Gene LNC013800 for regulating and controlling growth and proliferation of sheep myoblasts and application of gene LNC013800

Abstract

The invention provides a gene LNC013800 for regulating and controlling proliferation of sheep myoblasts and application of the gene LNC013800, and belongs to the technical field of functional genes. The invention discloses a gene LNC013800 for regulating and controlling proliferation of sheep myoblasts. The nucleotide sequence of the gene LNC013800 is shown as SEQ ID NO: 1. The gene LNC013800 is differentially expressed in transcriptomes of small tailed han sheep and Sunitt sheep in the same growth period, and the gene LNC013800 positively regulates and influences expression of growth factors in myoblasts and activity and cell proliferation performance of sheep myoblasts. Therefore, overexpression of the gene LNC013800 provided by the invention can inhibit growth and proliferation of the sheep myoblasts, and the gene LNC013800 can be used as a regulatory element for regulating the sheep myoblasts, so that a new way is provided for molecular breeding of sheep.

Description

Technical Field

[0001] The invention belongs to the technical field of functional genes, and in particular relates to a gene LNC_013800 for regulating the growth of sheep myoblasts and an application thereof. Background Art

[0002] In recent years, long noncoding RNA (lncRNA) has gradually become a research hotspot. Studies have shown that lncRNA plays a complex and precise regulatory function in animal muscle development. For example, lncYYW promotes bovine myoblast proliferation by upregulating growth hormone 1 (GH1), and lncRNA11007 promotes myoblast proliferation. At a more refined transcriptional level, lncRNA can also participate in skeletal muscle development as an important regulatory molecule. For example, lnc-RAW directly binds to MyoD as a regulatory element, promoting the assembly of the MyoD-Baf60c-Brag1 complex on the regulatory element of the target gene. The complex causes chromatin remodeling, upregulates the expression of myogenic differentiation genes, and then promotes myoblast differentiation and affects muscle tissue development. However, there are currently few reports on lncRNAs that regulate the growth and proliferation of sheep myoblasts. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide a gene LNC_013800 for regulating the growth of myoblasts. Overexpression of LNC_013800 can promote the expression of growth factors in myoblasts and improve cell activity and proliferation performance. Inhibition of LNC_013800 expression can inhibit the expression of growth factors in myoblasts and reduce cell activity and proliferation performance.

[0004] The present invention provides a gene LNC_013800 for regulating the proliferation of sheep myoblasts. The nucleotide sequence of the gene LNC_013800 is shown in SEQ ID NO:1.

[0005] The present invention provides a gene-derived product comprising the gene LNC_013800, including a recombinant vector comprising the gene LNC_013800 or a recombinant virus comprising the gene LNC_013800.

[0006] The invention provides application of the gene LNC_013800 or a product derived from the gene in regulating sheep muscle development.

[0007] The invention provides application of the gene LNC_013800 or a product derived from the gene in promoting proliferation of sheep myoblasts.

[0008] The present invention provides an application of a reagent for regulating the expression of the gene LNC_013800 in the preparation of a product for influencing the proliferation of sheep myoblasts.

[0009] Preferably, the reagent comprises an overexpression recombinant vector containing the gene LNC_013800 or a recombinant vector interfering with the expression of the gene LNC_013800.

[0010] Preferably, the recombinant vector for interfering with the expression of gene LNC_013800 comprises siRNA having a nucleotide sequence as shown in SEQ ID NO:10.

[0011] Preferably, the recombinant vector interfering with the expression of gene LNC_013800 is used in the preparation of a product for inhibiting the proliferation of sheep myoblasts.

[0012] Preferably, the backbone vector of the overexpression recombinant vector containing gene LNC_013800 includes pcDNA3.1.

[0013] The invention provides a method for promoting the growth and / or proliferation of sheep myoblasts, and the gene LNC_013800 or a product derived from the gene is introduced into the sheep myoblasts.

[0014] The present invention provides a gene LNC_013800 for regulating the growth and proliferation of sheep myoblasts, and the nucleotide sequence of the gene LNC_013800 is shown in SEQ ID NO: 1. The present invention performs transcriptome sequencing on small-tailed Han sheep and Sunite sheep in the same growth period, analyzes differentially expressed genes, obtains gene LNC_013800, verifies transcriptome data by RT-qPCR, and the results show that the verification result is consistent with the transcriptome data result. The present invention analyzes the effect of the expression of growth factors (CDK4 and CCND1) in sheep myoblasts by overexpressing gene LNC_013800 and inhibiting gene LNC_013800, and the results show that overexpressing gene LNC_013800 promotes the expression of growth factors in sheep myoblasts, and inhibiting the expression of gene LNC_013800 will inhibit the expression of growth factors in sheep myoblasts, indicating that gene LNC_013800 affects the expression of growth factors in myoblasts through positive regulation. At the same time, the present invention also carried out the effects of overexpression gene LNC_013800 and inhibition gene LNC_013800 expression on myoblast growth and proliferation. The results showed that overexpression of LNC_013800 can increase the activity of sheep myoblasts and promote cell proliferation, whereas inhibition of LNC_013800 expression can reduce the activity of sheep myoblasts and inhibit cell proliferation. It can be seen that the gene LNC_013800 provided by the present invention can promote the growth and proliferation of sheep myoblasts through positive regulation, and can be used as a regulatory element for regulating sheep myoblasts, providing a new means for sheep molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 To validate transcriptome sequencing results for RT-qPCR;

[0016] Figure 2 The results of RT-qPCR detection of the effects of LNC_013800 overexpression and interference expression on growth factors in sheep myoblasts;

[0017] Figure 3 Western blotting was used to detect the effects of LNC_013800 overexpression and interference expression on growth factors in sheep myoblasts;

[0018] Figure 4 The results of myoblast activity after inhibition of LNC_013800 were detected by CCK-8;

[0019] Figure 5 The results of CCK-8 detection of myoblast activity after overexpression of LNC_013800;

[0020] Figure 6The results of using EdU cell proliferation detection kit to detect the effect of overexpression or interference expression of LNC_013800 on the proliferation of sheep myoblasts. DETAILED DESCRIPTION

[0021] The present invention provides a gene LNC_013800 for regulating the growth and proliferation of sheep myoblasts. The nucleotide sequence of the gene LNC_013800 is shown in SEQ ID NO:1().

[0022] In the present invention, the gene LNC_013800 is differentially expressed in different breeds of sheep, and the results of the present embodiment show that the gene LNC_013800 is differentially expressed in Sunite sheep and small-tailed Han sheep. The present invention uses RT-qPCR verification, and the results show that the gene LNC_013800 is highly expressed in Sunite sheep relative to small-tailed Han sheep, which is completely consistent with the transcriptome sequencing results.

[0023] In the present invention, in order to clarify the relationship between the gene LNC_013800 and the proliferation of sheep myoblasts, the present invention explores the effect on the growth of myoblasts by overexpressing the gene LNC_013800 and inhibiting the gene LNC_013800 in sheep myoblasts. The growth factor is shown to be positively correlated with the expression level of the gene LNC_013800 at both the gene and protein levels. At the same time, the results of the activity and proliferation experiments of myoblasts also show that the activity and proliferation ability of myoblasts are positively correlated with the expression level of the gene LNC_013800. Therefore, when the gene LNC_013800 is overexpressed, it is beneficial to promote the proliferation of myoblasts. Therefore, the gene LNC_013800 can be used to cultivate new breeds of meat-type sheep.

[0024] The present invention also provides a gene-derived product comprising the gene LNC_013800, including a recombinant vector comprising the gene LNC_013800 or a recombinant virus comprising the gene LNC_013800.

[0025] In the present invention, the gene derivative product containing gene LNC_013800 preferably includes an overexpression recombinant vector of gene LNC_013800, and may also include an agent that promotes the expression of gene LNC_013800. The present invention has no special restrictions on the type of backbone vector of the overexpression recombinant vector of gene LNC_013800, and can use an overexpression vector commonly used in mammalian cells known in the art, such as pcDNA3.1(+) vector. The agent that promotes the expression of gene LNC_013800 preferably includes gene elements such as promoters and enhancers.

[0026] The present invention provides application of the gene LNC_013800 or a gene derivative product thereof in regulating sheep muscle development.

[0027] In the present invention, the method for regulating sheep muscle development preferably overexpresses the gene LNC_013800 in sheep cells in a heritable manner, thereby positively regulating and promoting the proliferation of sheep myoblasts.

[0028] In view of the fact that the gene LNC_013800 has the property of positively regulating the proliferation of sheep muscle cells, the present invention provides the use of the gene LNC_013800 or a product derived from the gene in promoting the proliferation of sheep myoblasts.

[0029] The present invention provides an application of a reagent for regulating the expression of the gene LNC_013800 in the preparation of a product for influencing the proliferation of sheep myoblasts.

[0030] In the present invention, the reagent preferably includes an overexpression recombinant vector containing gene LNC_013800 or a recombinant vector interfering with the expression of gene LNC_013800. The recombinant vector interfering with the expression of gene LNC_013800 contains siRNA with a nucleotide sequence as shown in SEQ ID NO: 10. The overexpression recombinant vector containing gene LNC_013800 can promote the up-regulation of growth factor in myoblasts through positive regulation, thereby promoting the proliferation of myoblasts. The recombinant vector interfering with the expression of gene LNC_003296 inhibits the expression of gene LNC_003296 through siRNA, downregulates the expression of myoblast growth factor, and inhibits the proliferation of myoblasts.

[0031] The invention provides a method for promoting the growth and / or proliferation of sheep myoblasts, and the gene LNC_013800 or a product derived from the gene is expressed in sheep cells.

[0032] In the present invention, the method of expressing in sheep cells is preferably to increase the expression of gene LNC_013800 in sheep by heritable and non-heritable means. The heritable means is preferably to integrate gene LNC_013800 into sheep fertilized eggs under the mediation of lentivirus. The non-heritable means preferably includes integrating gene LNC_013800 into sheep cells under the mediation of mammalian vectors or viral vectors for overexpression. The sheep cells preferably include sheep myoblasts.

[0033] The following is a detailed description of a gene LNC_013800 for regulating myoblast growth and its application provided by the present invention in conjunction with the examples, but they should not be construed as limiting the protection scope of the present invention.

[0034] Example 1

[0035] Screening and verification of gene LNC_013800 related to sheep muscle growth and development

[0036] Five small-tailed Han sheep (STH) and five Sunite sheep (SNT) at the same growth period were selected and commissioned to Wuhan Fraser Gene Information Co., Ltd. for transcriptome sequencing and data analysis. The differentially expressed gene LNC_013800 (GTCCTGCCTGGTTTC, SEQ ID NO: 1) related to sheep muscle growth and development was screened through transcriptome sequencing.

[0037] In order to verify the sequencing results of the transcriptome data, RT-qPCR was used to verify it. Five small-tailed Han sheep and five Sunite sheep of the same growth period were selected to study the changes in muscle growth and development of sheep of different breeds at the same growth age. The specific steps of RT-qPCR detection are as follows:

[0038] The total RNA of the longissimus dorsi muscle of Small Tail Han sheep (STH) and Sunite sheep (SNT) was used as template and reverse transcribed into cDNA library. The reaction system included 5×All in one qRT SuperMix 4μl, Enzyme Mix 1μl, template RNA 1μg, and RNase-free ddH2O supplemented to 20μl. The reaction procedure was 50℃15min, 85℃5sec. The obtained cDNA was used as a template, and LNC_0013800-F (CATTAAAGCACACCCTGGAAGTTTC, SEQ ID NO: 2) and LNC_0013800-R (AGGTCACAGCATCAGCGAATATG, SEQ ID NO: 3) were used as primers to prepare the RT-qPCR reaction system, 2×TaqProUniversal SYBR qPCRMasterMix 10.0μl, F primer (10μM) 0.4μl, R primer (10μM) 0.4μl, cDNA 2μl, ddH2O 7.2μl. The internal reference gene was GAPDH, and the internal reference primers were GAPDH-F (GCAAGTTCCACGGCACAG, SEQ ID NO: 8) and GAPDH-R (TCAGCACCAGCATCACCC, SEQ ID NO: 9). The RT-qPCR reaction was performed using LightCycler 480 II. The reaction procedure was 95°C pre-denaturation for 5 min; 95°C denaturation for 5 s, 60°C annealing for 30 s, for a total of 40 cycles. -ΔΔCt The relative expression of experimental data was calculated by t-test and the P value was calculated by t-test.

[0039] Results Figure 1 . Figure 1 The results showed that the expression level of LNC_013800 in the longissimus dorsi muscle of Sunite sheep was significantly higher than that in the longissimus dorsi muscle of Small-tail Han sheep, which was consistent with the transcriptome sequencing results.

[0040] Example 2

[0041] Method for constructing LNC_013800 overexpression vector and interference vector

[0042] According to the sequence of LNC_013800, siRNA (si-LNC_013800) was designed to interfere with the expression of LNC_013800 gene, and the sequence is shown in GCUGCUUGGUUUGUGUGAUTT (SEQ ID NO: 10), AUCACACAAACCAAGCAGCTT (SEQ ID NO: 11). The si-LNC_013800 was used to construct an interference vector, which was recorded as si-LNC_013800 interference vector, and was specifically commissioned to Shanghai Jima Pharmaceutical Technology Co., Ltd. for synthesis.

[0043] BamHI and NotI restriction sites were added to both ends of the DNA fragment of LNC_013800, and cloned into the pcDNA3.1(+) vector by restriction digestion and ligation to obtain the pcDNA3.1-LNC_013800 overexpression vector, which was specifically commissioned to Shanghai Jima Pharmaceutical Technology Co., Ltd. for synthesis.

[0044] Example 3

[0045] Cell transfection experiment of recombinant vector

[0046] Sheep myoblasts were cultured at 1×10 6 Cells were inoculated at a density of 100 μg / well in a 6-well plate (3 replicates per group), and 2 mL of DMEM complete medium (DMEM complete medium was prepared by adding 10% fetal bovine serum, 2% penicillin and streptomycin (100 μg / mL) to DMEM medium) was added to each well. The cells were cultured overnight at 37°C, 5% CO2 and saturated humidity. Before transfection, the original cell culture medium was replaced with 1.5 mL of Opti-MEM. 242 μL of Opti-MEM was mixed with 8 μL of pcDNA3.1-LNC_013800 or si-LNC_013800 interference vector at a concentration of 500 ng / μL to make solution A. 242 μL of Opti-MEM and 8 μL of 2000 to make liquid B, mix liquid A and liquid B to form a transfection complex, incubate at room temperature for 20 minutes, add to the cell culture plate to transfect sheep myoblasts, culture at 37 ° C, 5% CO2, saturated humidity, replace with complete medium after 6 hours, and collect cells after 48 hours. At the same time, a control group was set up, specifically replacing pcDNA3.1-LNC_013800 with pcDNA3.1-LNC_013800-NC, or replacing si-LNC_013800 interference vector with si-LNC_013800-NC vector, and the other steps were the same.

[0047] Example 4

[0048] Detection of the effects of overexpression or inhibition of LNC_013800 on the expression of growth factors in sheep myoblasts

[0049] 1. RT-qPCR detection

[0050] The total RNA of the four sheep myoblasts constructed in Example 3 was used as a template, and the RT-qPCR reaction system was prepared with CDK4-F (CAACGGAGGAGGTGCTGGAG, SEQ ID NO: 4) / CDK4-R (GAGCCTGACAACATTGGGATGC, SEQ ID NO: 5) and CCND1-F (TTGCTGCTTCCGCCTTGTATC, SEQ ID NO: 6) / CCND1-R (AACCATCCACTTGACACACTTCTC, SEQ ID NO: 7) primers, which were specifically described in Example 1. The internal reference gene was GAPDH, and the internal reference primers were GAPDH-F (GCAAGTTCCACGGCACAG, SEQ ID NO: 8) and GAPDH-R (TCAGCACCAGCATCACCC, SEQ ID NO: 9). The RT-qPCR reaction was performed using LightCycler 480II. The reaction procedure was 95°C pre-denaturation for 5 min; 95°C denaturation for 5 s, 60°C annealing for 30 s, for a total of 40 cycles. -ΔΔCt The relative expression of experimental data was calculated by t-test and the P value was calculated by t-test.

[0051] Results Figure 2 The expression of LNC_013800 was overexpressed / inhibited in cells, and the expression of growth factors was detected by RT-qPCR. The results showed that the expression levels of CDK4 and CCND1 after overexpression of LNC_013800 were significantly higher than those after inhibition of LNC_013800.

[0052] 2. Protein Extraction and Western Blot Detection

[0053] Use a whole protein extraction kit to extract the total protein of the four types of sheep myoblasts constructed in Example 3. Collect the cultured muscle cells in a 1.5mL centrifuge tube, use a high-speed centrifuge at 4°C, 12000r / min for 30min, collect the supernatant, and discard the precipitate. Determine the BCA standard curve and calculate the protein concentration according to the instructions of the protein concentration determination kit (BCA). According to the protein volume: 5×SDS Loading Buffer=4:1, mix the protein with 5×SDS Loading Buffer and boil it in a metal bath at 100°C for 5min. Add 15μg of protein to each well in BeyoGel Plus PAGE precast gel (Tris-Gly, 10%, 10 wells), 80V, 20min, 120V 60min, and stop when the bottom of the bromophenol blue gel is observed. After the electrophoresis is completed, use 180mA90 min electrophoresis conditions for transfer, and then use QuickBlock TMWestern blocking solution was used to block the sample on a shaker at room temperature for 2 hours. Then, different concentrations of primary antibodies (CCND1: proteintech, 26939-1-AP; CDK4: proteintech, 83994-3-RR) were added and blocked overnight at 4°C. Wash with washing solution 3 times, 5 minutes each time. After incubation with secondary antibodies at room temperature for 2 hours, wash again with washing solution 3 times, 5 minutes each time. Finally, ultra-sensitive ECL chemiluminescent reagent was used for color development, Odyssey CLX imaging system (Li-COR) was used for exposure, and the sample was photographed and saved. Image J software was used to analyze the gray value of the bands, and the ratio of the gray value of the target protein to that of GAPDH was the relative expression level of the target protein.

[0054] Results Figure 3 The expression of LNC_013800 was overexpressed or inhibited in cells, and the expression of growth factors was detected by Western blot. The results showed that the expression levels of CDK4 and CCND1 after overexpression of LNC_013800 were significantly higher than those after inhibition of LNC_013800.

[0055] Example 5

[0056] Effects of overexpression or inhibition of LNC_013800 gene on cell viability and proliferation of sheep myoblasts

[0057] 1.CCK-8 assay

[0058] 2×10 4 Sheep myoblasts were inoculated into 96-well plates at a density of 10 μL / 100 μL, with 5 replicates per group, and cultured for 24 h at 37 °C, 5% CO2, and saturated humidity. According to the instructions of the cell counting kit (CCK-8), after transfection with the overexpression vector or the interference vector (control vector), 10 μL CCK8 solution was added to each well after 0, 6, 12, 24, 48, and 72 h of cell growth, and the absorbance at 450 nm was measured using an ELISA reader after incubation in the incubator for 1 h, and then the proliferation rate of sheep myoblasts was calculated.

[0059] 2. EdU Detection

[0060] The EdU cell proliferation detection kit was used to detect the proliferation of sheep myoblasts. 5Sheep myoblasts were inoculated into 12-well plates at a density of 1 / well, with 3 replicates per group, and cultured for 24 hours at 37°C, 5% CO2, and saturated humidity. According to the instructions of the EdU cell proliferation detection kit, the vector was transfected and cultured for 12 hours. After the cells were in normal state, an equal volume of EdU working solution (10μmol / L) preheated at 37°C was added and incubated for 3 hours. After EdU labeling of cells, the culture medium was removed, and 1mL of immunostaining fixative was added and fixed at room temperature for 15 minutes. Wash 3 times with washing solution, 5 minutes each time. Remove the washing solution, permeabilize each well with 1mL of immunostaining strong permeabilization solution, and incubate at room temperature for 15 minutes. Remove the permeabilization solution, add 1mL of washing solution and wash twice, 3 minutes each time. Incubate at room temperature for 20 minutes with blocking solution, and wash 3 times with washing solution, 2 minutes each time. Add 0.5mL of Click reaction solution to each well, incubate at room temperature in the dark for 30 minutes, and wash 3 times with washing solution, 5 minutes each time. Add 200 μL of Streptavidin-HRP working solution to each well and incubate at room temperature for 30 min. Wash with washing solution 3 times, 2 min each time. Observe under a fluorescence microscope and take photos for record.

[0061] Results Figures 4 to 6 The results of CCK-8 and EdU showed that the activity of myoblasts after overexpression of LNC_013800 was significantly higher than that after inhibition of LNC_013800 expression.

[0062] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A gene LNC_013800 that regulates the proliferation of sheep myoblasts, characterized in that: The nucleotide sequence of the gene LNC_013800 is shown in SEQ ID NO:

1.

2. A gene-derived product comprising the gene LNC_013800 according to claim 1, characterized in that: It includes a recombinant vector containing the gene LNC_013800 or a recombinant virus containing the gene LNC_013800.

3. Use of the gene LNC_013800 described in claim 1 or a gene derivative product described in claim 2 in regulating sheep muscle development.

4. Use of the gene LNC_013800 according to claim 1 or a gene derivative product according to claim 2 in promoting the proliferation of sheep myoblasts.

5. Use of an agent for regulating the expression of the gene LNC_013800 according to claim 1 in the preparation of a product that affects the proliferation of sheep myoblasts.

6. The use according to claim 5, characterized in that: The reagent includes an overexpression recombinant vector containing the gene LNC_013800 or a recombinant vector interfering with the expression of the gene LNC_013800.

7. The use according to claim 6, characterized in that: The recombinant vector for interfering with the expression of gene LNC_013800 comprises siRNA with a nucleotide sequence as shown in SEQ ID NO:

10.

8. The use according to claim 6, characterized in that: The recombinant vector for interfering with the expression of gene LNC_013800 is used in preparing a product for inhibiting the proliferation of sheep myoblasts.

9. The use according to claim 6, characterized in that: The backbone vector of the overexpression recombinant vector containing gene LNC_013800 includes pcDNA3.

1.

10. A method for promoting the growth and / or proliferation of sheep myoblasts, characterized in that: The gene LNC_013800 of claim 1 or the gene derivative product of claim 2 is introduced into sheep myoblasts.

Images