Application of OSGEP gene in preparation of kit for detecting acute myelogenous leukemia

Abstract

The invention discloses an application of an OSGEP gene in preparation of a kit for detecting acute myelogenous leukemia. In the invention, the OSGEP gene is highly expressed in patients with acute myelogenous leukemia, the total survival rate of the highly expressed patients with acute myelogenous leukemia is reduced, and further by constructing a leukemia cell strain with OSGEP gene specificity knocked down, it is found that the knocked down OSGEP gene has the effects of inhibiting leukemia cell proliferation, retarding cell cycle and inducing cell apoptosis. Therefore, the OSGEP gene can be used as a biomarker for screening, diagnosis, dynamic disease course monitoring and prognosis evaluation of the acute myelogenous leukemia, can also be applied to screening, preparation and testing of novel drugs for resisting the acute myelogenous leukemia, and creates conditions for developing novel drugs for treating the acute myelogenous leukemia.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to an application of an OSGEP gene in preparing a kit for detecting acute myeloid leukemia. Background Art

[0002] Acute myeloid leukemia (AML) is a type of heterogeneous blood system malignancy that seriously endangers human health. Its incidence ranks first among adult leukemias in my country. Its pathogenesis is complex, often accompanied by abnormal changes in cell differentiation, proliferation, apoptosis and other aspects. AML progresses rapidly, with a natural course of only a few months. The prognosis of patients varies greatly, with a high mortality rate. The five-year survival rate of traditional chemotherapy is only 20-35%. With the aging of my country's population, the incidence of AML has been on the rise in recent years.

[0003] The diagnosis, classification and prognosis evaluation of AML have always relied on morphological and cytogenetic testing, but for AML with normal karyotype, the diagnostic accuracy is very low and there is a lack of good universal markers. At present, the treatment methods for AML patients mainly include combined chemotherapy, the use of hypomethylating drugs and hematopoietic stem cell transplantation. The "7+3" regimen in chemotherapy, that is, chemotherapy with 7 days of cytarabine combined with 3 days of anthracyclines such as daunorubicin, is still the standard treatment for the vast majority of patients. However, due to the high recurrence and drug resistance problems, the long-term survival rate and cure rate of AML patients are low. Therefore, it is of great significance to further clarify the occurrence and development mechanism of AML and find more markers or targets for early diagnosis, treatment and prognosis of AML.

[0004] OSGEP gene encodes tRNA N 6 -Adenosine threonyl aminoformyl transferase protein O-sialoglycoprotein endopeptidase (OSGEP) is a catalytic subunit of the highly conserved KEOPS complex. Recent studies have shown that OSGEP is involved in cell proliferation and mitochondrial metabolism. Knocking down the OSGEP gene may inhibit cell proliferation, affect protein translation, and induce cell death. The OSGEP gene is one of the pathogenic genes of Galloway-Mowat syndrome (GAMOS), which causes microcephaly, growth and intellectual developmental delay, and nephrotic syndrome. Summary of the invention

[0005] The purpose of the present invention is to provide an application of an OSGEP gene in the preparation of products for screening diagnosis, prognosis evaluation and prevention and treatment of acute myeloid leukemia.

[0006] The above-mentioned purpose is achieved by the following technical solutions.

[0007] A first aspect of the present invention provides an application of an OSGEP gene or a reagent for detecting the expression level of an OSGEP gene in the preparation of a kit for detecting acute myeloid leukemia.

[0008] In some embodiments, the nucleotide sequence of the OSGEP gene is shown as SEQ ID NO:1.

[0009] A second aspect of the present invention provides a use of a primer set for amplifying the OSGEP gene in preparing a kit for detecting acute myeloid leukemia, the primer set comprising a forward primer having a sequence as shown in SEQ ID NO:6 and a reverse primer having a sequence as shown in SEQ ID NO:7.

[0010] The third aspect of the present invention provides a kit for detecting acute myeloid leukemia, wherein the kit comprises a reagent for detecting the expression level of the OSGEP gene.

[0011] In some embodiments, the reagent for detecting the expression level of the OSGEP gene includes a primer set for amplifying the OSGEP gene, and the primer set includes a forward primer with a sequence as shown in SEQ ID NO:6 and a reverse primer with a sequence as shown in SEQ ID NO:7.

[0012] A fourth aspect of the present invention provides a use of the above-mentioned kit for detecting acute myeloid leukemia in the preparation of products for screening, diagnosing, dynamically monitoring the course of acute myeloid leukemia or evaluating the prognosis of acute myeloid leukemia patients.

[0013] A fifth aspect of the present invention provides a use of an OSGEP gene and / or its encoded protein in the preparation of a drug for preventing and / or treating acute myeloid leukemia.

[0014] The sixth aspect of the present invention provides an application of an OSGEP gene in the preparation of a product for the screening of a drug for acute myeloid leukemia. Specifically, the product may be a cell line.

[0015] A seventh aspect of the present invention provides a cell line with suppressed OSGEP gene expression for use in screening drugs for acute myeloid leukemia.

[0016] In some embodiments, the cell line is HL-60 cells.

[0017] In some of the embodiments, the cell line with inhibited OSGEP gene expression is a cell line that can stably express short hairpin RNA that inhibits OSGEP gene expression; preferably, the DNA sequence corresponding to the short hairpin RNA is as shown in SEQ ID NO:8 or SEQ ID NO:10, and more preferably, the DNA sequence corresponding to the short hairpin RNA is as shown in SEQ ID NO:8.

[0018] In the present invention, the inventors first discovered and verified that the OSGEP gene is highly expressed in patients with acute myeloid leukemia, and the overall survival rate of patients with high expression of acute myeloid leukemia is reduced. Further, by constructing a leukemia cell line with specific knockdown of the OSGEP gene, it was found that knockdown of the OSGEP gene has the effect of inhibiting leukemia cell proliferation, arresting the cell cycle, and inducing cell apoptosis. Based on the above findings, the OSGEP gene can be used as a biomarker for screening, diagnosis, dynamic monitoring of the course of disease, and prognosis evaluation of acute myeloid leukemia, and can also be used in the screening, preparation, and testing of new anti-acute myeloid leukemia drugs, creating conditions for the development of new drugs for the treatment of acute myeloid leukemia. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a graph showing the difference in OSGEP expression between AML patients and normal (NC) samples in the TNMplot database.

[0020] Figure 2 This is the result of the correlation analysis between the expression of OSGEP gene in the Kaplan-Meier plotter database and the overall survival rate of AML patients.

[0021] Figure 3 It is the expression of OSGEP in healthy people (Normal) and AML patients in clinical samples.

[0022] Figure 4 This is a ROC analysis chart based on the expression results of OSGEP in clinical samples.

[0023] Figure 5 is the knockdown efficiency result of OSGEP; Figure 5 A is the expression level of OSGEP gene detected by qRT-PCR in various interference HL-60 cell lines; Figure 5 B: Western blotting was used to verify the knockdown efficiency of OSGEP protein levels in shOSGEP-1 and shOSGEP-3; Figure 5 C: Detection of t6A modification levels in shOSGEP-1 and shOSGEP-3 cell lines.

[0024] Figure 6 To observe the changes in cell proliferation ability after knocking down the OSGEP gene using CCK-8 experiment; Figure 6 A is the change of cell proliferation ability of shOSGEP-1, Figure 6 B shows the changes in the cell proliferation ability of shOSGEP-3.

[0025] Figure 7Flow cytometry was used to detect the effect of knocking down the OSGEP gene on the apoptosis of HL-60 cells; Figure 7 A is the effect of shOSGEP-1 on apoptosis of HL-60 cells. Figure 7 B shows the effect of shOSGEP-3 on apoptosis of HL-60 cells.

[0026] Figure 8 Flow cytometry was used to detect the effect of knocking down the OSGEP gene on the cell cycle of HL-60 cells; Figure 8 A is the effect of shOSGEP-1 on the cell cycle of HL-60 cells. Figure 8 B shows the effect of shOSGEP-3 on the cell cycle of HL-60 cells.

[0027] Fig. 9 The relative survival rates and half-maximal inhibitory dose (IC50) of shOSGEP-1 and shNC cells after incubation with different concentrations of cytarabine for 48 hours. 50 ). DETAILED DESCRIPTION

[0028] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0029] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0030] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0031] In the present invention, it is found for the first time that the OSGEP gene is highly expressed in patients with acute myeloid leukemia, and the finding is verified by analysis of the INMplot database. At the same time, analysis of the Kaplan-Meier plotter database verifies that the overall survival rate of patients with highly expressed acute myeloid leukemia is decreased. Further, the leukemia cell line HL-60 with OSGEP gene knockdown is constructed by infecting the leukemia cell line HL-60 with shRNA lentivirus, and it is verified that knocking down the OSGEP gene has the effects of inhibiting HL-60 cell proliferation, blocking the cell cycle, and inducing cell apoptosis. Therefore, based on this discovery, the OSGEP gene can be used as a biomarker for screening, diagnosis, dynamic monitoring of the course of disease, and prognosis evaluation of acute myeloid leukemia, and can also be used in the screening and testing of new anti-acute myeloid leukemia drugs, creating conditions for the development of new drugs for the treatment of acute myeloid leukemia.

[0032] The present invention is described below with reference to specific embodiments.

[0033] Example 1 Database retrieval analysis of OSGEP expression in AML patients

[0034] During the long-term research on acute myeloid leukemia (AML), the inventors accidentally discovered that the OSGEP gene is highly expressed in patients with acute myeloid leukemia, wherein the DNA sequence of the OSGEP gene is: (SEQ ID NO: 1).

[0035]

[0036] To verify this finding, the inventors further compared the gene expression differences of the OSGEP gene between AML patients and healthy people, analyzed the gene expression data of AML patients and the gene expression data of healthy human samples in the INMplot (differential gene expression analysis in Tumor, Normal, and Metastatic tissues) database, and analyzed the correlation between the expression of the OSGEP gene and the overall survival rate of AML patients in the Kaplan-Meier plotter database.

[0037] like Figure 1 The expression difference of OSGEP between AML patients and normal human (NC) samples in the TNMplot database is shown. The results show that OSGEP is highly expressed in AML patients. Figure 2 This is the result of correlation analysis between the expression of OSGEP gene and the overall survival rate of AML patients in the Kaplan-Meier plotter database, where Time (months) represents the overall survival rate (months), Probability represents the cumulative survival rate, low represents the samples with low OSGEP expression, high represents the samples with high OSGEP expression, Number at risk represents the number of samples, and p=0.011 represents the existence of significant difference, i.e., the overall survival time of AML patients with high OSGEP expression is significantly lower than that of AML patients with low OSGEP expression.

[0038] Example 2 Detection of OSGEP expression in clinical samples

[0039] 1. Experimental Methods

[0040] 1.1 Clinical sample collection and processing

[0041] Peripheral blood specimens from 12 patients diagnosed with acute myeloid leukemia and 12 healthy subjects from Yuhuangding Hospital of Yantai University were collected. 1 ml of whole blood was taken from each sample, and 3 ml of red blood cell lysis buffer EL was added. The samples were incubated on ice for 10-15 min. After the red blood cells were lysed, the samples were centrifuged at 800×g at 4°C for 10 min, the supernatant was discarded, 2 ml of red blood cell lysis buffer EL was added to the precipitate, and the samples were centrifuged at 800×g at 4°C for 10 min. The supernatant was discarded, and 500 μl of QIAGEN RLT Plus Buffer was added. The samples were mixed thoroughly and stored at -80°C.

[0042] 1.2 Extraction of RNA

[0043] RNA was extracted according to the RNA extraction kit QIAsymphony RNA Kit (QIAGEN) operating manual, and the RNA concentration and purity were determined.

[0044] 1.3 cDNA reverse transcription

[0045] cDNA reverse transcription was performed using the cDNA reverse transcription kit HiScript III 1st Strand cDNA Synthesis Kit (Novozyme). The specific operation is as follows:

[0046] 1.3.1 Genomic DNA Removal

[0047] Prepare the following mixture in an RNase-free centrifuge tube:

[0048] <![CDATA[RNase-free ddH 2 The]]> to 10μL 5×gDNA wiper Mix 2μL Total RNA 10pg-1μg or Poly A+RNA 10pg-100ng

[0049] Mix gently by pipetting and incubate at 42°C for 2 min.

[0050] 1.3.2 Preparation of first-strand cDNA synthesis reaction solution

[0051] Prepare the following mixture in an RNase-free centrifuge tube:

[0052]

[0053]

[0054] 1.3.3 Perform the first-strand cDNA synthesis reaction according to the following conditions

[0055] 37℃ 15min 85℃ 5s

[0056] After the reaction, add RNase-free ddH2O to the product to 100 μL, mix well, and store in aliquots.

[0057] 1.4qRT-PCR

[0058] The fluorescent quantitative PCR detection kit ChamQ Universal SYBR qPCR Master Mix (Novozyme) was used for amplification reaction to detect gene expression levels. The specific operation is as follows:

[0059] Configure the qRT-PCR reaction system according to the following table:

[0060] 2×ChamQ Universal SYBR qPCR Master Mix 10μL Primer-F (10 μM) 0.4μL Primer-R (10 μM) 0.4μL Template 2μL <![CDATA[RNase-free ddH 2 The]]> to 20μL

[0061] The primer sequences used in qRT-PCR were synthesized by Shanghai Jierui Bioengineering Co., Ltd. SRP14 and B2M were used as internal reference genes. The sequences are as follows:

[0062]

[0063] Reaction conditions:

[0064] First, pre-denaturation was performed at 95°C for 60 s. Second, denaturation was performed at 95°C for 10 s, annealing and extension was performed at 60°C for 40 s, and fluorescence was collected, for a total of 40 cycles.

[0065] 1.5 Statistical analysis

[0066] All data were obtained from three independent experiments. Unpaired Student's t-test was used to compare the means of two samples, and one-way analysis of variance was used to compare the data between multiple groups. The test level was α = 0.05, and P < 0.05 indicated that the difference was statistically significant.

[0067] 2. Experimental results

[0068] Figure 3 The results show that OSGEP is significantly more expressed in the AML group compared with healthy people. Further ROC curve analysis was performed. Figure 4 The ROC curve is as follows: AUC reaches 0.9442, sensitivity is 90.91%, and specificity is 95.45%.

[0069] Example 3: Construction of OSGEP gene interference stable strain and identification of knockdown efficiency

[0070] 1. Experimental Methods

[0071] 1.1 Construction of OSGEP gene interference stable cell line

[0072] 1.1.1 Lentivirus packaging, sequencing identification and titer determination: The shRNA lentiviral vector targeting the OSGEP gene (shOSGEP) was synthesized by Sangon Co., Ltd. The target sequence is as follows, where shNC is a negative control:

[0073] shRNA-1(SEQ ID NO:8):GGATTAACCTCCCCAGGATATC

[0074] shRNA-2(SEQ ID NO:9):CCATCGATATTGCAGTGGGTA

[0075] shRNA-3(SEQ ID NO:10):CAGAGGTATCGGACAGATGAA

[0076] shRNA-4(SEQ ID NO:11):CTGTATTGACAATGGAGCGAT

[0077] shRNA-NC (SEQ ID NO:12):ACAACAGCCACAACGTCTATC

[0078] 1.1.2 Infecting cells with lentivirus and screening stable cell lines: Leukemia cell line HL-60 was used as the experimental object. First, cells were collected and inoculated into 24-well plates, with a cell density of 1×10 5 Add 25-40 μL of lentivirus solution with a titer of 1×108TU / ml and 20 μL of HitransGP, and use cell culture medium to make up the cell suspension in each well to 500 μL, mix thoroughly, and place at 37°C and 5% CO. 2 After culturing in the incubator for 48 to 72 hours, observe the cell status and fluorescence intensity, and replace the culture dish and culture medium in time. Finally, when the infection efficiency reaches about 80%, add 2 μg / mL puromycin for screening for 7 to 14 days to obtain a stable cell line, and continue to expand the culture for subsequent experiments.

[0079] 1.2 Detection of OSGEP gene knockdown efficiency

[0080] 1.2.1 qRT-PCR: After extracting the total RNA of the cells obtained in step 1.1 using an RNA extraction kit, the knockdown efficiency of OSGEP was detected using the qRT-PCR method. The experimental method was the same as that in Example 2.

[0081] 1.2.2 Western Blotting:

[0082] (1) Protein extraction: Collect the cells obtained in step 1.1 and wash the culture medium with PBS, add cell lysis buffer, and lyse on ice for 30 min. After lysis, centrifuge at 13,000 rpm for 30 min at 4°C, take part of the supernatant and put it into a pre-cooled EP tube. Detect the protein concentration by BCA method, and store the remaining supernatant sample at -20°C.

[0083] (2) SDS-PAGE gel electrophoresis: Prepare 12% separation gel and pour the gel slowly. After the separation gel is completely solidified, pour the prepared 5% concentration gel (the formula of separation gel and concentration gel is as follows) on the upper layer and insert the tooth comb. After solidification, remove the tooth comb, put the gel into the electrophoresis tank, and add 1×SDS electrophoresis buffer. Add protein samples to the sample wells and add protein markers on both sides of the sample wells. Separate the proteins by electrophoresis.

[0084] Reagents 12% separation gel (mL) 5% concentrated gel (mL) <![CDATA[ddH 2 The]]> 4.900 3.400 30% Acrylamide 6.000 0.830 1.5M Tris-HCl (pH = 8.8) 3.800 / 1.0M Tris-HCl (pH=6.8) / 0.63 10% SDS 0.150 0.050 10% AP 0.150 0.050 TEMED 0.006 0.005

[0085] (3) Transfer: Take the PVDF membrane and soak it in methanol for 30 seconds, wash it with distilled water for 2 minutes, then soak the PVDF membrane and filter paper in pre-cooled wet transfer solution, take the gel and soak it in pre-cooled wet transfer solution, and finally place the sponge, filter paper, PVDF membrane and gel in order from the positive electrode to the negative electrode. Transfer the membrane by constant current electrophoresis at 220 mA.

[0086] (4) Blocking: After transfer, place the PVDF membrane in 5% protein blocking solution and block at room temperature for 2 h.

[0087] (5) Antibody incubation: After washing the remaining blocking solution on the membrane with TBST, use qualitative filter paper to absorb the remaining liquid on the membrane, place the membrane on a wax plate, add the primary antibody working solution to evenly cover the PVDF membrane, and incubate at 4°C overnight; after recovering the primary antibody working solution, place the PVDF membrane in TBST and wash it three times, 10 min each time; add horseradish peroxidase-labeled secondary antibody to the PVDF membrane, incubate at room temperature for 1.5 h, and wash it three times with TBST, 10 min each time.

[0088] (6) Color development and imaging: In a dark room, place the PVDF membrane on a wax plate, then add the prepared chemiluminescent reagent (equal volumes of solution A and solution B) to cover the PVDF membrane, and display the image in an imaging system.

[0089] 1.2.3 t6A modification detection

[0090] (1) tRNA extraction: After collecting the cells obtained in step 1.1, add 1 mL TRIzol and 200 μL CHCl3, mix well and let stand for 2 min; centrifuge at 12000 g for 10 min, take the supernatant and add 1 / 3 volume of EtOH, mix well and add to the silica gel column, let stand for 1 min; centrifuge at 3500 g for 2 min, collect the lower filtrate; add 2 / 3 volume of EtOH, mix well and add to the silica gel column, let stand for 1 min; centrifuge at 3500 g for 2 min, discard the filtrate; add 200 μL RNA Prep Buffer (Zymo kit), centrifuge for 2 min, discard the lower layer, and wash twice; add 700 μl RNA Wash Buffer (Zymo kit), centrifuge for 2 min, discard the lower layer, and wash twice; centrifuge at 12000 g for 2 min, add 50 μL nuclease-free water, let stand for 2 min, centrifuge, and collect the eluate. The extracted tRNA was tested for concentration and subjected to 6% Urea-PAGE gel electrophoresis. After the samples were confirmed to be qualified, they were stored at -80°C.

[0091] (2) t6A modification detection

[0092] 1) Sample hydrolysis: Take an appropriate amount of total tRNA sample and place it in a 1.5 mL centrifuge tube. Add 1 / 7 of the total sample volume Buffer, pre-incubate at 37℃ for 10min; prepare mixed enzyme solution according to the volume specified in the table below:

[0093] Stock solution of reagent Volume(μL) 10U / μL RNase I 50 0.025U / μL phosphodiesterase I 100 0.025U / μL phosphodiesterase II 100 <![CDATA[RNase-free H 2 The]]> 250 Total volume 500

[0094] Add 10 μL of the mixed enzyme solution to the total tRNA, vortex to mix, and react in a constant temperature incubator at 37°C for 2.5-3 hours; add 2 μL of rSAP (1U / μL) and continue incubation for 1 hour; terminate the reaction after incubation at 70°C for 10 minutes, centrifuge at 10000 rpm for 10 minutes, and transfer the supernatant to a sample injection bottle for testing.

[0095] 2) Mass spectrometry

[0096] Chromatographic conditions:

[0097]

[0098]

[0099] Elution gradient:

[0100] Time (min) Mobile phase A% Mobile phase B% Flow rate 1 0.00min 98.00％ 2.00％ 0.200mL / min 2 6.00min 68.00％ 32.00％ 0.200mL / min 3 8.00min 20.00％ 80.00％ 0.200mL / min 4 9.00min 98.00％ 2.00％ 0.200mL / min 5 12.00min 98.00％ 2.00％ 0.200mL / min

[0101] Mass spectrometry conditions:

[0102] Source gas parameters Drying gas temperature 250℃ Drying gas flow 14L / min Atomizing gas pressure 50psi Sheath gas temperature 300℃ Sheath gas flow 11L / min

[0103] 3) MRM method:

[0104] Compound Name Precursor ion Product ions Dwell time Fragmentation voltage Collision Energy polarity t6A 413.1 281.1 10 380 18 Positive t6A_2 413.1 162.1 10 380 18 Positive A 268.1 136.1 10 380 5 Positive G 284.1 152.1 10 380 10 Positive

[0105] 4) Result analysis: The Student's t-test statistical test method was used to compare the patient group and the healthy control group for each compound.

[0106] 1.4 Statistical analysis

[0107] All data were obtained from three independent experiments. Unpaired Student's t-test was used to compare the means of two samples, and one-way analysis of variance was used to compare the data between multiple groups. The test level was α = 0.05, and P < 0.05 indicated that the difference was statistically significant.

[0108] 2. Experimental results

[0109] The knockdown efficiency of OSGEP was detected by qRT-PCR and Western blotting. Figure 5 As shown, Figure 5 A is the use of qRT-PCR to detect the expression level of OSGEP gene in HL-60 cell line to evaluate the knockdown efficiency. The results show that shOSGEP-1 and shOSGEP-3 have higher knockdown efficiency, so they were selected for subsequent experiments. Figure 5 B: Western blotting was used to verify the knockdown efficiency of OSGEP protein levels in shOSGEP-1 and shOSGEP-3. The results showed that OSGEP protein expression was reduced in shOSGEP-1 and shOSGEP-3. Figure 5 C is the t6A modification level. Compared with shNC, the t6A modification level in shOSGEP-1 and shOSGEP-3 cells was significantly reduced.

[0110] Example 4: Detection of the effect of knocking down the OSGEP gene on HL-60 cell proliferation

[0111] 1. Experimental Methods

[0112] The cell line obtained in step 1.1 of Example 3 was inoculated in a 96-well plate at 3000 cells per well, with 3 replicate wells set for each group. When the culture reached the corresponding time, 10 μL of CCK-8 reagent was added to each well, mixed and then cultured at 37°C for 4 h; the absorbance (OD) value was detected at a wavelength of 450 nm.

[0113] 2. Experimental results

[0114] Figure 6 In order to observe the changes of cell proliferation ability after knocking down OSGEP gene by CCK-8 experiment, the results showed that compared with shNC, shOSGEP-1( Figure 6 A) and shOSGEP-3 ( Figure 6 B) cell proliferation was inhibited.

[0115] Example 5: Detection of the effect of knocking down the OSGEP gene on apoptosis of HL-60 cells

[0116] 1. Experimental Methods

[0117] Collect the cell fluid of each group obtained in step 1.1 of Example 3, centrifuge at 1000g×5min, discard the supernatant, gently resuspend with PBS, take 50,000-100,000 resuspended cells, centrifuge at 1000g×5min, discard the supernatant, add 195μl Annexin V-FITC binding solution, gently resuspend the cells, add 5μl Annexin V-FITC, mix well; add 10μl propidium iodide staining solution, mix well; incubate at room temperature in the dark for 15min, and immediately detect using a flow cytometer after the reaction is completed.

[0118] 2. Experimental results

[0119] The results are as follows Figure 7 As shown, compared with shNC, shOSGEP-1( Figure 7 A) and shOSGEP-3 ( Figure 7B) The apoptosis rate was significantly increased.

[0120] Example 6: Detection of the effect of knocking down the OSGEP gene on the HL-60 cell cycle

[0121] 1. Experimental Methods

[0122] 1.1 Preparation of cell samples: Collect the cell fluids of each group obtained in step 1.1 of Example 3 and centrifuge at about 1000g for 5 minutes to precipitate the cells. Carefully remove the supernatant. Add about 1 ml of ice-cold PBS, resuspend the cells, and transfer to a 1.5 ml centrifuge tube. Centrifuge again to precipitate the cells and carefully remove the supernatant.

[0123] 1.2 Cell fixation: Add 1 ml of ice-cold 70% ethanol, gently pipette to mix, and fix at 4°C for 30 minutes or longer. Centrifuge at about 1000g for 5 minutes to precipitate the cells.

[0124] 1.3 Preparation of propidium iodide staining solution: Add 0.5 ml staining buffer, 25 μl propidium iodide staining solution (20X), and 10 μl RNase A (50X) to each sample.

[0125] 1.4 Staining: Add 0.5 ml of propidium iodide staining solution to each tube of cell sample, slowly and fully resuspend the cell pellet, and incubate at 37°C in the dark for 30 minutes.

[0126] 1.5 No need to wash, the sample is filtered through a 200-mesh cell filter and transferred to a flow cytometry tube.

[0127] 1.6 Flow cytometric detection and analysis: Red fluorescence was detected by flow cytometer at an excitation wavelength of 488 nm, and KALUZA analysis software was used to analyze the cell DNA content.

[0128] 2. Experimental results

[0129] To detect the effect of knocking down the OSGEP gene on the cell cycle of HL-60 cells, flow cytometry was used to detect the cell cycle distribution of HL-60 cells. Figure 8 As shown, in shOSGEP-1 cells ( Figure 8 A), the proportion of cells in the G1 phase increased, while the proportion of cells in the S and G2 phases decreased. In shOSGEP-3 cells ( Figure 8 B), the proportion of cells in the G1 phase increased, and the proportion of cells in the S phase decreased, indicating that the cell cycle was arrested in the G1 phase.

[0130] Example 7: Inhibitory effect of cytarabine on HL-60 cell activity

[0131] 1. Experimental Methods

[0132] The shOSGEP-1 and shNC cells obtained in step 1.1 of Example 3 were collected and diluted to 50,000 cells / ml, respectively, and complete culture medium (IMDM culture medium + 20% FBS + 1% penicillin / streptomycin double antibody solution + 0.25ug / ml puromycin) was added. 100 μL / well of cells were added to a 96-well plate and placed at 37°C and 5% CO 2 The cells were cultured in a cell culture incubator. Different concentrations of cytarabine (0, 0.4, 0.8, 1.2, 1.6, 2.0, 2.4, 2.8, 3.2, and 3.6 μM) were added, and the relative survival rate of the cells was measured after 48 h of culture, and the maximum half inhibitory dose (IC 50 ).

[0133] 2. Experimental results

[0134] like Fig. 9 The relative survival rates and half-maximal inhibitory dose (IC50) of shOSGEP-1 and shNC cells after incubation with different concentrations of cytarabine for 48 hours. 50 ). The results showed that under the same drug concentration treatment conditions, compared with shNC cells, OSGEP knockdown cells had stronger cell activity and a higher maximum half-inhibitory dose value, that is, they showed drug tolerance. Cytarabine is a commonly used drug for the treatment of acute myeloid leukemia (AML). Knockdown cell lines showed greater tolerance to cytarabine, indicating that the OSGEP gene may be related to the mechanism of action of cytarabine.

[0135] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0136] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Use of the OSGEP gene or a reagent for detecting the expression of the OSGEP gene in the preparation of a kit for detecting acute myeloid leukemia.

2. The use according to claim 1, wherein the nucleotide sequence of the OSGEP gene is shown in SEQ ID NO:

1.

3. Use of a primer set for amplifying the OSGEP gene in preparing a kit for detecting acute myeloid leukemia, the primer set comprising a forward primer having a sequence as shown in SEQ ID NO: 6 and a reverse primer having a sequence as shown in SEQ ID NO:

7.

4. A kit for detecting acute myeloid leukemia, characterized in that: The kit comprises a reagent for detecting the expression amount of the OSGEP gene.

5. The kit according to claim 4, characterized in that The reagent for detecting the expression amount of the OSGEP gene includes a primer set for amplifying the OSGEP gene, and the primer set includes a forward primer with a sequence as shown in SEQ ID NO:6 and a reverse primer with a sequence as shown in SEQ ID NO:

7.

6. Use of the kit for detecting acute myeloid leukemia according to claim 4 or 5 in the preparation of products for screening, diagnosing, dynamically monitoring the course of acute myeloid leukemia or evaluating the prognosis of acute myeloid leukemia patients.

7. Use of the OSGEP gene in the preparation of drugs for preventing and / or treating acute myeloid leukemia.

8. Application of OSGEP gene in the preparation of drug products for screening acute myeloid leukemia.

9. Use of a cell line with suppressed OSGEP gene expression in screening drugs for acute myeloid leukemia; preferably, the cell line is HL-60 cells.

10. The use according to claim 9, characterized in that The cell line in which OSGEP gene expression is inhibited is a cell line that can stably express short hairpin RNA that inhibits OSGEP gene expression; preferably, the DNA sequence corresponding to the short hairpin RNA is as shown in SEQ ID NO:8 or SEQ ID NO:10, and more preferably, the DNA sequence corresponding to the short hairpin RNA is as shown in SEQ ID NO:8.

Images