Nucleic acid aptamer specifically combined with FKB and application of nucleic acid aptamer

Abstract

The invention discloses a nucleic acid aptamer specifically combined with FKB and application of the nucleic acid aptamer, and belongs to the technical field of molecular biological medicines. A nucleic acid aptamer FKB-1 specifically combined with FKB is screened through a Capture-SELEX technology, the nucleotide sequence of the nucleic acid aptamer FKB-1 is shown as SEQ ID NO.1, a nucleic acid aptamer FKB-S is obtained by cutting the nucleic acid aptamer FKB-1, and the nucleotide sequence of the nucleic acid aptamer FKB-S is shown as SEQ ID NO.2. Through verification, the combination of the nucleic acid aptamers FKB-1 and FKB-S and the FKB has good affinity and specificity, so that the nucleic acid aptamer FKB-1 or FKB-S can be used as a detection reagent, an enrichment and separation reagent and an attenuation reagent of the small-molecule FKB and is used for detecting, enriching, separating and inhibiting the FKB in products such as FKB-related plant slips, medicines and health-care products; therefore, quality control of FKB related products is realized, and hepatotoxicity caused by FKB is avoided.

Description

Technical Field

[0001] The invention belongs to the field of molecular biomedicine and biological detection technology, and particularly relates to a nucleic acid aptamer specifically binding to FKB and an application thereof. Background Art

[0002] Kava, commonly known as kava, is a perennial shrub medicinal plant of the genus Piper in the family Piperaceae. It originates from the South Pacific islands such as Vanuatu, Fiji, and Tonga. Local residents are accustomed to using its roots or rhizomes to prepare beverages that can relax the body and emotions, restore physical strength, and relieve pain. Among them, beverages prepared by kava are indispensable. As kava, a local plant, is recognized and accepted by the outside world, studies have found that kava has a "refreshing and calming" effect, which is mainly derived from the active ingredient kavalactone in the rhizome of kava. This ingredient has clinical effects such as anti-anxiety and depression, sedation and hypnosis, and local anesthesia. Therefore, in Western countries, in addition to daily drinking and entertainment activities, the drug preparations of this herb are also used to treat anxiety disorders. However, in actual use, people have found that taking kava-related products, in addition to its pharmacological effects, can also cause liver damage and even death. In some patients, the use of certain kava supplements has been shown to induce liver failure, severe acute hepatitis, pancreatic necrosis, hepatic lobular collapse, and hepatocyte apoptosis associated with increased bilirubin. Therefore, many countries, including the United States, Germany, and Canada, have clearly restricted the use of kava as a medicinal plant and its related products and investigated its hepatotoxicity. The results showed that kava rhizomes contain a class of trace flavonoid components, which mainly include structurally similar chalcone compounds flavokavain A (FKA), flavokavain B (FKB), and flavokavain C (FKC), among which FKB is the main toxic component causing liver damage. The hepatotoxicity of FKB is caused by depletion of reduced glutathione GSH, induction of oxidative stress, inhibition of IKK activity, resulting in NF-κB transcription blockade, and activation of the mitogen-activated protein kinase (MAPK) signaling pathway. Since kava-related medicinal products still have advantages when used to treat depression, menopause, insomnia, convulsions and other related diseases, such as the lack of addiction, hallucinations and other common side effects brought by general anti-anxiety drugs, the detection, enrichment, separation and inhibition of FKB, a hepatotoxic component in kava and its related products, plays a vital role in determining the quality of the medicinal plant kava, whether it can be used for medicinal purposes or export, and the safe use of kava-related products.

[0003] Aptamers are a nucleotide sequence selected from artificial ssDNA or RNA libraries by exponential enrichment (Systematic Evolution of Ligands by EXponential enrichment, SELEX for short), and can be applied to a variety of targets, including metal ions, proteins, viruses, bacteria, toxins, cells, etc. Aptamers fold to form a variety of specific spatial structures, including stem-loop, hairpin, pseudoknot, G-quadruplex structure, etc., through intramolecular interactions (such as hydrogen bonds, base complementary pairing), and then through hydrogen bonds, electrostatic effects, van der Waals forces, base stacking, etc., to form a "binding pocket" to wrap the target molecule and produce specific binding with the target molecule. Since aptamers can produce a binding with the target similar to that of antigens and antibodies and have similar functions to antibodies, they are also called chemical antibodies. They have the advantages of small physical size, low immunogenicity, flexible structure, low production cost, easy synthesis and modification, good water solubility and thermal stability, and convenient storage and transportation. They are often used as an effective targeting tool that is different from small molecule inhibitors and have good application prospects in the field of biomedicine.

[0004] The main steps of SELEX screening of nucleic acid aptamers include: library or target fixation, target elution, non-binding library separation, amplification of binding aptamers and single-stranded preparation, etc. Based on these steps, a variety of SELEX screening technologies have been derived, such as affinity chromatography SELEX, capillary electrophoresis SELEX, magnetic bead SELEX, graphene oxide SELEX, nanocolloidal gold SELEX, Cell-SELEX, Capture-SELEX, etc. Among them, Capture-SELEX is a screening technology that fixes nucleotide libraries and is suitable for small molecule targets. It can reduce the difficulty of screening caused by insufficient binding sites for small molecule targets. This method is simple to operate, has low equipment requirements, can be carried out in the laboratory, and can greatly improve the screening success rate of small molecule target nucleic acid aptamers.

[0005] However, so far, no nucleic acid aptamer targeting FKB has been screened. Summary of the invention

[0006] The purpose of the present invention is to solve the problems existing in the prior art and provide a nucleic acid aptamer that specifically binds to FKB and its application, including as a component of a FKB detection kit in kava-related products and the preparation of a biosensor. In addition, the nucleic acid aptamer can also be used for the enrichment, separation, inhibition of FKB in kava-related products and basic research related to FKB hepatotoxicity.

[0007] The technical solution of the present invention is: a nucleic acid aptamer that specifically binds to FKB, including nucleic acid aptamer FKB-1, and the nucleotide sequence of FKB-1 is shown in SEQ ID NO.1.

[0008] Furthermore, any of the following sequences is included:

[0009] 1) The homology with nucleic acid aptamer FKB-1 is more than 80%

[0010] 2) Hybridization with the nucleotide sequence of nucleic acid aptamer FKB-1

[0011] 3) RNA sequence reverse transcribed from the nucleotide sequence of nucleic acid aptamer FKB-1.

[0012] Furthermore, it includes a nucleotide sequence obtained by truncating the nucleotide sequence of the nucleic acid aptamer FKB-1 or replacing the base; the nucleotide sequence obtained by truncating the nucleotide sequence of the nucleic acid aptamer FKB-1 includes the nucleic acid aptamer FKB-S, and the nucleotide sequence of FKB-S is shown in SEQ ID NO.2.

[0013] Furthermore, the nucleotide sequence is obtained by labeling the 5' end or 3' end of the nucleic acid aptamer with a label. Preferably, the label is a biotin label, a digoxigenin label, a fluorescent label, a nanoluminescent material label or an enzyme label.

[0014] The use of the above-mentioned nucleic acid aptamer that specifically binds to FKB in the preparation of a reagent for enriching FKB.

[0015] The use of the above-mentioned nucleic acid aptamer that specifically binds to FKB in the preparation and separation of FKB reagents.

[0016] A detection reagent, a test paper or a biosensor for FKB, wherein the effective component of the detection reagent, the test paper or the component of the biosensor comprises the above-mentioned nucleic acid aptamer that specifically binds to FKB.

[0017] A drug for reducing the toxicity of FKB, wherein the active ingredient of the drug comprises the above-mentioned nucleic acid aptamer that specifically binds to FKB.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] 1. This application uses the Capture-SELEX technology to screen out the nucleic acid aptamer FKB-1 for the first time. It has been verified that FKB-1 can specifically bind to FKB, and further identification shows that FKB-1 can significantly distinguish six similar small molecules FKA, FKC, hesperidin, hyperoside, aloe-emodin, and quercetin. The nucleic acid aptamer FKB-1 has a strong specific binding ability to FKB;

[0020] 2. K of the aptamer FKB-1 and FKB D The value is 1.45 μM, which shows a strong affinity for the target FKB. Therefore, the nucleic acid aptamer FKB-1 can be used for the enrichment, separation, inhibition of FKB in kava-related products and basic research related to FKB hepatotoxicity.

[0021] 3. The present application found that not only the nucleic acid aptamer FKB-1 showed strong specificity and affinity for the target FKB, but also the truncated aptamer FKB-S of the nucleic acid aptamer FKB-1 also showed strong specificity and affinity for the target FKB, which could significantly distinguish FKA, FKC, hyperoside, hesperidin, and K D The value is 280nM, which can be used as a molecular recognition element for the construction of FKB detection methods, sensors, etc.

[0022] 4. The nucleic acid aptamer FKB-1 disclosed in the present application can simply, rapidly and sensitively identify and bind to FKB, and is suitable for the quality control of the medicinal plant kava and its related beverages and medicines, and the enrichment, separation and inhibition of FKB hepatotoxicity in these products. It is of great significance to the safe application of the medicinal plant kava and its related products. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The statistical results of the elution rate of FKB nucleic acid aptamers in each round of screening;

[0024] Figure 2 The gel electrophoresis results of the 6th, 19th, 24th, and 27th rounds of eluate during the FKB aptamer screening process;

[0025] Figure 3 The affinity characterization results of the gel elution experiment of the 5th round of FKB aptamer screening library;

[0026] Figure 4 The affinity characterization results of the gel elution experiment of the 19th round of FKB aptamer screening library;

[0027] Figure 5 The specificity characterization results of the gel elution experiment of the 19th round of FKB aptamer screening library;

[0028] Figure 6 The specificity characterization results of the gel elution experiment of the 27th round of FKB aptamer screening library;

[0029] Figure 7 The results of affinity characterization of FKB nucleic acid aptamer candidate sequence FKB-1 gel elution experiment;

[0030] Figure 8 The specific characterization results of the gel elution experiment of the FKB nucleic acid aptamer candidate sequence FKB-1;

[0031] Fig. 9 To verify the affinity results of nucleic acid aptamer FKB-1 using microscale thermophoresis (MST) technology;

[0032] Fig.10 Schematic diagram of the secondary structure simulation of nucleic acid aptamers FKB-1 and FKB-S;

[0033] Fig.11 The affinity results of the tailored sequence FKB-S of the nucleic acid aptamer FKB-1 were characterized by MST technology;

[0034] Fig.12 The MST technology was used to characterize the specific results of the nucleic acid aptamer FKB-1 cutting sequence FKB-S. DETAILED DESCRIPTION

[0035] The technical solution of the present invention is further described below in conjunction with the accompanying drawings, but is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention should be included in the protection scope of the present invention.

[0036] Example 1: Screening and preparation of nucleic acid aptamers specifically binding to FKB

[0037] (1) Construction of initial single-stranded nucleic acid library:

[0038] The nucleotide sequence of the initial single-stranded nucleic acid library is shown in SEQ ID NO.3: 5'-CGAGCATAGGCAGAACTTACGAC(30n)GTCGTAAGAGCGAGTCATTC-3', wherein n represents any base among A, T, C and G.

[0039] Biotin-labeled cDNA: The nucleotide sequence of cDNA-biotin is shown in SEQ ID NO.4: 5'-TTTTTGTCGTAAGTTCTGCCATTTT-biotin-3'

[0040] The forward primer is referred to as FP, and its nucleotide sequence is shown in SEQ ID NO.5: 5'-CGAGCATAGGCAGAACTTAC-3';

[0041] The biotin-labeled reverse primer is Bio-RP, and its nucleotide sequence is as shown in SEQ ID NO.6: 5'-Biotin-GAATGACTCGCTCTTACGAC-3';

[0042] The above sequences were purchased from Shanghai Sangon Biotechnology Co., Ltd.

[0043] (2) Preparation of experimental solutions

[0044] 5×SELEX Buffer: 50mM Tris-HCl pH7.4, 100mM NaCl, 2.5mM MgCl2. Weigh NaCl and MgCl2 and prepare 2M and 50mM solutions respectively with DEPC water. Add 2mL of 1M Tris-HCl solution at pH7.4, 2mL of 2M and 50mM NaCl and MgCl2 solutions in a 50mL centrifuge tube, and finally add DEPC water to 40mL. Store in a 4℃ refrigerator for later use. 1×SELEX Buffer is diluted from 5×SELEX Buffer.

[0045] 5×MST Buffer: 50mM Tris-HCl pH7.4, 100mM NaCl, 2.5mM MgCl2, 25% DMSO, 0.25% Tween-20. Add 10mL pure DMSO solution, 2mL 1M Tris-HCl solution at pH7.4, 2mL 2M and 50mM NaCl, MgCl2 in a 50mL centrifuge tube. 2 Solution, 2mL 5% Tween-20 solution, and finally add DEPC water to make up to 40mL, and store in a 4℃ refrigerator for later use. 1×MST Buffer is diluted from 5×MST Buffer.

[0046] 5×Mg-free 2+ Buffer: Add 4 mL 1M NaCl and 2 mL 1M Tris-HCl (pH 7.4) to a 50 mL centrifuge tube, add DEPC water to 40 mL, and store in a 4°C refrigerator for later use. 1× Mg-free 2+ Made of 5× Mg-free 2+ Diluted.

[0047] 98% formide solution containing 10 mM EDTA: Take 20 μL of 0.5 M EDTA solution, add it to 980 μL of pure formide solution, mix well, and store in a 4°C refrigerator for later use.

[0048] 0.5×TEB Rounding Buffer: Add 200 mL of 5×TBE Buffer to 1.8 L of double distilled water, mix well, and store at room temperature.

[0049] Preparation of positive and negative screening target solutions: The positive screening target FKB, negative screening targets FKA, FKC, hesperidin, hyperoside, aloe-emodin, quercetin, etc. used in the experiment were dissolved in DMSO, and 5×SELEX Buffer was added to prepare a solution containing 1×SELEX Buffer when used.

[0050] Preparation of single-stranded library and primer solution: The initial dry powdered nucleic acid library and primers were centrifuged at room temperature using a small centrifuge, dissolved and mixed with enzyme-free water according to a final concentration of 100 μM, and stored in a -20°C refrigerator for later use.

[0051] (3) Immobilization of nucleic acid library

[0052] Add 50 μL 5×SELEX Buffer to the 250 μL system, add the library and the capture chain cDNA-Bio, the molar ratio of which is 1:5, add DEPC water to 250 μL and mix well, anneal at 95°C for 10 minutes and then slowly cool to room temperature to allow the library and the capture cDNA-Bio to hybridize to form a double strand. Label this solution as SM and take 2 μL for gel electrophoresis. Next, add 250 μL of streptavidin agarose microspheres to the microcolumn, let it stand for stratification, and wash it 5 times with 250 μL 1×SELEX Buffer. Repeatedly add the mixed solution SM to the microcolumn 5 times, collect the final eluate, label it as SM-L, and use it to calculate the column binding rate LR (%). Then, 5 mL of 1×SELEX Buffer was used for automatic washing under gravity to remove the nucleic acid chains in the library that were not bound to the microspheres. After completion, 250 μL of 1×SELEX Buffer was used for manual washing 5 times, and the last eluate was collected as the background, marked as A.

[0053] (4) Screening of FKB binding sequences

[0054] The prepared FKB solution was added to the microcolumn with the fixed nucleic acid library for elution, 3 times in total, 250 μL each time, and the 3 eluates were collected and marked as E1, E2, and E3, and concentrated to 50-100 μL using an ultrafiltration tube. The concentration of the nucleic acid library contained in the concentrate was determined, and the corresponding amount was calculated and taken for PCR amplification to prepare the nucleic acid library for the next round of screening. In the screening, in order to ensure that the nucleic acid aptamer that specifically binds to FKB is screened, the reverse screening was introduced from the 6th round, and small molecules with similar structures to FKB, such as myricetin, quercetin, aloe-emodin, and isoliquiritigenin, were successively selected as reverse screening targets. Among them, the 3 eluates after adding the reverse screening target were marked as C1, C2, and C3, respectively, and the above-collected solutions and eluates SM, SM-L, A, E1, E2, and E3 were analyzed by gel electrophoresis. As the screening progresses, it is necessary to continuously increase the screening pressure and change the screening conditions, including reducing the library dosage, increasing the counter-screening material concentration, reducing the FKB concentration, etc. The specific screening conditions are shown in Table 1.

[0055] Table 1: Summary of experimental conditions and results of FKB aptamer screening

[0056] (5) Polyacrylamide gel electrophoresis monitoring and screening process

[0057] During the screening process, gel electrophoresis was used to monitor the screening process to determine the library enrichment and the screening endpoint. The solutions and eluents SM, SM-L, A, E1, E2, E3 and C1, C2, C3 collected from each round of screening were added to the denatured DNA Loading Buffer and mixed evenly, and then loaded for gel electrophoresis. The entire electrophoresis process used a 10% mass volume concentration of denatured gel and 0.5×TEB electrophoresis buffer (Rouding Buffer). The specific conditions were to first electrophoresed at 50V for 30 minutes, and then adjust the voltage to 80V and continue electrophoresis for 1 hour. After the electrophoresis is completed, the gel is placed in a light-proof environment and stained with SYBR Gold dye solution for 20 to 30 minutes, and then the image is taken with a developer, the gray value of the band is calculated, and semi-quantitative analysis is performed using the following formula:

[0058] LR(%)=(SM-L / SM)*100%

[0059]

[0060] ER(%)=BN / (Pool Size*LR)*100%

[0061] In the formula, LR (Ligation Ratio) is the column binding rate of the total library fixed on the column, BD (Bound Nucleotides) is the amount of sequence substances that can bind to the target solution after eliminating non-specific elution, E is the gray value of the gel band of the 3 eluates in each round of positive screening, C is the gray value of the gel band of the 3 eluates in each round of reverse screening, A is the gray value of the gel band of the last eluate in the library fixation, ER (Elution Rate) is the ratio of the eluted target enriched sequence to the total library, and Ref (Reference) is the gray value of the library sequence with a known concentration of 20nM. The results are shown in Table 1. Figure 1 , Figure 2 As shown in the figure, as the screening progresses, the screening pressure is continuously increased, so that the library binding to FKB is effectively enriched. Among them, by comparing the results of the 6th and 19th rounds, it is found that the gray value of the bands corresponding to the counter-screening objects (C1-C3) decreases, and the gray value of the bands corresponding to the positive screening targets (E1-E3) increases, indicating that the library binding to FKB is enriched during the screening process; comparing the results of the 24th and 27th rounds, the gray value of the bands corresponding to the counter-screening objects (C1-C3) is close to the gray value of the bands corresponding to the positive screening targets (E1-E3), indicating that the enrichment of the screened library has reached the maximum extent, so the selection is to end the screening at the 27th round.

[0062] (6) PCR amplification

[0063] Take a certain amount of concentrated E1-E3 as template, and prepare a total of 1 mL of mixed solution for PCR amplification. The mixed solution contains 100 μL 10 μM forward primer (FP), 100 μL 10 μM reverse primer (RP-Bio), 100 μL ssDNA template, 200 μL TaqMix DNA polymerase (5U / mL), and 200 μL DEPC water. The prepared 1 mL PCR mixed solution is divided into 10 200 μL PCR tubes, each tube has a volume of 100 μL, and the PCR reaction conditions are set as follows: initial denaturation is 95°C, 2 min, denaturation (95°C, 15 s), annealing (58°C, 30 s), extension (72°C, 45 s), final extension (72°C, 5 min), and a total of 11 to 15 rounds of PCR amplification.

[0064] (7) Separation and recovery of amplification products

[0065] Add 250 μL of streptavidin agarose microspheres to the microcolumn, let it stand, and then add 250 μL of 1× Mg-free 2+ Buffer was used for washing 5 times until the solution environment was balanced; the nucleic acid library obtained after the previous round of amplification was added, and the separated liquid was added to the microcolumn again, and repeated 4 times; then 250 μL 1× Mg-free 2+Buffer was used to wash the microcolumn 5 times to remove interfering substances such as PCR reaction buffer, unused dNTPs, primers, etc.; 300 μL of 0.2 M NaOH was added, incubated for 10 min, the eluate was collected, and 100 μL of 0.2 M NaOH was added to collect the residual ssDNA in the microcolumn; the pH was adjusted to neutral with dilute HCl. The collected eluate was concentrated to 80-100 μL using an ultrafiltration tube. The ssDNA concentration (ng / μL) obtained after PCR concentration was measured using a NanoDrop-100 spectrophotometer as the nucleic acid library for the next round of screening, and stored in a -20°C refrigerator for later use.

[0066] (8) Affinity and specificity determination of secondary library

[0067] The affinity level of the secondary library was characterized by using a gel elution experiment. Specifically, 50 pmol of the nucleic acid library of this round was mixed with 250 pmol of cDNA-Bio in 125 μL of a system containing 1×SELEX Buffer, denatured at 95°C for 10 min, and then annealed at room temperature for 20 min to allow the nucleic acid library and cDNA-Bio to hybridize to form a double-stranded complex. Next, add 125 μL of streptavidin agarose microspheres to the microcolumn, wash 5 times with 250 μL of 1×SELEX Buffer, transfer to a 1.5 mL EP tube, and let stand to remove excess buffer outside the agarose microspheres; add the library and cDNA-Bio complex solution to the agarose microspheres and incubate for 30 minutes. After incubation, incubate with 625 μL of 1×SELEX Buffer for 5 minutes each time, let stand for 5 minutes, discard the buffer, repeat the operation 5 times, remove the unfixed library, and finally add 625 μL of 1×SELEX Buffer and evenly divide into 7 equal parts. Then add 50μL of FKB solution of different concentrations to each EP tube, incubate at room temperature for 1h, let stand for 15min after incubation, take 40μL of supernatant containing target binding sequence in turn; add 50μL of 98% formide solution containing 10mM EDTA to the remaining conjugate, mix, incubate at 90℃ for 10min, let stand for 15min, and take the supernatant to obtain the sequence fixed on the microsphere that has not been competed by the target. The supernatant after incubation with different concentrations of target and the elution supernatant after 98% formide treatment were sampled separately, analyzed by 10% polyacrylamide gel electrophoresis, and the gray value of the band was calculated. According to the standard concentration of the known chain in the band, the elution percentage was calculated using the following formula:

[0068] θ=(V1*Cs) / (V2*Cs+V3*Cb)*100%

[0069] Where θ is the target eluate fraction, Cs is the concentration of the sequence bound by the target molecule in the supernatant calculated from the gray value of the corresponding band on the gel, Cb is the concentration of the sequence in the 98% Formide eluate calculated from the gray value of the corresponding band on the gel, V1 is the volume of the solution before supernatant collection (estimated to be 62 μL, of which about 8 μL is occupied by streptavidin agarose microspheres), V2 is the collection volume of the supernatant containing the target aptamer (40 μL), and V3 is the volume of the solution after formamide (80 μL) is added. A calibration curve was created by plotting the relationship between the eluted chain fraction and the concentration of the target FKB used. The obtained curve was fitted with the Langmuir equation to obtain the dissociation constant (KD) of the target FKB and the ssDNA library. During the screening process, the 5th and 19th rounds of screening libraries were selected for affinity characterization. In the 5th round, 0, 10, 50, 100, 250, 500, and 1000 μM FKB was used for incubation. As the screening progressed, the amount of counter-screening target gradually decreased, and the amount of FKB gradually decreased. Therefore, 0, 2.5, 5, 10, 20, 40, and 100 μM FKB was used for incubation in the 19th round. The results are shown in Figure 2. Figure 3 and Figure 4 As shown in the figure, compared with the library screened in the fifth round, the affinity of the library screened in the 19th round increased by about 17 times, indicating that the high affinity library binding to FKB was effectively enriched. At the same time, the specificity of the nucleic acid library after the 19th and 27th rounds of screening was also determined during the screening process. Following the same operating steps as the gel elution experiment, 10 μM FKB and FKA, FKC, quercetin, aloe-emodin, hyperoside, and hesperidin were incubated with the nucleic acid library after the 19th and 27th rounds of screening. The results are shown in the figure. Figure 5 and Figure 6 As shown, compared with the 19th round, the specificity of the library screened in the 27th round was significantly improved, and the screened library could clearly distinguish FKB from its more similar structures, FKA and FKC.

[0070] In this example, the Capture-SELEX technology was used to screen nucleic acid aptamer sequences, specifically FKB was used as the positive screening target, and FKA, FKC, hesperidin, hyperoside, aloe-emodin, quercetin, etc. were used as counter-screening targets. After multiple rounds of repeated incubation, elution, and amplification, multiple nucleic acid aptamer sequences were screened. A candidate nucleic acid aptamer sequence FKB-1 was obtained by sequence alignment and homology analysis of these nucleic acid aptamer sequences. FKB-1 was determined to be the optimal sequence through affinity and specificity characterization, and then FKB-1 was trimmed to obtain FKB-S and the affinity and specificity were verified.

[0071] The nucleotide sequence of the candidate nucleic acid aptamer FKB-1 is shown in SEQ ID NO. 1: 5′-CGAGCATAGGCAGAACTTACGACCAAGTGAGGGTGTACGGTGGCTTACG CTTGGTCGTAAGAGCGAGTCATTC-3′;

[0072] The nucleotide sequence of nucleic acid aptamer FKB-S is shown in SEQ ID NO.2:

[0073] 5'-CTTACGACCAAGTGAGGGTGTACGGTGGCTTACGCTTGGTCGTAAG-3';

[0074] The affinity and specificity of the above-screened candidate nucleic acid aptamer FKB-1 and its truncated nucleic acid aptamer FKB-S were characterized: First, the affinity and specificity of FKB and the nucleic acid aptamer candidate sequence FKB-1 were characterized by gel elution experiment, and it was determined that the nucleic acid aptamer candidate sequence FKB-1 had good affinity and specificity for FKB binding, which was used for subsequent research. Then, the MST technology was used to further characterize the binding affinity of the nucleic acid aptamer candidate sequence FKB-1 with FKB.

[0075] Characterization Example 1: Gel elution experiment characterizes the affinity and specificity of the candidate nucleic acid aptamer sequence FKB-1 to FKB

[0076] This characterization example 1 was conducted in accordance with the same experimental method as disclosed in "(8) Affinity and specificity determination of secondary library" in Example 1. After 50 pmol of FKB-1 and 5 times the amount of cDNA were fixed on streptavidin agarose microspheres, they were incubated with 0, 5, 10, 50, 100, 250, and 500 μM concentrations of FKB, respectively. The supernatants after incubation with different concentrations of target and the eluted supernatants after 98% formidide treatment were subjected to 10% polyacrylamide gel electrophoresis analysis, the gray value of the bands was calculated, and the elution percentage was calculated using the following formula based on the standard concentration of the known chain in the bands:

[0077] θ=(V1*Cs) / (V2*Cs+V3*Cb)*100%

[0078] The results are as follows Figure 7 As shown, the equilibrium dissociation constant K of the binding of the candidate nucleic acid aptamer sequence FKB-1 to FKB was obtained. D The affinity of the candidate nucleic acid aptamer FKB-1 to FKB was 2.87 μM.

[0079] For the specific verification of FKB-1 and FKB, after fixing FKB-1 and 5 times the amount of cDNA, 10 μM FKB, FKA, FKC, hesperidin, hyperoside, aloe-emodin, and quercetin were used for incubation, and the elution percentage was calculated in the same way. Figure 8 The results showed that the candidate nucleic acid aptamer sequence FKB-1 could significantly distinguish FKA, FKC, hesperidin, hyperoside, aloe-emodin, and quercetin, and had good selectivity.

[0080] The above results show that the nucleic acid aptamer candidate sequence FKB-1 has good affinity and specificity in binding to FKB, so FKB-1 was selected as the nucleic acid aptamer of FKB.

[0081] Characterization Example 2: MST technology characterization of the affinity and specificity of nucleic acid aptamers FKB-1, FKB-S and FKB

[0082] To further verify the results of the gel elution experiment, the MST molecular interaction technology was used for characterization. Use 1×MSTBuffer to dissolve 200nM Cy5 fluorescent group-labeled FKB-1, heat denature at 95℃ for 10 minutes, and then slowly anneal to room temperature. Use 5×MST Buffer to prepare 20μL 2mM FKB solution containing 1×MST Buffer, and use 1×MST Buffer to gradient dilute to 16 concentrations, each concentration is 10μL, and then mix with the same volume of annealed Cy5 fluorescent group-labeled FKB-1 solution, incubate at room temperature in the dark for 5 minutes, use a capillary to draw 8μL of the mixture and place it in the MST interaction instrument for detection. The same sample was measured three times in a row, and the data was analyzed by MO.Affinity Analysis software, and the dissociation constant was fitted. The results are shown in Fig. 9 As shown, the binding dissociation constant KD of FKB-1 and FKB is 1.45 μM, which is consistent with the results of gel elution experiment.

[0083] In order to further improve the binding ability of nucleic acid aptamer FKB-1 to FKB, Fig.10 As shown in the figure, the aptamer FKB-1 was trimmed to obtain a new aptamer FKB-S. The same experimental method as the aptamer FKB-1 was used to characterize the affinity of the aptamer FKB-S with FKB using MST technology. The selectivity of the aptamer FKB-S with FKB, FKA, FKC, hyperoside, and hesperidin was also characterized using MST technology. The results are shown in the figure. Fig.11 As shown, the binding dissociation constant K of the nucleic acid aptamer FKB-S and FKB D is 280nM, indicating that tailoring increases the affinity of the nucleic acid aptamer FKB-1 by about 5 times; Fig.12 The results of specific characterization shown in the figure indicate that the nucleic acid aptamer FKB-S has a good fit with FKB in MST, but a poor fit with FKA, FKC, Hyperoside and Hesperidin, indicating that FKB-S has a good selectivity for FKB.

[0084] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A nucleic acid aptamer that specifically binds to FKB, characterized in that: It includes nucleic acid aptamer FKB-1, and the nucleotide sequence of FKB-1 is shown as SEQ ID NO.

1.

2. A nucleic acid aptamer that specifically binds to FKB according to claim 1, characterized in that: Also includes any of the following sequences: 1) A nucleotide sequence that has a homology of more than 80% with the nucleic acid aptamer FKB-1 and can specifically bind to FKB; 2) hybridize with the nucleotide sequence of nucleic acid aptamer FKB-1 and can specifically bind to the nucleotide sequence of FKB; 3) RNA sequence reverse transcribed from the nucleotide sequence of nucleic acid aptamer FKB-1.

3. A nucleic acid aptamer that specifically binds to FKB according to claim 1, characterized in that: The invention comprises a nucleotide sequence obtained by subjecting the nucleotide sequence of the nucleic acid aptamer FKB-1 to phosphate backbone modification, truncation, extension, inversion or chemical modification of the base.

4. A nucleic acid aptamer that specifically binds to FKB according to claim 3, characterized in that: The nucleotide sequence obtained by truncating the nucleotide sequence of the nucleic acid aptamer FKB-1 includes the nucleic acid aptamer FKB-S, and the nucleotide sequence of FKB-S is shown in SEQ ID NO.

2.

5. A nucleic acid aptamer that specifically binds to FKB according to any one of claims 1 to 4, characterized in that: It includes a nucleotide sequence obtained by labeling the 5' end or 3' end of the nucleic acid aptamer with a label.

6. A nucleic acid aptamer that specifically binds to FKB according to claim 5, characterized in that: The marker refers to a biotin marker, a digoxigenin marker, a fluorescent marker, a nanoluminescent material marker or an enzyme marker. 7 . Use of a nucleic acid aptamer that specifically binds to FKB according to any one of claims 1 to 4 in the preparation of a reagent for enriching FKB.

8. Use of a nucleic acid aptamer that specifically binds to FKB according to any one of claims 1 to 4 in the preparation and separation of FKB reagents.

9. A detection reagent, test paper or biosensor for FKB, characterized in that: The detection reagent, the effective component of the test paper or the component of the biosensor comprises the nucleic acid aptamer specifically binding to FKB according to any one of claims 1 to 4.

10. A drug for reducing the toxicity of FKB, characterized in that: The active ingredient of the drug includes a nucleic acid aptamer specifically binding to FKB according to any one of claims 1 to 4.

Images