Primer probe combination for detecting salmonella gallinarum, kit and application

Abstract

The invention provides a primer probe combination for detecting salmonella gallinarum, a kit and application, and belongs to the technical field of biological detection. In the primer probe combination, an upstream primer sequence of a primer is as shown in SEQ ID NO. 1; the sequence of a downstream primer of the primer is as shown in SEQ ID NO. 2; and the sequence of the probe is as shown in SEQ ID NO. 3. A primer probe combination is designed for a target gene, shown as SEQ ID NO.4, of salmonella gallinarum, the primer probe combination is high in salmonella gallinarum detection sensitivity, the sensitivity is 2.15 * 10 < 1 > copy number, and the salmonella gallinarum can be specifically detected from escherichia coli, salmonella pullorum, salmonella enteritidis and salmonella typhimurium. Meanwhile, the period of detecting the salmonella gallinarum by using the primer probe combination is short, and the operation detection and the result are easy to read.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to a primer-probe combination, a kit and an application thereof for detecting Salmonella typhi. Background Art

[0002] Salmonella is an important zoonotic pathogen and an important foodborne pathogen. It can cause infection and disease in humans and a variety of animals, seriously affecting the healthy development of the breeding industry and public health safety. Salmonella Gallinarum is a serotype of Salmonella. It can cause septicemic infectious diseases in poultry. Sick chickens can die quickly. It mainly harms poultry over 3 months old. It mainly occurs in chickens, but can also infect turkeys and ducks, showing symptoms such as diarrhea, anorexia, and lack of energy. It can cause disease in chicks and adult chickens, and is characterized by anemia, leukocytosis, and bleeding. Salmonella Gallinarum is a bacteria that causes serious harm in the poultry industry. Therefore, in veterinary clinics, differential diagnosis of Salmonella Gallinarum is extremely important.

[0003] At present, the detection technologies for Salmonella mainly include bacterial isolation and culture and biochemical identification, immunological technology, molecular biology technology, etc. Traditional detection methods such as bacterial isolation and culture are time-consuming and labor-intensive, cumbersome to operate and low in detection efficiency, and cannot meet the requirements of rapid detection; immunological technology has low sensitivity and specificity, and it is difficult to distinguish some serotypes or biotypes of Salmonella, especially Salmonella pullorum and Salmonella gallinarum. Therefore, there is an urgent need for a rapid, specific and sensitive detection method to detect Salmonella gallinarum in a timely manner, which is of great significance for the effective prevention and control of chicken typhoid. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a primer-probe combination, a kit and an application for detecting Salmonella typhi. The probe-primer combination has high sensitivity, strong specificity and good repeatability in detecting Salmonella typhi.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a primer-probe combination for detecting Salmonella typhi. The upstream primer sequence of the primer is shown as SEQ ID NO.1; the downstream primer sequence of the primer is shown as SEQ ID NO.2; and the sequence of the probe is shown as SEQ ID NO.3.

[0007] Preferably, the 5' end of the probe is labeled with a fluorescent group; and the 3' end of the probe is labeled with a quenching group.

[0008] Preferably, the fluorescent group includes FAM, and the quenching group includes MGB.

[0009] The present invention also provides a kit for detecting Salmonella typhi, wherein the kit comprises a PCR reaction system, and the PCR reaction system comprises the above-mentioned primer-probe combination.

[0010] Preferably, the PCR reaction system also includes 2×T5 FastqPCRMix.

[0011] Preferably, based on a total volume of 20 μL, the PCR reaction system is 10 μL of 2×T5 FastqPCRMix, 1.4 μL of 10 μM upstream primer, 1.4 μL of 10 μM downstream primer, 1.2 μL of 10 μM probe, 1 μL of test sample, and ddH2O is added to make up to 20 μL.

[0012] Preferably, the kit further comprises one or both of a positive control and a negative control; the positive control is a DNA sample of a Salmonella typhi gene, the sequence of which is shown in SEQ ID NO.4.

[0013] The present invention also provides an application of the primer-probe combination in preparing a product for detecting Salmonella typhi.

[0014] The present invention also provides a method for detecting Salmonella typhi, which is a method for non-disease diagnosis purposes and comprises the following steps:

[0015] The genomic DNA of the test sample and the control sample are added to the above-mentioned PCR reaction system respectively, and then the PCR reaction is carried out using the PCR amplification reaction program, and the results are analyzed by the fluorescence intensity of the test sample and the control sample; the control sample is one or both of the above-mentioned positive control and negative control.

[0016] Preferably, the PCR amplification reaction procedure is pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and 30 cycles.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention provides a primer-probe combination, a kit and an application for detecting Salmonella typhi. The present invention designs a primer-probe combination for the target gene of Salmonella typhi as shown in SEQ ID NO.4. The primer-probe combination has high sensitivity in detecting Salmonella typhi, with a sensitivity of 2.15×10 1 The copy number can be determined, and Salmonella typhi can be specifically detected from Escherichia coli, Salmonella pullorum, Salmonella enteritidis, and Salmonella typhimurium. At the same time, the detection cycle of Salmonella typhi using primer-probe combination is short, the operation detection is convenient, and the results are easy to read. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Draw a standard curve diagram for Example 4;

[0020] Figure 2 The sensitivity test results of detecting Salmonella typhi using the primer-probe combination described in Example 1 are as follows;

[0021] Figure 3 The sensitivity test results of the common PCR method for detecting Salmonella typhimurium;

[0022] Figure 4 This is the specific result of detecting Salmonella typhi using the primer-probe combination described in Example 1. DETAILED DESCRIPTION

[0023] The invention provides a primer-probe combination for detecting Salmonella typhi. The upstream primer sequence of the primer is shown as SEQ ID NO.1; the downstream primer sequence of the primer is shown as SEQ ID NO.2; and the sequence of the probe is shown as SEQ ID NO.3.

[0024] In the present invention, the 5' end of the probe is labeled with a fluorescent group; the 3' end of the probe is labeled with a quenching group. As a preferred embodiment, the fluorescent group includes FAM, and the quenching group includes MGB. The fluorescent group (donor) is labeled at the 5' end of the probe, and the quenching group (acceptor) is labeled at the 3' end of the probe. When the probe is complete, the distance between the fluorescent group and the quenching group is very close (probe length). Due to fluorescence resonance energy transfer, the fluorescent group does not emit fluorescence under the excitation of incident light. During the PCR reaction, the probe hybridizes on the amplification product. When the primer-mediated extension reaction reaches the probe position, the Taq enzyme has a 5'-3' exonuclease activity, which will cut (hydrolyze) the probe from the 5' end, thereby separating the fluorescent group at the 5' end and the quenching group at the 3' end, so that their distance exceeds 10nm, which exceeds the range of fluorescence resonance energy transfer. At this time, the fluorescent group can emit fluorescence of its own wavelength under the action of appropriate incident light. When the specific probe hybridizes with the corresponding allele, the DNA polymerase is active, the probe is cut and hydrolyzed, and fluorescence is emitted.

[0025] The present invention also provides a kit for detecting Salmonella typhi, the kit comprising a PCR reaction system, the PCR reaction system comprising the above-mentioned primer-probe combination. The PCR reaction system also comprises 2×T5 Fast qPCRMix. As one embodiment, based on a total volume of 20 μL, the PCR reaction system is 10 μL of 2×T5 Fast qPCR Mix, 1.4 μL of 10 μM upstream primer, 1.4 μL of 10 μM downstream primer, 1.2 μL of 10 μM probe, 1 μL of test sample, and ddH2O is added to make up to 20 μL. The present invention can efficiently detect Salmonella typhi by optimizing the PCR reaction system.

[0026] In the present invention, the kit further comprises one or both of a positive control and a negative control; the positive control is a DNA sample of a Salmonella typhi gene, the sequence of which is shown in SEQ ID NO.4; and the negative control is ddH2O.

[0027] The present invention also provides an application of the primer-probe combination in preparing a product for detecting Salmonella typhi.

[0028] In the present invention, the product includes a reagent or a kit.

[0029] The present invention utilizes the primer-probe combination to rapidly detect Salmonella typhi, with strong specificity, high sensitivity and good stability.

[0030] The present invention also provides a method for detecting Salmonella typhi, which is a method for non-disease diagnosis purposes and comprises the following steps:

[0031] The genomic DNA of the test sample and the control sample are added to the above-mentioned PCR reaction system respectively, and then the PCR reaction is carried out using the PCR amplification reaction program, and the results are analyzed by the fluorescence intensity of the test sample and the control sample; the control sample is one or both of the above-mentioned positive control and negative control.

[0032] As a preferred embodiment, the PCR amplification reaction procedure is pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and 30 cycles. The present invention can improve the sensitivity and specificity of detecting Salmonella typhi through the above PCR amplification reaction procedure.

[0033] According to the fluorescence intensity analysis results of the test sample and the control sample of the present invention, if the fluorescence intensity of the test sample has a significant change compared with the control sample, or the test sample can emit fluorescence, it indicates that the test sample is Salmonella typhi.

[0034] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0035] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0036] In the following examples, the 2×T5 Fast qPCR Mix was purchased from Qingke Biotechnology with the catalog number TSE301. The pClone007 Versatile Simple Vector was purchased from Beijing Qingke Biotechnology with the catalog number TSV-007VSm / TSV-007VS. The 2×TaqPCR Master Mix was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0037] Example 1

[0038] A primer-probe combination for detecting Salmonella typhi, wherein the upstream primer sequence of the primer is 5'-CCGTACCTGCCGTTATCCAG-3' (SEQ ID NO.1); the downstream primer sequence of the primer is 5'-CAGTACGTTGTCCAGCCGC-3' (SEQ ID NO.2); the sequence of the probe is 5'-CTTGCCGTCATTATC-3' (SEQID NO.3), wherein the 5' end of the probe sequence is modified with FAM, and the 3' end is modified with MGB.

[0039] Example 2

[0040] A kit for detecting Salmonella typhi, comprising a PCR reaction system, wherein the PCR reaction system comprises 10 μL of 2×T5 Fast qPCR Mix, 1.4 μL of the 10 μM upstream primer described in Example 1, 1.4 μL of the 10 μM downstream primer described in Example 1, 1.2 μL of the 10 μM probe described in Example 1, and 1 μL of a test sample, supplemented to 20 μL with ddH2O.

[0041] Example 3

[0042] Optimization of Fluorescence Quantitative PCR Reaction Conditions

[0043] 1. Optimization of primer and probe dosage

[0044] In this embodiment, the amounts of primers and probes are optimized, and are divided into reaction system 1, reaction system 2, reaction system 3 and reaction system 4, as follows:

[0045] Reaction system 1: 2×T5 Fast qPCR Mix 10 μL, 10 μM upstream primer described in Example 1 0.35 μL, 10 μM downstream primer described in Example 1 0.35 μL, 10 μM probe described in Example 1 0.3 μL, test sample 1 μL, add ddH2O to make up to 20 μL.

[0046] Reaction system 2: 2×T5 Fast qPCR Mix 10 μL, 10 μM upstream primer described in Example 1 0.7 μL, 10 μM downstream primer described in Example 1 0.7 μL, 10 μM probe described in Example 1 0.6 μL, test sample 1 μL, add ddH2O to make up to 20 μL.

[0047] Reaction system 3: 2×T5 Fast qPCR Mix 10 μL, 1.4 μL of 10 μM upstream primer described in Example 1, 1.4 μL of 10 μM downstream primer described in Example 1, 1.2 μL of 10 μM probe described in Example 1, 1 μL of test sample, add ddH2O to make up to 20 μL.

[0048] Reaction system 4: 2×T5 Fast qPCR Mix 10 μL, 10 μM upstream primer 2.1 μL, 10 μM downstream primer 2.1 μL, 10 μM probe 1.8 μL, test sample 1 μL, add ddH2O to make up to 20 μL.

[0049] The test sample in this embodiment is a recombinant plasmid.

[0050] Construction of recombinant plasmid:

[0051] (1) Amplification primer sequences of the target gene: upstream primer: 5'-CCGTACCTGCCGTTATCCAG-3' (SEQ ID NO.1), downstream primer: 5'-CAGTACGTTGTCCAGCCGC-3' (SEQ ID NO.2), amplification reaction system (total volume 20 μL): 10 μL 2×Taq PCR MasterMix, 1 μL 10 μM upstream primer, 1 μL 10 μM downstream primer, 0.5 μL 10 μM template, 7.5 μL ddH2O. Amplification reaction procedure: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 30 cycles; final extension at 72°C for 7 min. Gel recovery of target gene fragments, gel recovery kit purchased from Axygen, USA, catalog number AP-GX-50. Identification and sequencing of the target gene recovery, the nucleotide sequence of the target gene is as follows:

[0052] CCGTACCTGCCGTTATCCAGAGAAACGCTTGCCGTCATTATCGCCGGG

[0053] AAGCTGGCGCGGCTGGACAACGTACTGCGCGCCCGCTTCGGCGCGGAGGT

[0054] GGTGATTGAGCCGGAGGTGACCGACGAAATCATGCAGCGCGTCACCCGCG

[0055] CCGAAAACGGCGCGCGGATGCTGGAGTCGGTCATCGACGGCGAGATGCTG

[0056] CCGCCGCTCTCCCTGCTGCTGTTGCAGAAAATGGCGGCGAATATCGCCATT

[0057] GCCCGTATCACGCTGGGCGTGGCAAACGGCGCGTTTACCGCGGATGTGGA

[0058] GGATGTGCCGGATGAGGATACTCAGC (SEQ ID NO. 4).

[0059] (2) Connecting the target gene and plasmid: 3 μL of pClone007 Versatile SimpleVector (purchased from Beijing Qingke Biotechnology, catalog number TSV-007VSm / TSV-007VS), 1 μL of the amplified target sequence, and 1 μL of ddH2O were added to a microcentrifuge tube and allowed to stand at room temperature for 5 min to obtain a reaction liquid. 5 μL of the reaction liquid was added to 100 μL of Trelef5α competent cells (purchased from Beijing Qingke, catalog number TSC-01) and placed on ice for 30 min, heat-shocked at 42°C for 45 seconds, and then placed on ice for 1 min. 890 μL of LB broth medium was added and cultured at 37°C with shaking at 200 rpm for 60 min. The plate was then spread on an ampicillin-resistant LB agar plate and positive clones were selected for PCR identification. The recombinant plasmid was extracted from the positive bacterial clones.

[0060] The extraction kit used was the plasmid mini-extraction kit (Cat. No.: DP103) from Tiangen Biochemical Technology (Beijing) Co., Ltd. The extraction method was as follows: ① Add 500 μL of the balance solution BL to the adsorption column CP3, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. ② Take 3 mL of overnight cultured bacterial solution, add it to a centrifuge tube, use a regular desktop centrifuge, centrifuge at 12,000 rpm for 1 min, and remove the supernatant as much as possible. ③ Add 250 μL of solution P1 to the centrifuge tube with bacterial precipitate, and use a vortex oscillator to thoroughly suspend the bacterial precipitate. ④ Add 250 pL of solution P2 to the centrifuge tube, gently flip it up and down 8 times to fully lyse the bacteria. ⑤ Add 350 μL of solution P3 to the centrifuge tube, immediately and gently flip it up and down 8 times, mix it thoroughly, and a white flocculent precipitate will appear. Centrifuge at 12,000 rpm for 10 min. ⑥ Use a pipette to transfer the supernatant collected in the previous step to the adsorption column CP3 adsorption column, centrifuge at 12000rpm for 60s, pour out the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube. ⑦ Add 500μL of deproteinization solution PD to the adsorption column CP3, centrifuge at 12000rpm for 30-60s, pour out the waste liquid in the collection tube, and put the adsorption column CP3 back into the collection tube. ⑧ Add 600μL of rinse solution PW to the adsorption column CP3, centrifuge at 12000rpm for 60sec, pour out the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube. ⑨ Repeat step 8. ⑩ Place the adsorption column CP3 in the collection tube and centrifuge at 12000rpm for 2min to remove the residual rinse solution in the adsorption column. Place the adsorption column CP3 in a clean centrifuge tube, add 80 μL of elution buffer EB to the middle of the adsorption membrane, leave at room temperature for 2 minutes, centrifuge at 12000 rpm for 2 minutes to collect the plasmid solution into the centrifuge tube. Use Nanodrop2000 spectrophotometer to measure the plasmid concentration.

[0061] Using the primer-probe combination described in Example 1, the recombinant plasmid constructed above was used as the test sample, and the target gene in Salmonella typhi was detected by PCR method using the above reaction systems 1 to 4 through PCR reaction procedures. The PCR reaction procedure is:

[0062] Pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, 30 cycles.

[0063] The above PCR reaction procedure was used for amplification, and the concentration gradient with the smallest Ct value and the highest fluorescence value was the optimal dosage for the reaction. The results are shown in Table 1.

[0064] Table 1 Detection results of different primer and probe dosages

[0065]

[0066]

[0067] The results in Table 1 show that reaction system 3 is the optimal amount of primers and probes.

[0068] 2. Optimization of annealing temperature

[0069] Using the primer-probe combination described in Example 1 and the recombinant plasmid constructed as described above as the detection sample, the target gene in Salmonella typhi was detected by the PCR method using reaction system 3 through the following PCR reaction procedures.

[0070] The PCR reaction program is divided into: PCR reaction program 1, PCR reaction program 2 and PCR reaction program 3.

[0071] The PCR reaction program 1 is pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 56°C for 30 s, and 30 cycles.

[0072] The PCR reaction program 2 is pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and 30 cycles.

[0073] The PCR reaction program 3 is pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 64°C for 30 s, and 30 cycles.

[0074] After amplification through the PCR reaction program, the concentration gradient with the smallest Ct value and the highest fluorescence value was the optimal reaction annealing temperature. The results are shown in Table 2.

[0075] Table 2 Detection results of different annealing temperatures

[0076] Annealing temperature 56℃ 60℃ 64℃ Detect sample CT value 18.166 17.081 18.025 Detection peak signal value 4.500E+06 9.000E+06 7.000E+06

[0077] The results in Table 2 show that 60°C is the best annealing temperature for the reaction.

[0078] Example 4

[0079] The concentration of the recombinant plasmid prepared in Example 3 was determined, and the copy number was calculated. The recombinant plasmid was diluted in a 10 gradient until it was diluted to 10 7 copies / μL, and the recombinant plasmid of each dilution was used as the DNA template. The primer-probe combination described in Example 1 was used to amplify according to the reaction system 3 and PCR reaction procedure 2 of Example 3. A standard curve was drawn based on the Ct value as the ordinate and the logarithm of the plasmid copy number as the abscissa, and the linear regression equation, R 2 and amplification efficiency values.

[0080] The concentration of the recombinant plasmid prepared in Example 3 was 100.781 ng / μL, and the copy number was 2.15E+10 copies / μL.

[0081] Table 3 Copy numbers and CT values ​​detected at different dilution factors

[0082]

[0083]

[0084] According to the results in Table 3, a standard curve was drawn based on the Ct value as the ordinate and the logarithm of the plasmid copy number as the abscissa. Figure 1 .

[0085] Depend on Figure 1 The results show that the standard curve equation is: y = -3.1403x + 41.277, the slope is -3.1403, R 2 The value of the standard curve is 0.9985, and the amplification efficiency is 1.081809151. It can be seen that the standard curve has a good linear relationship.

[0086] Example 5

[0087] The concentration of the recombinant plasmid prepared in Example 3 was determined, and the copy number was calculated. The recombinant plasmid was diluted in a 10 gradient until it was diluted to 10 9 copies / μL, and the recombinant plasmid of each dilution was used as the DNA template. The primer-probe combination described in Example 1 was used to perform absolute quantitative qPCR amplification according to the reaction system 3 and PCR reaction procedure 2 of Example 3. The results are shown in Figure 2 .

[0088] At the same time, the concentration of the recombinant plasmid prepared in Example 3 was determined, and the copy number was calculated. The recombinant plasmid was diluted in a 10 gradient until it was diluted to 10 9 copies / μL, and each dilution recombinant plasmid was used as a DNA template. Amplification was performed according to the common PCR method. The amplification results are shown in Figure 3 .

[0089] The upstream primer of the common PCR method: 5'-CCGTACCTGCCGTTATCCAG-3' (SEQ ID NO.1), the downstream primer: 5'-CAGTACGTTGTCCAGCCGC-3' (SEQ ID NO.2). The detection system (total volume 20μL): 10μL 2×TaqPCRMasterMix, 1μL 10μM upstream primer, 1μL 10μM downstream primer, 1μL template (recombinant plasmid), 7μL ddH2O. The detection conditions: pre-denaturation at 95℃ for 5min; denaturation at 95℃ for 30s, annealing at 56℃ for 30s, extension at 72℃ for 30s, 30 cycles; final extension at 72℃ for 7min.

[0090] The sensitivity of the qPCR method of the present invention and the common PCR method was compared, and the minimum copy number with a CT value less than or equal to 30 was taken as the sensitivity.

[0091] Figure 2 and Figure 3 The results show that the sensitivity of the qPCR method of the present invention can reach 2.15×10^1 copy number, and the sensitivity of ordinary PCR can reach 2.15×10^3 (CT value is less than or equal to 30).

[0092] Example 6

[0093] Real-time fluorescence quantitative PCR specific detection

[0094] Using the primer-probe combination described in Example 1, the absolute quantitative qPCR method was performed according to the reaction system 3 and PCR reaction procedure 2 of Example 3 to detect the genomic DNA of Escherichia coli (dachang group), Salmonella pullorum (jibail group), Salmonella enteritidis (changyan group), and Salmonella typhimurium (shushanghan group), respectively. At the same time, positive and negative controls were set up. The positive control was the recombinant plasmid prepared in Example 3 (jishanghan group), and the negative control was ddH2O (NTC group). The two groups were detected in parallel.

[0095] Figure 4 The results show that the primer-probe combination described in Example 1 of the present invention can specifically detect Salmonella typhi.

[0096] Example 7

[0097] The recombinant plasmid prepared in Example 3 with three dilutions of the same batch was used as a template, and real-time fluorescence quantitative PCR amplification was performed according to the method of Example 6, and a negative control group was set up, and the negative control was ddH2O. Three parallels were set up in each group for repeatability test, and the average value and the coefficient of variation within the group were calculated. The inter-group repeatability test was performed three times under the same reaction conditions, and the average value and the coefficient of variation between the groups were calculated. The intra-group and inter-group differences of the method were determined according to the coefficient of variation.

[0098] Table 4 Results of intra-group and inter-group repeatability tests using the primer-probe combination of the present invention

[0099]

[0100] The results in Table 4 show that the primer-probe combination of the present invention has good repeatability in detecting Salmonella typhi.

[0101] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer-probe combination for detecting Salmonella typhi, characterized in that: The upstream primer sequence of the primer is shown as SEQ ID NO.1; the downstream primer sequence of the primer is shown as SEQ ID NO.2; and the sequence of the probe is shown as SEQ ID NO.

3.

2. The primer-probe combination according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent group; the 3' end of the probe is labeled with a quenching group.

3. The primer-probe combination according to claim 2, characterized in that: The fluorescent group includes FAM, and the quenching group includes MGB.

4. A kit for detecting Salmonella typhi, characterized in that: The kit comprises a PCR reaction system, and the PCR reaction system comprises the primer-probe combination according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that The PCR reaction system also includes 2×T5 FastqPCRMix.

6. The kit according to claim 4, characterized in that Based on a total volume of 20 μL, the PCR reaction system is 2×T5 Fast qPCR Mix 10 μL, 10 μM upstream primer 1.4 μL, 10 μM downstream primer 1.4 μL, 10 μM probe 1.2 μL, and test sample 1 μL, and ddH2O is added to make up to 20 μL.

7. The kit according to claim 4, characterized in that The kit also includes one or both of a positive control and a negative control; the positive control is a DNA sample of a Salmonella typhi gene, and the sequence of the gene is shown in SEQ ID NO.

4.

8. Use of the primer-probe combination according to any one of claims 1 to 3 in the preparation of a product for detecting Salmonella typhi.

9. A method for detecting Salmonella typhi, characterized in that: The method is a method for non-disease diagnosis purposes, comprising the following steps: The genomic DNA of the test sample and the control sample are respectively added to the PCR reaction system described in any one of claims 4 to 6, and then the PCR reaction is carried out using the PCR amplification reaction program, and the results are analyzed by the fluorescence intensity of the test sample and the control sample; the control sample is one or both of the positive control and the negative control described in claim 7.

10. The method according to claim 9, characterized in that The PCR amplification reaction procedure is pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and 30 cycles.

Images