.

[0017] In one embodiment, the siRNA that inhibits the expression of miR-1303 is shown in SEQ ID NO:5.

[0018] In one embodiment, the siRNA that inhibits the expression of miR-4521 is shown in SEQ ID NO:6.

[0019] In one embodiment, the substance further comprises an expression vector. Optionally, the expression vector includes but is not limited to a viral vector and a plasmid. In one embodiment, the viral vector comprises a lentivirus and / or an adenovirus.

[0020] Use of miR-1303 and / or miR-4521 in screening drugs for preventing and / or treating thin endometrium; optionally, the drug can reduce the expression level of miR-1303 and / or miR-4521 in HucMSC cells, and / or inhibit the function of miR-1303 and / or miR-4521.

[0021] In one embodiment, in the screening, the candidate drug is co-cultured with HucMSC cells, and the expression level of miR-1303 and / or miR-4521 in the HucMSC cells is detected after culture to determine whether it is a drug for preventing and / or treating thin endometrium.

[0022] In one embodiment, the method for detecting the expression level of miR-1303 and / or miR-4521 in HucMSC cells comprises RT-qPCR.

[0023] In one embodiment, the detection primers for miR-1303 expression level are shown in SEQ ID NO: 1-2, and the detection primers for miR-4521 expression level are shown in SEQ ID NO: 3-4.

[0024] Use of a reagent for detecting the expression level of miR-1303 and / or miR-4521 in the preparation of a product for diagnosing thin endometrium.

[0025] In one embodiment, the product comprises a diagnostic kit.

[0026] In one embodiment, the miR-1303 and / or miR-4521 are significantly upregulated in HucMSCs of patients with thin endometrium.

[0027] In one embodiment, the reagents for detecting the expression levels of miR-1303 and / or miR-4521 include primers.

[0028] In one embodiment, the primers for detecting miR-1303 are shown in SEQ ID NO: 1-2, and the primers for detecting miR-4521 are shown in SEQ ID NO: 3-4.

[0029] Compared with the traditional technology, this application has the following beneficial effects:

[0030] The present application found that inhibiting the transcriptional expression of miR-1303 and miR-4521 can treat thin endometrium by promoting the differentiation of HucMSC into EEC and / or promoting the proliferation and migration of HucMSC, providing a new idea for the diagnosis, prevention and treatment of thin endometrium. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0032] Figure 1 This is a diagram showing the results of the CCK8 cell proliferation experiment in Example 1;

[0033] Figure 2 The results of the EdU cell proliferation experiment in Example 1 are shown in Figure A at 72 hours and Figure B at 96 hours;

[0034] Figure 3 The results of the Transwell cell migration experiment in Example 1, wherein Figure A is for 12 hours and Figure B is for 24 hours;

[0035] Figure 4 The results of the Wound Healing cell scratch experiment in Example 1, wherein Figure A is for 12 hours and Figure B is for 24 hours;

[0036] Figure 5 The Western Blot results of the HucMSC stem cell differentiation into EEC in Example 1;

[0037] Figure 6 The expression results of miR-1303 and miR-4521 in HucMSC group, EECD-ex+HucMSC group and EEC-ex+HucMSC group;

[0038] Figure 7 This is a diagram showing the results of the CCK8 cell proliferation experiment in Example 2;

[0039] Figure 8 The results of the EdU cell proliferation experiment in Example 2 are shown in Figure A at 72 hours and Figure B at 96 hours;

[0040] Fig. 9 The results of the Transwell cell migration experiment in Example 2, wherein Figure A is 12 hours and Figure B is 24 hours;

[0041] Fig.10 The results of the Wound Healing cell scratch test in Example 2, where Figure A is 12 hours and Figure B is 24 hours;

[0042] Fig.11 This is the Western Blot experimental result of HucMSC stem cells differentiation into EEC in Example 2. DETAILED DESCRIPTION

[0043] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail below. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0045] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0046] In this article, EEC, the full name of which is endometrial epithelial cells, refers to normal endometrial glandular epithelial cells.

[0047] In this article, EECD, the full name of which is endometrial epithelial cell under damage, refers to hypoxia-damaged endometrial glandular epithelial cells.

[0048] In this article, HucMSC, the full English name is human umbilical cord mesenchymal stem cell, human umbilical cord mesenchymal stem cell.

[0049] In this article, ex, which stands for Exosome in English, refers to exosomes secreted by EEC or EECD cells.

[0050] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0051] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0052] The following examples involve the following main experimental methods:

[0053] 1. EEC cell culture and identification

[0054] Normal endometrial glandular epithelial cells (EEC) were purchased from Shanghai Saibaikang Biotechnology (human primary EEC, catalog number: HUM-iCell-f004), and the company's complete culture medium system for this cell was used. EEC was cultured in a 37°C, 5% CO2 constant temperature incubator. When the EEC density increased to 80% to 90%, cell expansion and passage were started, and the steps were as follows:

[0055] (1) Add complete cell culture medium to PBS containing penicillin-streptomycin double antibody at a final concentration of 1×, take out 0.25% trypsin from a 4°C refrigerator, and place it at room temperature for later use.

[0056] (2) Aspirate the complete medium (retain 3 mL for subsequent digestion termination), gently wash the cells 3 times with 3 mL PBS, add 500 μL of 0.25% trypsin, and digest the cells in a 37°C CO2 incubator for 2 minutes. When the cells begin to flow like a waterfall, and a large area of ​​cells are observed to be attached to the wall and floating under an inverted microscope, the digestion is terminated, and the cells at the bottom are blown 15 to 20 times. The cell suspension is centrifuged at 1,000 rpm / min at room temperature for 5 minutes.

[0057] (3) Discard the supernatant, use your fingertips to disperse the cell pellet at the bottom of the centrifuge tube, add 3 mL of complete culture medium, and resuspend the cells by pipetting. Prepare a new sterile cell culture flask, pipette 4 mL of new complete culture medium and 1 mL of cell suspension into the new flask. Mix the cells thoroughly and let stand for 5 minutes to allow the cells to evenly settle to the bottom of the flask. Observe the cell adhesion and transfer to a CO2 incubator.

[0058] (4) After the EEC density has expanded to 90%, digest, centrifuge and resuspend the cells in fresh complete medium for subsequent identification.

[0059] Under a 100x optical microscope, cells were observed to grow attached to the wall, in a spindle-shaped, cobblestone-like shape, with no obvious boundaries and parallel distribution, which is consistent with the morphological characteristics of EEC. The second generation of EEC was taken, and the EEC cell surface marker cytokeratin (PCK) was identified by immunofluorescence (IF) technology, and the PCK positive rate of EEC was verified. The PCK positive rate of EEC cells was >90%, indicating that EEC was successfully cultured in vitro.

[0060] 2. EECD Model Construction

[0061] The EECD model was constructed under oxygen-glucose deprivation (OGD) conditions. Normal EEC culture was carried out according to the cell culture expansion and passage steps mentioned above. After two passages, when the cell state was stable and the cell density reached 80% to 90%, the low-glucose basal medium with 1% penicillin-streptomycin double antibody was replaced, and the well plate was transferred to a special incubator for hypoxic conditions of 1% O2, 94% N2, and 5% CO2. For the well plate with EEC, OGD conditions were set to culture for 4 hours (the expression of hypoxia-related proteins VEGFA and αvβ3 was significantly upregulated, and the expression of epithelial cell marker protein E-cadherin was significantly reduced). After 4 hours, normal oxygen and high glucose were restored, and subsequent experiments were carried out after 24 hours of continuous culture.

[0062] 3. Extraction of exosomes from EEC and EECD supernatants

[0063] (1) Take the cell culture medium and divide it into sterilized centrifuge bottles or centrifuge tubes. Centrifuge it at 4°C, 1000×g for 10 min to remove the cell culture supernatant, debris and dead cells in the culture medium.

[0064] (2) After centrifugation, the supernatant was filtered through a 0.2 mm filter and dispensed into sterilized centrifuge bottles;

[0065] (3) The supernatant culture medium was centrifuged at 4°C, 100,000 × g for 3 h;

[0066] (4) Discard the supernatant, add 10 mL of pre-cooled 1× PBS, and wash the precipitate in an ultracentrifuge at 100,000×g for 90 min at 4°C;

[0067] (5) The supernatant was discarded, and the exosome-containing pellet at the bottom of the tube was resuspended with 50 μL of pre-cooled 1× PBS, transferred to a 1.5 ml EP tube, and BCA quantification was performed and stored at -80°C for later use. Transmission electron microscopy (TEM) observation showed that the exosome morphology was a biconcave double-layered disc-like structure. Nanoparticle tracking analysis (NTA) technology analysis showed that the exosome diameter was 30-200 nm and indicated high purity. WB identification showed significantly high expression of CD81 and CD63 exosome marker proteins, confirming that the exosomes in the supernatant of EEC and EECD were successfully extracted.

[0068] IV. HucMSC Cell Culture

[0069] HucMSCs were purchased from Shanghai Saibaikang Biotechnology (primary HucMSCs, catalog number: HUM-iCell-e009) and cultured in a CO2 incubator at 37°C for cell expansion and passage using Gibco's α-MEM basal medium, FBS Australian fetal bovine serum, 0.25% trypsin, and 100× penicillin-streptomycin double antibody-matched culture medium system and cell digestion system. HucMSCs of the 4th to 6th generations of culture were collected, and after the cell density was expanded to 90%, the cells were digested, centrifuged, and resuspended in fresh complete culture medium for subsequent experiments.

[0070] 5. Co-culture of EEC exosomes (EEC-ex) and EECD exosomes (EECD-ex) with HucMSCs to detect cell proliferation

[0071] 1. CCK8 experiment

[0072] Before preparing the cell suspension, EEC and EECD exosomes were added to HucMSC at 2 μg / well, respectively. No exosomes were added to the control group. After the exosomes were co-cultured with HucMSC for 24 h, 48 h, and 72 h, the cells were digested to prepare the cell suspension;

[0073] Prepare CCK8 solution by adding 10 μL CCK8 stock solution + 100 μL serum-free basal medium to each well. Keep CCK8 experiments away from light. Aspirate the medium in the 96-well plate, add the CCK8 reagent prepared in the step to the plate, transfer the plate to a 37°C cell culture incubator, and incubate for 1.5 hours to allow the CCK8 reagent to fully combine with the proliferating cells.

[0074] 95 μL of the CCK8 supernatant after incubation of cells in each experimental group in the previous step was aspirated and transferred to a new 96-well plate, and the prepared CCK8 working solution was also aspirated and transferred to a new 96-well plate as a blank control. Finally, the absorbance value of the new 96-well plate was read at 450nm using an ELISA reader. The data of cells at 0h, 24h, 48h and 72h were collected, and the differences in cell proliferation activity were statistically analyzed using Graphpad Prism 7.0.0 (abscissa: time; ordinate: absorbance value OD).

[0075] 2. EdU experiment

[0076] Before preparing the cell suspension, EEC and EECD exosomes were added to HucMSC at 2 μg / well, respectively. No exosomes were added to the control group. After co-culture of exosomes and HucMSC for 72 h and 96 h, the exosomes were cultured according to BevotCLick TM EdU detection was performed using the EdU-594 cell proliferation detection kit.

[0077] 6. Co-culture of EEC exosomes (EEC-ex) and EECD exosomes (EECD-ex) with HucMSCs to detect cell migration

[0078] 1. Transwell

[0079] (1) Before preparing the cell suspension, EEC and EECD exosomes were added to HucMSC at 2 μg / well, respectively. No exosomes were added to the control group. After the exosomes were co-cultured with HucMSC for 12 h and 24 h, the cells were digested to prepare the cell suspension;

[0080] (2) Digest the cells, centrifuge and discard the culture medium after digestion, wash 1-2 times with PBS, and resuspend in serum-free medium containing BSA. Adjust the cell density to 5×10 5 cells / ml;

[0081] (3) Take 100 μl of the cell suspension and add it into the Transwell chamber.

[0082] (4) Add 600 μl of culture medium containing 20% ​​FBS to the lower chamber of the 24-well plate.

[0083] (5) Conventional culture, observing the differences in migration ability of HucMSC cells treated in different groups at different time points (12h, 24h).

[0084] 2. Wound healing cell scratch test

[0085] (1) Before preparing the cell suspension, EEC exosomes and EECD exosomes were added to HucMSCs at 2 μg / well, and the cells were plated in a 6-well plate. No exosomes were added to the control group. Exosomes were co-cultured with HucMSCs for 12 h and 24 h.

[0086] (2) After co-culture, use a sterile yellow pipette tip to vertically draw a line along the center of the well plate at the end in contact with the pipette to create a fracture zone in the cells.

[0087] (3) Observe cell migration. Take photos of the scratch site every 12 hours and record the distance of the scratch zone in each group at each time point. Stop observation after the cell scratch zone is closed and perform statistical analysis.

[0088] 7. RT-qPCR detection of differential expression of miR-1303 and miR-4521 in EECD-ex+HucMSC group, EEC-ex+HucMSC group and HucMSC group

[0089] TRIzol Reagent was used to extract total RNA from the three groups of cell samples, and reverse transcription was used to synthesize cDNA. Reverse transcription was performed using Invitrogen's reverse transcription kit Superscript III. Real-time fluorescence quantitative Real time PCR was used to detect the expression of miR-1303 and miR-4521.

[0090] The miRNA sequences of miR-1303 and miR-4521 involved in this application are as follows:

[0091] miR-1303: UUUAGAGACGGGGUCUUGCUCU, SEQ ID NO:7;

[0092] miR-4521:GCUAAGGAAGUCCUGUGCUCAG, SEQ ID NO:8.

[0093] Among them, the reaction system (Table 1), reaction conditions (Table 2) and primers (Table 3) of Real time PCR detection.

[0094] Table 1 Real time PCR reaction system

[0095]

[0096] Table 2 Reaction conditions

[0097]

[0098] Table 3 Primers

[0099] Gene sequence miR-1303-F ATGTGCGTTTAGAGACGGGGTC, SEQ ID NO:1 miR-1303-R ATCCAGTGCAGGGTCCGAGG, SEQ ID NO:2 miR-4521-F AAGTCGCGCTAAGGAAGTCCTG, SEQ ID NO:3 miR-4521-R ATCCAGTGCAGGGTCCGAGG, SEQ ID NO:4

[0100] Example 1 Effect of exosomes secreted by EECD on HucMSC

[0101] Experimental groups: HucMSC group; EEC-ex+HucMSC group; EECD-ex+HucMSC group.

[0102] Among them, the EEC-ex+HucMSC group represents the co-culture of EEC-ex and HucMSC; the EECD-ex+HucMSC group represents the co-culture of EECD-ex and HucMSC.

[0103] 1. Stem Cell Proliferation

[0104] 1. CCK-8 experiment, the results are as follows Figure 1As shown, compared with HucMSC, the proliferation activity of the EECD-ex+HucMSC group was significantly increased, which was dependent on the co-culture time (24h, 48h, 72h), that is, as the co-culture time increased, the effect of EECD-ex in promoting HucMSC proliferation was more obvious; there was no significant difference between the HucMSC group and the EEC-ex+HucMSC group.

[0105] 2. EdU experiment, the results are as follows Figure 2 As shown, compared with the HucMSC group, the proportion of proliferating cells in the EECD-ex+HucMSC group was significantly increased, which was dependent on the co-culture time (72h, 96h), that is, as the co-culture time prolonged, the effect of EECD-ex in promoting HucMSC proliferation was more obvious; there was no significant difference between the HucMSC group and the EEC-ex+HucMSC group.

[0106] 2. Stem Cell Migration

[0107] 1. Transwell experiment, the results are as follows Figure 3 As shown, compared with the HucMSC group, the cell migration activity of the EECD-ex+HucMSC group was significantly increased, which was dependent on the co-culture time (12h, 24h), that is, as the co-culture time prolonged, the effect of EECD-ex in promoting HucMSC migration was more obvious; there was no significant difference between the HucMSC group and the EEC-ex+HucMSC group.

[0108] 2. Wound Healing scratch test, the results are as follows Figure 4 As shown, compared with the HucMSC group, the EECD-ex+HucMSC group significantly promoted cell migration activity, which was dependent on the co-culture time (12h, 24h), that is, as the co-culture time prolonged, the effect of EECD-ex in promoting HucMSC migration was more obvious; there was no significant difference between the HucMSC group and the EEC-ex+HucMSC group.

[0109] 3. Potential of stem cells to differentiate into EEC

[0110] Western Blot experiment, the results are as follows Figure 5 As shown in the figure, compared with the HucMSC group, the EECD-ex+HucMSC group significantly promoted the high expression of glandular epithelial markers CK19 and CD9, which was co-culture time-dependent (48h, 72h, 96h, 120h), that is, as the co-culture time prolonged, EECD-ex promoted the further high expression of glandular epithelial markers CK19 and CD9 in the HucMSC group; there was no difference between the HucMSC group and the EEC-ex+HucMSC group; the expression of mesenchymal marker proteins Vimentin and CD13 gradually decreased, which was also time-dependent. This shows that EECD-ex promotes the differentiation and development of HucMSC into EEC.

[0111] IV. RT-qPCR detection

[0112] RT-qPCR was used to detect the expression of miR-1303 and miR-4521 in the HucMSC group, EEC-ex+HucMSC group, and EECD-ex+HucMSC group.

[0113] The results are as follows Figure 6 As shown, compared with the HucMSC group, the transcriptional expression of miR-1303 and miR-4521 in the EECD-ex+HucMSC group was significantly reduced, indicating that EECD-ex inhibited the transcriptional expression of miR-1303 and miR-4521.

[0114] In summary, EECD-ex inhibited the transcriptional expression of miR-1303 and miR-4521, promoted the proliferation of HucMSC stem cells, activated the migration function and the potential for differentiation into EEC.

[0115] Example 2

[0116] Experimental groups: HucMSC-NC inhibitor; HucMSC-miR-1303inhibitor; HucMSC-miR-4521inhibitor.

[0117] miR-1303inhibitor: AGAGCAAGACCCCGTCTCTAAA, SEQ ID NO: 5;

[0118] miR-4521inhibitor: CTGAGCACAGGACTTCCTTAGC, SEQ ID NO: 6.

[0119] 1. Stem Cell Proliferation

[0120] The miR-1303inhibitor lentivirus and miR-4521inhibitor lentivirus (synthesized by GeneCare Gene Corporation) were synthesized and used to infect HucMSC cells, respectively. The control group was infected with NC inhibitor lentivirus. Proliferation experiments were performed 24h, 48h, and 72h after transfection.

[0121] 1. CCK-8 experiment, the results are as follows Figure 7 As shown, compared with the NC inhibitor+HucMSC transfection group, the cell proliferation activity of the miR-1303inhibitor+HucMSC transfection group and the miR-4521inhibitor+HucMSC transfection group was significantly increased, which was dependent on the transfection time (24h, 48h, 72h).

[0122] 2. EdU experiment, the results are as follows Figure 8 As shown, compared with the NC inhibitor+HucMSC transfection group, the cell proliferation ratio of the miR-1303inhibitor+HucMSC transfection group and the miR-4521inhibitor+HucMSC transfection group was significantly increased, which was dependent on the transfection time (72h and 96h).

[0123] 2. Stem Cell Migration

[0124] The miR-1303inhibitor lentivirus and miR-4521inhibitor lentivirus (synthesized by GeneCare Gene Corporation) were synthesized and used to infect HucMSC cells, respectively. The control group was infected with NC inhibitor lentivirus. Transwell migration and scratch assays were performed 12h and 24h after transfection.

[0125] 1. Transwell experiment, the results are as follows Fig. 9 As shown, compared with the NC inhibitor+HucMSC transfection group, the migration activity of the miR-1303inhibitor+HucMSC transfection group and the miR-4521inhibitor+HucMSC transfection group was significantly enhanced, which was dependent on the transfection time (12h and 24h).

[0126] 2. Wound Healing scratch test, the results are as follows Fig.10 As shown, compared with the NC inhibitor+HucMSC transfection group, the cell migration activity of the miR-1303inhibitor+HucMSC transfection group and the miR-4521inhibitor+HucMSC transfection group was significantly enhanced, which was dependent on the transfection time (12h and 24h).

[0127] 3. Potential of stem cells to differentiate into EEC

[0128] The miR-1303inhibitor lentivirus and miR-4521inhibitor lentivirus (synthesized by GeneCare Gene Co., Ltd.) were synthesized and used to infect HucMSC cells, respectively. The control group was infected with miR-NC lentivirus. After 48h, 72h, 96h, and 120h of transfection, the total cell protein was collected, and the expression of EEC (CK19 and CD9) and HucMSC indicators (Vimentin and CD13) was detected by Western Blot (WB).

[0129] Western Blot experiment, the results are as follows Fig.11As shown, compared with the NC inhibitor+HucMSC transfection group, in the miR-1303inhibitor+HucMSC transfection group and the miR-4521inhibitor+HucMSC transfection group, as the time of stem cell transfection with miR-1303inhibitor or miR-4521inhibitor was prolonged (48h, 72h, 96h, 120h): the expression of mesenchymal marker proteins Vimentin and CD13 gradually decreased, and the expression of glandular epithelial marker proteins CK19 and CD9 gradually increased.

[0130] The above shows that miR-miR-1303inhibitor and miR-4521inhibitor are potential marker molecules for mobilizing HucMSC activation and differentiation into EEC, which play a certain role in promoting the repair of thin endometrium.

[0131] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0132] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description may be used to interpret the content of the claims.

Claims

1. Use of miR-1303 inhibitors and / or miR-4521 inhibitors in the preparation of products for preventing and / or treating thin endometrium.

2. The use according to claim 1, characterized in that: The type of thin endometrium is a thin endometrium caused by hypoxic damage to endometrial cells.

3. The use according to claim 1, characterized in that: The products include pharmaceuticals; Optionally, the drug comprises an active ingredient and a pharmaceutically acceptable excipient, and the active ingredient comprises a miR-1303 inhibitor and / or a miR-4521 inhibitor.

4. The use according to any one of claims 1 to 3, characterized in that The medicament also includes exosomes secreted by hypoxia-damaged endometrial glandular epithelial cells.

5. Application of miR-1303 inhibitor and / or miR-4521 inhibitor in the preparation of biological preparations for promoting the differentiation of HucMSC into EEC.

6. Use of miR-1303 inhibitor and / or miR-4521 inhibitor in the preparation of biological preparations for promoting HucMSC proliferation and / or migration.

7. The use according to any one of claims 1-3 and 5-6, characterized in that: The miR-1303 inhibitor includes a substance that inhibits the expression or function of miR-1303, and / or the miR-4521 inhibitor includes a substance that inhibits the expression or function of miR-4521; Optionally, the substance comprises siRNA; Optionally, the substance further comprises an expression vector; Optionally, the expression vector comprises a viral vector.

8. The use according to claim 7, characterized in that: The siRNA for inhibiting the expression of miR-1303 is shown in SEQ ID NO:5; and / or, the siRNA for inhibiting the expression of miR-4521 is shown in SEQ ID NO:

6.

9. Use of miR-1303 and / or miR-4521 in screening drugs for preventing and / or treating thin endometrium. Optionally, the drugs can reduce the expression level of miR-1303 and / or miR-4521 in HucMSC cells and / or inhibit the function of miR-1303 and / or miR-4521.

10. Use of a reagent for detecting the expression level of miR-1303 and / or miR-4521 in the preparation of a product for diagnosing thin endometrium; Optionally, the miR-1303 and / or miR-4521 are significantly upregulated in patients with thin endometrium; Optionally, the reagents for detecting the expression levels of miR-1303 and / or miR-4521 include primers; Optionally, the primers for detecting miR-1303 are shown in SEQ ID NO: 1-2; Optionally, the primers for detecting miR-4521 are shown in SEQ ID NO:3-4.

Images