NtHAK37 gene and application thereof

Abstract

The invention discloses an NtHAK37 gene and application thereof, and belongs to the technical field of gene engineering. The nucleotide sequence of the CDS region of the NtHAK37 gene is as shown in SEQ ID NO. 1. The NtHAK37 gene is cloned and analyzed, the function of the gene is verified on tobacco K326 in combination with an overexpression technology, the NtHAK37 gene positively regulates the tolerance of a plant to drought stress, and overexpression of the NtHAK37 gene enables the tolerance of the plant to drought stress to be remarkably improved. The invention provides a theoretical basis and related genes for drought-stress-resistant breeding and production of crops, especially creation of drought-resistant new germplasm of tobacco.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a NtHAK37 gene and an application thereof in regulating plant tolerance to drought stress. Background Art

[0002] Global climate change has brought many challenges to agricultural production. Extreme climate events such as high temperature, floods and droughts have become more common (Yang et al., 2023). Drought is defined as the availability of water resources below the normal level for plant growth. Under drought conditions, plant growth is inhibited, cell morphology and structure change, photosynthesis is limited, osmotic regulation and antioxidant systems are damaged, and severe growth inhibition is shown. Due to its high frequency, long duration and wide spatial coverage (Zhan et al., 2024), the losses caused by drought may exceed the losses of many other abiotic stresses (Feng et al., 2020). Developing and cultivating drought-tolerant crop varieties is an economical and effective way to achieve sustainable crop production in arid areas.

[0003] As sessile organisms, plants have evolved complex mechanisms to adapt to drought, including regulating stomata to control transpiration rate (Su et al., 2024) and root growth and development (He et al., 2015) to maintain water status in the early stage of water deficit, accumulating osmotic regulating substances to maintain cellular water potential (Du et al., 2023), and using antioxidant defense systems to alleviate damage caused by drought stress (Huo et al., 2016). Therefore, identifying drought-resistant germplasm, exploring drought-resistant genes, and understanding the mechanisms related to crop drought tolerance are crucial for breeding drought-resistant crop varieties and ensuring agricultural production.

[0004] Tobacco (Nicotiana tabacum L.) is an annual herbaceous plant of the genus Nicotiana in the Solanaceae family. Due to its high medicinal value and easy tissue culture, it has become a model plant for research in agriculture, biology and other fields. At the same time, tobacco is also an important economic crop and is widely planted throughout the world (Zou et al., 2018). However, due to the frequent occurrence of drought climate in tobacco-growing areas, tobacco plant height is reduced, leaf pieces are small, mineral element absorption is reduced, reducing sugar content is reduced, total nitrogen and nicotine content are increased, tobacco leaf oil content is reduced, and tobacco leaf aroma substances are difficult to form and transform. Therefore, analyzing the response mechanism of tobacco drought stress, discovering tobacco drought-resistant genes, and cultivating more drought-resistant tobacco varieties have received more and more attention. Summary of the invention

[0005] The purpose of the present invention is to provide a gene with drought-resistant characteristics cloned from tobacco, so as to provide relevant genes and theoretical basis for cultivating drought-resistant crops, especially the creation of new tobacco drought-resistant germplasm.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] The present invention uses whole genome resequencing and whole genome association analysis technology, combined with agronomic traits under drought stress, to identify and clone a gene Nta14g09530 related to tobacco drought stress resistance from 300 core tobacco germplasms. The gene is located on the 14th chromosome of tobacco and is annotated as High affinity K+transporter 5. According to the location of the HAK family on the tobacco chromosome, the gene is named NtHAK37.

[0008] Cloning and analysis of NtHAK37 gene: The full-length CDS region sequence of the gene was cloned from tobacco K326, and the nucleotide sequence is shown in SEQ ID NO.1.

[0009] The CDS region of the NtHAK37 gene is 1938 bp in length and encodes a protein sequence consisting of 645 amino acid residues, the amino acid sequence of which is shown in SEQ ID NO. 2. The protein has a molecular weight of 73.00 kDa and an isoelectric point pI of 7.94.

[0010] The functional domain and transmembrane helix analysis of the NtHAK37 protein sequence showed that the protein contained one functional domain: the K_trans functional domain and 10 transmembrane helices.

[0011] Analysis of tobacco HAK family showed that there were 55 HAK family members in tobacco, distributed on 19 chromosomes, named NtHAK1-NtHAK55 according to the chromosome distribution, and the target gene NtHAK37 was located on chromosome 14. Sequence analysis of the promoter of NtHAK37 gene showed that the region had multiple cis-acting elements, including 4 drought-induced elements, 1 abscisic acid-responsive element and 5 light-responsive elements.

[0012] Evolutionary analysis of NtHAK37 showed that the sequence similarity between NtHAK37 protein and tomato SlHAK5 was the highest, with a similarity of 65.8%.

[0013] The NtHAK37 gene is expressed in the root, root tip, stem, old leaf, middle leaf, and young leaf of the plant, with the highest expression in the root tip, followed by the root. The expression of NtHAK37 was detected in the drought-tolerant genotype T218 and drought-sensitive genotype T180 screened in the early stage. The results showed that compared with the control condition, the expression of NtHAK37 in the drought-tolerant genotype T218 increased under drought stress, but the expression of NtHAK37 in the drought-sensitive genotype T180 did not change significantly under drought stress.

[0014] The NtHAK37 gene was overexpressed in tobacco K326 using overexpression technology. The results showed that under drought stress, the growth of plants overexpressing NtHAK37 was significantly better than that of wild K326 plants. Under drought treatment, the plant height, fresh weight, photosynthetic rate, SPAD value, number of leaves per plant, and functional leaf area decline rate of the overexpression strain were all lower than those of wild K326 plants. These results indicate that NtHAK37 positively regulates tobacco drought tolerance.

[0015] Therefore, the present invention provides the use of NtHAK37 gene in regulating the tolerance of plants to drought stress. Mechanism studies show that NtHAK37 gene positively regulates the tolerance of plants to drought stress.

[0016] Furthermore, the plant may be, but is not limited to, tobacco.

[0017] Based on the positive regulatory effect of the NtHAK37 gene on plant drought stress tolerance, the present invention can use genetic engineering technology and other means to upregulate the expression of the NtHAK37 gene in the plant to enhance the tolerance to drought stress. Specifically, the application includes: using biological technology to upregulate the expression of the NtHAK37 gene in the plant to improve the tolerance of the plant to drought stress.

[0018] Furthermore, the application includes: cloning the NtHAK37 gene fragment with a nucleotide sequence such as that shown in SEQ ID NO.1 into a plant overexpression vector to construct a recombinant plasmid, and using Agrobacterium-mediated technology to transfer the target fragment in the recombinant plasmid into a recipient plant to cultivate transgenic plants with enhanced tolerance to drought stress.

[0019] The plant overexpression vector in the present invention can be a vector known in the art for Agrobacterium-mediated genetic transformation technology, and can be but not limited to pHK-35S vector.

[0020] Furthermore, the Agrobacterium used was GV3101 Agrobacterium.

[0021] Furthermore, the recipient plant is tobacco K326.

[0022] The present invention has the following beneficial effects:

[0023] The present invention clones and analyzes the NtHAK37 gene, and verifies the function of the gene in tobacco K326 by combining overexpression technology. The NtHAK37 gene positively regulates the tolerance of the plant to drought stress, and overexpression of the NtHAK37 gene significantly increases the tolerance of the plant to drought stress. The present invention provides a theoretical basis and related genes for crop drought stress tolerance breeding and production, especially the creation of new tobacco drought-resistant germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a predicted map of NtHAK37 functional domains.

[0025] Figure 2 This is the predicted map of NtHAK37 transmembrane helices.

[0026] Figure 3 Chromosome analysis of tobacco HAK family.

[0027] Figure 4 Analysis of the gene structure of tobacco HAK family.

[0028] Figure 5 Phylogenetic tree analysis of NtHAK37 and HAK family genes in rice, tomato and Arabidopsis.

[0029] Figure 6 The figure shows the amino acid sequence comparison between NtHAK37, AtHAK5, SlHAK5 and OsHAK5.

[0030] Figure 7 : The expression pattern of NtHAK37 gene, where (A) is the expression pattern of NtHAK37 gene in different parts of tobacco; (B) is the induced expression of NtHAK37 gene in drought-tolerant genotype T218 and drought-sensitive genotype T180 under drought treatment.

[0031] Figure 8 Figure 2 shows the drought tolerance phenotype of overexpressed plants. (A) shows the relative expression of NtHAK37 gene in each treatment line detected by qRT-PCR; (B) shows the phenotypic analysis of each line after drought stress treatment; (C) shows the plant height (cm) of each line after drought stress treatment; (D) shows the leaf fresh weight (g) of each line after drought stress treatment; (E) shows the photosynthetic rate (Net photosynthetic rate, μmol CO2 m -2 s -1 ); (F) is the SPAD value of each strain after drought stress treatment; (G) is the number of leaves per plant of each strain after drought stress treatment; (H) is the functional leaf area (cm2) of each strain after drought stress treatment 2 ). DETAILED DESCRIPTION

[0032] The technical solution of the present invention is further described in detail below through specific embodiments. It should be understood that the implementation of the present invention is not limited to the following embodiments, and any form of modification and / or change made to the present invention will fall within the protection scope of the present invention.

[0033] In the present invention, unless otherwise specified, all parts and percentages are by weight, and the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are all conventional methods in the art unless otherwise specified.

[0034] This invention is based on the agronomic trait analysis of 300 core tobacco germplasms under drought stress conducted by the research team in the early stage, and identifies, clones and analyzes the key genes that regulate tobacco drought resistance, which has important guiding significance for clarifying the molecular mechanism of tobacco response to drought stress and the breeding and production of tobacco drought resistance.

[0035] Example 1: Cloning and analysis of the CDS region of the NtHAK37 gene

[0036] 1. Tobacco growing conditions

[0037] Tobacco K326 seeds were sterilized in 75% alcohol for 30 seconds and washed with sterile water for 1 minute. The sterilized tobacco seeds were sown on moist nutrient soil and germinated in an artificial climate chamber (22℃ / 18℃, daytime / nighttime). After 10 days, the germinated seedlings were transplanted to outdoor soil culture. The pot specifications were: 10.0cm×10.0cm×12.5cm. The soil was collected from the experimental farm (0-20cm depth). 1 / 5 Hogland nutrient solution (pH=5.8-6.0) was used to evenly mix the soil 1 day before transplanting. Seedlings with uniform growth and size were selected, and one seedling was fixed in each pot. Drought treatment was carried out after 30 days: normal watering was used to control the soil moisture content to maintain about 35% to 45%. Watering was stopped for drought treatment and the soil was allowed to dry naturally.

[0038] 2. Cloning of the CDS sequence of NtHAK37 gene

[0039] Total RNA was extracted according to the instructions of the RNA extraction kit (Takara, Japan), and genomic DNA contamination in the total RNA was removed with DNaseI. The extracted total RNA was reverse transcribed into cDNA for cloning, and specific primers were designed according to the sequence obtained by Blast. The specific primer sequences are as follows:

[0040] NtHAK37_CDS_F:

[0041] 5'-ATGTGTCGATATGCAAAAGTGAGTCTTATCCC-3' (SEQ ID NO. 3);

[0042] NtHAK37_CDS_R:

[0043] 5'-TTATAATTCATAAGTCATGCCGACCCTTAGCA-3' (SEQ ID NO. 4).

[0044] The amplified product was connected to the pMD18-T (Takara, Japan) vector and transformed into E. coli DH5α. The positive clones were selected and sent to the company for sequencing. The correct clones were extracted and stored in glycerol. The resulting plasmid was named pMD18-T-NtHAK37 plasmid. PCR primer synthesis and gene sequencing were completed by Zhejiang Shangya Biotechnology Co., Ltd.

[0045] 3. NtHAK37 gene sequence analysis

[0046] The NtHAK37 protein sequence was used to predict and analyze the functional domains through the SMART (http: / / smart.embl-heidelberg.de / ) website. Figure 1 As shown in Figure 2, the protein contains a K_trans functional domain. The transmembrane helix was predicted by TMHMM (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ), as shown in Figure 2. Figure 2 As shown, the protein has 10 transmembrane helices.

[0047] To identify the HAK family in tobacco, we first performed a local BLASTP search (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) against the entire tobacco protein database using previously known HAK proteins from Arabidopsis, rice, and tomato as queries with an e-value cutoff of 10 -10 , with a score threshold of 100. Secondly, the HAK family .hmm file was obtained from the Pfam database and the tobacco protein database was searched using the HMMER v3.0 software package (http: / / hmmer.org / ) with an e-value cutoff of 10 -20 , with a score threshold of 200. Genes identified by both methods were considered to be members of the tobacco HAK family. Figure 3 As shown, a total of 55 NtHAK family genes were identified, distributed on 19 chromosomes.

[0048] MEME was used for motif prediction (https: / / meme-suite.org / meme / tools / meme), Batch CD-Search (https: / / www.ncbi.nlm.nih.gov / Structure / bwrpsb / bwrpsb.cgi) was used for conserved domain analysis, MAFFT and MEGA-X software were used to construct evolutionary trees, and TBTools was used for promoter cis-acting element prediction and gene structure analysis. Figure 4 As shown, the NtHAK37 promoter includes four drought-inducible elements, one abscisic acid-responsive element and five light-responsive elements.

[0049] The HAK protein sequences in different species including NtHAK37 were analyzed using MAFFT and MEGA-X software to construct a phylogenetic tree. Figure 5 , Figure 6 As shown, NtHAK37 is evolutionarily located in the same evolutionary branch as tomato SlHAK5, and the sequence similarity between the two is 65.8%.

[0050] 4. Analysis of NtHAK37 gene expression

[0051] The total RNA extraction kit (Takara, Japan) was used to extract the RNA from the roots, root tips, stems, old leaves, middle leaves, and young leaves of tobacco K326 with normal growth, as well as the total RNA from the control, drought-treated T218 (drought-tolerant genotype), and T180 (drought-sensitive genotype). The genomic DNA contamination in the total RNA was removed with DNaseI, and the total RNA of each sample was reverse transcribed into single-stranded cDNA using the PrimeScriptTM RT reagent Kit (Takara, Japan). The expression of the NtHAK37 gene in the corresponding samples was analyzed by fluorescence quantitative PCR (qRT-PCR) using the SYBR green luciferase complex (Takara, Japan) and the Light Cycler 480PCR instrument (Roche, Switzerland), and the expression value was corrected using an internal reference gene NtL25.

[0052] The RT-PCR primer sequences are:

[0053] NtHAK37-qpcr-F: 5'-ATTTGCTCCAGCCATTTGCATT-3' (SEQ ID NO. 5);

[0054] NtHAK37-qpcr-R: 5'-TCCACCAAGAGAGATCCATCCT-3' (SEQ ID NO. 6);

[0055] qNtL25_F: 5'-CAAAAGTTACATTCCACCG-3' (SEQ ID NO. 7);

[0056] qNtL25_R: 5'-TTTCTTCGTCCCCATCAGGC-3' (SEQ ID NO. 8).

[0057] The qRT-PCR system (total volume 20 μL) was: SYBR Green Realtime PCR Master Mix 10 μL, NtHAK37-qpcr-F / qNtL25_F 0.8 μL, NtHAK37-qpcr-R / qNtL25_R 0.8 μL, cDNA 2 μL, and ddH2O 6.4 μL.

[0058] The specific PCR program was: 95°C for 30 s, (95°C for 5 s, 60°C for 10 s, 72°C for 15 s) for 40 cycles. The melting curve program was: 60°C-95°C, 5 s per step, increasing by 0.5°C. -ΔΔCq The relative quantitative method was used to calculate the changes in gene expression values. Each group of experiments was repeated three times.

[0059] The result is: Figure 7 As shown in (A), the NtHAK37 gene was expressed in the root (R), root tip (RT), stem (S), old leaf (SL), middle leaf (ML), and young leaf (YL) of tobacco, with the highest expression level in the root tip, followed by the root.

[0060] like Figure 7 As shown in (B), compared with the control condition, the expression level of NtHAK37 in the drought-tolerant genotype T218 increased under drought stress, but the expression level of NtHAK37 in the drought-sensitive genotype T180 remained unchanged under drought stress, indicating that this gene may positively regulate tobacco drought tolerance.

[0061] Example 2: Overexpression to verify the function of NtHAK37 gene

[0062] 1. Overexpression vector construction

[0063] Design primers with homology arms:

[0064] NtHAK37_OX_F:

[0065] 5'- CTATTTACAATTACGGATCC ATGTGTCGATATGCAAAAGTGAGTCT TATCCC-3'(SEQ IDNO.9);

[0066] NtHAK37_OX_R:

[0067] 5'- TGAAGACAGAGCTAGTTACA TTATAATTCATAAGTCATGCCGACCCTTAGCA-3' (SEQ ID NO. 10).

[0068] The PCR amplification products were detected by 1% agarose gel electrophoresis, the target products were recovered and purified by gel electrophoresis, and the concentration of the recovered products was measured.

[0069] The vector enzyme digestion system (20 μL) is: Nuclease-free Water 13 μL, 10×Buffer 2 μL, BsaI / Eco31I 1 μL, vector 4 μL. The vector used is based on the pHK-35S vector, with a double 35s promoter and an enhancer TMVΩ (Synthetic microbe-to-plant communication channels. Nature Communications, 2024, 15: 1817) added to the end of the promoter.

[0070] Enzyme digestion reaction conditions: 37°C for 1 h.

[0071] The recombination reaction system (20 μL) was as follows: Biorun 2×EasyClone Mix 10 μL, pBWA(V)H2STMVΩ-ccdB(D) 5 μL, and NtHAK37 amplification product 5 μL.

[0072] Recombination reaction conditions: 37℃ for 30min

[0073] 5-10 μL of the ligation product was transformed into competent E. coli, transformed into a kan-resistant plate, cultured at 37°C for 12 hours, and the plasmid was extracted.

[0074] 2. Genetic transformation of tobacco

[0075] Take 1 μL of the recombinant plasmid to transform GV3101 Agrobacterium competent cells, pick Agrobacterium in the infection solution, and prepare the OD 600=0.2 Agrobacterium resuspension. Sow the sterilized tobacco K326 seeds on the germination medium, culture at 23℃16h / 8h light / dark for 4-5 weeks, cut the sterile tobacco leaves into small pieces with a scalpel and inoculate them on the pre-culture medium. Inoculate the tobacco leaves that have been pre-cultured for 2-3 days in the Agrobacterium suspension for infection for 10-15 minutes, inoculate the infected tobacco leaves on filter paper, dry them and inoculate them on the co-culture medium, and culture them in the dark for 48-72 hours. Transfer the leaves that have been co-cultured for 2 days to the induction medium to induce callus, and wait for about 10 days for callus tissue to grow. Inoculate the callus tissue on the screening medium of the corresponding resistance, culture time 15-30 days, culture temperature: 23±2℃. Inoculate the second screened positive callus tissue with vigorous growth on the differentiation medium, 4-5 calli / dish, 23℃16h / 8h light / dark culture for 15-30 days. During the differentiation process, if seedlings are formed from callus, they are inoculated on seedling medium and grown for 7-10 days. Transplant them into large pots for harvesting. Select two strains with higher expression levels for subsequent drought treatment experiments.

[0076] 3. Phenotypic identification of NtHAK37 overexpression strains

[0077] K326 and two NtHAK37 overexpression lines were used to verify the drought tolerance of tobacco after NtHAK37 overexpression. Soil culture drought treatment was also used, and the planting method was as described above.

[0078] The expression level of NtHAK37 was measured when the soil moisture content under drought treatment reached about 10%. Figure 8 (A) shown.

[0079] When the soil moisture content reaches 6%, the physiological and biochemical indicators and agronomic traits are measured. Figure 8 As shown in (B), compared with the control condition, after drought treatment, the leaves of wild-type K326 wilted significantly, while the leaves of the NtHAK37 overexpressing line wilted to a lesser extent. Figure 8 As shown in (CH), under drought treatment, the plant height, leaf fresh weight, photosynthetic rate, SPAD value, number of leaves per plant and functional leaf area of ​​the wild-type K326 line were 76.72%, 35.43%, 34.11%, 81.34%, 53.13% and 68.55% of those of the control, respectively, while the corresponding values ​​of the two overexpression lines were 92.44% / 94.02%, 58.59% / 59.70%, 60.35% / 51.41%, 117.10% / 104.68%, 74.6% / 72.31% and 82.56% / 74.57%, respectively.

[0080] The above results indicate that overexpression of NtHAK37 improves the drought tolerance of tobacco, further proving that NtHAK37 positively regulates tobacco drought tolerance.

[0081] In summary, by cloning and analyzing tobacco NtHAK37 and verifying the function of the gene in K326 with overexpression technology, it was found that the drought tolerance of NtHAK37 overexpressing plants was significantly enhanced. The present invention provides a theoretical basis and related genes for barley drought stress tolerance breeding and production.

[0082] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. Application of the NtHAK37 gene in regulating plant tolerance to drought stress, characterized in that: The nucleotide sequence of the CDS region of the NtHAK37 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The amino acid sequence of the protein encoded by the NtHAK37 gene is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The plant is tobacco.

4. The use according to claim 1 or 3, characterized in that: The NtHAK37 gene positively regulates the plant's tolerance to drought stress.

5. The use according to claim 1, characterized in that The application includes: utilizing biological technology to up-regulate the expression of NtHAK37 gene in plants, so as to improve the tolerance of plants to drought stress.

6. The use according to claim 1, characterized in that The application includes: cloning the NtHAK37 gene fragment with a nucleotide sequence such as that shown in SEQ ID NO.1 into a plant overexpression vector to construct a recombinant plasmid, and using Agrobacterium-mediated technology to transfer the target fragment in the recombinant plasmid into a recipient plant to cultivate a transgenic plant with enhanced tolerance to drought stress.

7. The use according to claim 6, characterized in that Agrobacterium GV3101 was used.

8. The use according to claim 6, characterized in that The recipient plant is tobacco K326.

Images