Genetic transformation method and application of muskmelon

Abstract

The invention provides a genetic transformation method and application of muskmelon. The genetic transformation method comprises the following steps: carrying out co-culture treatment on an infected muskmelon explant and agrobacterium engineering bacteria in a sugar-free culture medium, and the sugar-free culture medium does not contain soluble sugar. By using the method, the co-culture time can be prolonged to 7-9 days, the infection efficiency of agrobacterium tumefaciens can be remarkably improved, the growth of the agrobacterium tumefaciens can be slowed down, agrobacterium tumefaciens pollution in the bud induction process is avoided, meanwhile, the immunoreaction of explants in the co-culture process is reduced, and the genetic transformation efficiency is further improved. Compared with an existing melon genetic transformation method in which co-culture time lasts for 4 days by adopting a sugar-containing culture medium, the genetic transformation method provided by the invention adopts a sugar-free culture medium and the co-culture time is prolonged to 8 days, so that the melon transgenosis efficiency can be improved by 14 times or more. The invention also provides an application of the genetic transformation method in preparation of a melon genetic transformation product.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology, and particularly relates to a genetic transformation method and application of melon. Background Art

[0002] Melon is a fruit crop with important economic value. Plant molecular breeding provides a new approach for the directional breeding and genetic improvement of melon. Using transgenic technology to introduce genes into melon cells and stably inherit them, thereby creating new germplasm, is a new direction in melon breeding.

[0003] Agrobacterium-mediated genetic transformation is an important technology in plant genetic engineering, and has important applications in plant gene function research and crop genetic breeding. Agrobacterium-mediated genetic transformation includes two processes: explant transformation and regeneration of transformed tissues or cells into complete plants. Its efficiency is restricted by factors such as the infection activity of Agrobacterium, the resistance of plants to Agrobacterium, and the regeneration ability of explants. However, the Agrobacterium genetic transformation of melon still has the disadvantages of low efficiency, long cycle, time-consuming and labor-intensive. Melon genetic transformation usually includes explant preparation, Agrobacterium infection, co-cultivation, bud induction, rooting and other steps. The main reason for the low efficiency of melon genetic transformation is that Agrobacterium cannot effectively integrate T-DNA into tissues / cells with strong regeneration ability in explants. The co-cultivation step of genetic transformation is the process of Agrobacterium infecting explants and integrating the T-DNA fragment on the binary vector into the plant genome. It is the most important step in determining whether melon transformation can be successful. This co-cultivation stage generally lasts 2 to 4 days. Although extending the co-cultivation time has certain potential for promoting Agrobacterium infection and improving melon transformation efficiency, long-term co-cultivation often leads to excessive growth of Agrobacterium, stimulating plant immune defense reactions, inhibiting the regeneration ability of explants, and even causing explants to brown and die. Therefore, improving the infection ability of Agrobacterium while reducing the harm of Agrobacterium to explants is the key to achieving high genetic transformation efficiency.

[0004] Therefore, in the prior art, Xin et al. used nanobrush, ultrasound, and vacuum treatment to increase the wound of the explant, increase the infection intensity of Agrobacterium inside the explant, and used reducing agents during the co-cultivation process to reduce the damage of reactive oxygen to the explant; Parsa et al. promoted the infection of Agrobacterium to the explant by adjusting the concentration of the bacterial solution and the infection time during the infection of Agrobacterium, and used ethylene synthesis or signal transduction inhibitors to reduce the resistance of the explant to Agrobacterium; Wan et al. (Lili Wan et al., Optimized Agrobacterium-mediated transformation and application of developmental regulators improve regeneration efficiency in melons, Genes 2023, 14(7), 1432) used overexpression of developmental regulatory factors to improve the regeneration efficiency of melon.

[0005] The above measures have improved the efficiency of Agrobacterium-mediated genetic transformation of melon, but the transformation efficiency of melon is still relatively low and the transformation process needs to be further optimized. Summary of the invention

[0006] Research has found that during the genetic transformation of melon, using a sugar-free culture medium for co-cultivation during the co-cultivation stage can effectively avoid excessive growth of Agrobacterium due to the prolonged co-cultivation time even if the co-cultivation time is extended, reduce or avoid Agrobacterium contamination during the bud regeneration process, and ultimately improve the genetic transformation efficiency of melon; based on this, the present invention provides a genetic transformation method and application of melon.

[0007] The "sugar-free culture medium" described in the present invention refers to a culture medium that does not contain soluble sugars, that is, the soluble sugars are omitted from the existing culture medium.

[0008] Specifically, the present invention provides the following technical solutions: A method for genetic transformation of melons comprises the steps of co-culturing infected melon explants and Agrobacterium engineering bacteria in a sugar-free culture medium.

[0009] The sugar-free medium does not contain soluble sugars. The "soluble sugars" described in the present invention refer to soluble sugars that are added to the co-cultivation medium in the prior art to provide a carbon source for the growth of explants, but can also be efficiently utilized by Agrobacterium, including but not limited to sucrose, glucose, fructose, maltose, and arabinose. The cotyledon explants used in the present invention contain rich nutrients themselves, and no additional carbon source is required during the co-cultivation process.

[0010] The "Agrobacterium" mentioned in the present invention refers to the engineered Agrobacterium used for plant genetic transformation, including but not limited to Agrobacterium tumefaciens GV3101, EHA105, LBA4404, C58 and Agrobacterium rhizogenes K599, MUS440, Ar.Qual.

[0011] The "explant" mentioned in the present invention refers to a melon cotyledon explant with strong regeneration ability and rich nutrient reserve, and the explant hardly needs to take in additional carbon source from the culture medium during the co-cultivation stage.

[0012] The "co-cultivation" mentioned in the present invention refers to the use of appropriate conditions to maintain the co-growth of the melon explants and the Agrobacterium engineering bacteria during the co-cultivation stage of the infected melon explants and the Agrobacterium engineering bacteria, and neither the selection agent for positive transgenic cells nor the antibiotics that inhibit Agrobacterium are added to the culture medium.

[0013] Furthermore, the co-culture time of the infected melon explants and the Agrobacterium engineering bacteria in the sugar-free culture medium is 7 to 9 days.

[0014] In one embodiment of the present invention, the formula of the co-cultivation medium includes 4-5 g / L MS powder, 7.5-8.5 g / L agar, 18-22 mg / L acetosyringone, 0.9-1.1 mg / L 6-BA (6-benzylaminopurine), 0.9-1.1 mg / LABA (abscisic acid), 60-65 mg / L 2-morpholineethanesulfonic acid, 1.8-2.2 mg / L silver nitrate, and the pH is 5.6-5.8. The preparation method of the formula is as follows: dissolve 4-5 g of MS powder in 1 L of dd H2O, adjust the pH to 5.6-5.8, add 7.5-8.5 g of agar, and sterilize at 121°C for 20 min; when the temperature of the culture medium drops to 60°C, add the following reagents that have been previously sterilized by filtration in the clean bench: 1 mL of 18-22 mg / mL acetosyringone, 1 mL of 0.9-1.1 mg / mL 6-BA, 0.5 mL of 1.8-2.2 mg / mL ABA, 0.5 mL of 120-130 mg / mL 2-morpholineethanesulfonic acid, and 1 mL of 1.8-2.2 mg / mL silver nitrate.

[0015] In one embodiment of the present invention, the co-cultivation treatment method is: covering the above co-cultivation culture medium with a sterilized filter paper, placing the infected melon cotyledon explants on the culture medium, sealing with breathable medical tape, and incubating at 25° C. in the dark for 7 to 9 days.

[0016] The co-cultivation stage uses a sugar-free culture medium, which slows down the growth of Agrobacterium during the co-cultivation process and avoids damage to plant explants caused by excessive growth of Agrobacterium. At the same time, reducing the growth of Agrobacterium can also weaken the immune response of melon explants to Agrobacterium, further promoting the infection of Agrobacterium on the explants.

[0017] Preferably, the explant is a cotyledon explant of muskmelon. In one embodiment of the present invention, the method for preparing the explant comprises: preparing the explant using live muskmelon seeds that have not been subjected to germination treatment; thus, using the cotyledon explant prepared from the seeds in this state can reduce the generation of polyploid muskmelon regenerated seedlings.

[0018] In one embodiment of the present invention, the method for preparing the Agrobacterium engineered bacteria comprises transforming a plasmid vector into Agrobacterium to prepare the Agrobacterium engineered bacteria.

[0019] In one embodiment of the present invention, the method for constructing the plasmid vector comprises: CmPDS A gene editing target site was designed on the gene, and the nucleotide sequence of the target site was shown in SEQ ID NO.1: TAGTGAGATTGTGGGCGAT. The target site sequence was assembled into the gene editing vector pBSE402 to obtain melon CmPDS The gene editing plasmid vector pBSE402-PDS is a binary vector, and the T-DNA part of the binary vector contains a fluorescent protein expression element. In the co-cultivation stage, the infection intensity of Agrobacterium on the explant can be indicated according to the fluorescence expression, and the transgenic positive buds can also be screened according to the fluorescence expression in the bud induction stage.

[0020] The "fluorescent protein" refers to a protein that can emit corresponding fluorescence under the irradiation of an exogenous excitation light source, including but not limited to green fluorescent protein GFP, yellow fluorescent protein YFP, and red fluorescent protein DsRED2. In one embodiment of the present invention, the fluorescent protein used is enhanced green fluorescent protein eGFP.

[0021] In one embodiment of the present invention, a handheld fluorescent protein lamp (LUYOR-3415RG) is used to detect the expression of fluorescent protein, and corresponding filters and a digital camera are used to take fluorescent photos, and the proportion of the fluorescent expression area to the entire explant is calculated. The higher the proportion, the higher the infection intensity of Agrobacterium on the explant.

[0022] In one embodiment of the present invention, the genetic transformation method of melon further comprises the steps of: Induction of regenerating shoots; Regenerated shoots take root.

[0023] Wherein, the steps of inducing the regenerated buds and rooting the regenerated buds are both prior arts.

[0024] Therefore, compared with the prior art, the technical effect of the present invention is that the co-cultivation time is extended and the infection intensity of Agrobacterium on explants is increased; at the same time, the soluble sugar in the co-cultivation medium is removed, the growth of Agrobacterium is reduced, the immune response of melon explants to Agrobacterium is weakened, and the contamination of Agrobacterium in subsequent cultivation processes such as bud induction is avoided, and finally the genetic transformation efficiency of melon is improved, and its transformation efficiency reaches 2.84%.

[0025] The present invention also provides an application of the genetic transformation method in preparing a melon genetic transformation product, wherein the application comprises at least one of the following aspects: 1) Improve the infection efficiency of Agrobacterium on explants; 2) Enhance the ability of Agrobacterium to infect explants; 3) Slow down the growth of Agrobacterium during co-cultivation; 4) Reduce or avoid Agrobacterium contamination during bud induction; 5) Improve the efficiency of genetic transformation. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a graph showing the effect of extending the time and not using sucrose on the infection intensity of Agrobacterium during the co-cultivation process; Figure 2 This is a graph showing the effect of extending the time and not using sucrose on the growth of Agrobacterium during the co-cultivation process; Figure 3 is the effect of prolonged co-cultivation time and without sucrose on Agrobacterium contamination during bud induction; Figure 4 is the effect of not using sucrose on the expression of immune response marker genes in explants during co-culture; Figure 5 This is the identification picture of transgenic positive plants. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described in detail below through specific implementation methods.

[0028] The terms used in the present invention are all commonly used in the field. The raw materials, equipment, preparation processes, test methods, etc. used are all prior art in the field unless otherwise specified. The reagents and products used in the present invention are also commercially available. The sources, trade names, and components of the reagents used are indicated when they first appear.

[0029] Sources: The gene editing vector pBSE402 comes from Li Zheng's research group at Northwest Agriculture and Forestry University. eGFP , Cas9 and sgRNA When the vector is introduced into plant cells, eGFP The expression cassette will express green fluorescent protein, which will emit green fluorescence under blue light.

[0030] The melon material was XZM seeds preserved in our laboratory, belonging to the thick-skinned melon subspecies, summer melon variety, which had been self-pollinated and purified for more than 10 generations.

[0031] Competent Agrobacterium tumefaciens GV3101 and Escherichia coli strain DH5α were purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd.

[0032] LUYOR-3105RG fluorescent protein observation lamp was purchased from Shanghai Luyang Instrument Co., Ltd.

[0033] Example 1: Effects of Extended Co-cultivation Time and Culture Medium on Agrobacterium Infection Intensity (1) Vector construction In the melon CmPDS A gene editing target site was designed on the gene, and the nucleotide sequence of the target site was shown in SEQ ID NO.1: TAGTGAGATTGTGGGCGAT. The target site sequence was assembled into the gene editing vector pBSE402 to obtain melon CmPDS The gene editing vector pBSE402-PDS.

[0034] (2) Preparation of Agrobacterium engineering bacteria The pBSE402-PDS plasmid was transformed into the competent Agrobacterium tumefaciens GV3101 by heat shock method to obtain the engineered bacteria GV3101 / pBSE402-PDS, and the glycerol bacteria were stored at -80°C for future use.

[0035] (3) Infection of melon cotyledon explants Select intact melon seeds, soak them at 55℃ for 30 min, and remove the seed shells. Disinfect the shelled seeds with 75% alcohol for 1 min and 3% sodium hypochlorite for 15 min in a clean bench, cut and discard the 2 mm end of the radicle, and separate the two cotyledons as explants.

[0036] The engineered bacteria GV3101 / pBSE402-PDS were cultured overnight until OD 600 The bacterial solution was centrifuged and the supernatant was discarded. The bacterial solution was resuspended with infection solution to an OD of 0.7-0.9. 600 The Agrobacterium bacterial solution was mixed with the melon cotyledon explants and shaken in a sterile triangular flask for infection for 20 min.

[0037] The infection solution was prepared by dissolving 4.43 g MS powder and 30 g sucrose in 1 L ddH2O, adjusting the pH to 5.8, and sterilizing at 121°C for 20 min. When the culture medium was cooled to 60°C, 1 mL of 20 mg / mL acetosyringone, 0.5 mL of 125 mg / mL 2-morpholineethanesulfonic acid, and 200 μL of the surfactant SilwetL-77 were added to the clean bench.

[0038] (4) Co-cultivation of explants and Agrobacterium The infected cotyledon explants were dried on sterile filter paper, and placed on co-cultivation medium containing sucrose and sucrose-free medium, respectively, and the medium was covered with sterile filter paper, and cultured at 25° C. in the dark.

[0039] The preparation method of co-culture medium is as follows: dissolve 4.43g MS powder and 30g sucrose (only used in sugar-containing co-culture) in 1L ddH2O, adjust the pH to 5.8, add 8g agar, and sterilize at 121℃ for 20min. When the culture medium cools to about 60℃, add the following reagents that have been sterilized by filtration in the clean bench: 1mL of 20mg / mL acetosyringone, 1mL of 1mg / mL 6-BA, 0.5mL of 2mg / mL ABA, 0.5mL of 125mg / mL 2-morpholineethanesulfonic acid, and 1mL of 2mg / mL silver nitrate.

[0040] (5) Analysis of changes in Agrobacterium infection intensity during co-cultivation On the 1st to 9th day of co-cultivation, the expression of GFP protein in the explants was observed under 440 nm blue light excitation using LUYOR-3105RG fluorescent protein observation lamp, and photographed using a 500 nm filter combined with a digital camera. The proportion of GFP fluorescent area to the entire explant was analyzed using image J software to indicate the infection intensity of Agrobacterium. The results are shown in Figure 2. Figure 1 shown.

[0041] from Figure 1It can be seen that only after 4 days of culture on a sucrose-containing medium can obvious GFP fluorescence be observed on the explants. From the 4th day to the 7th day, the proportion of the GFP fluorescence expression area gradually increased to a maximum of 26.58%. On the 8th and 9th days, there was no obvious change in the GFP expression ratio. When sucrose was removed, obvious GFP fluorescence could be observed after 3 days of co-culture, reaching a peak of 41.81% on the 6th day. And at the same co-culture time, the GFP fluorescence ratio of the explants co-cultured without sugar was higher than that of the co-cultured with sugar. These data show that extending the co-culture time can improve the infection efficiency of Agrobacterium on explants to a certain extent, and the effect is more obvious when sucrose is removed from the co-culture medium.

[0042] Example 2: Effects of Extended Co-cultivation Time and Culture Medium on Agrobacterium Growth (1) Comparison of Agrobacterium growth on explants during co-cultivation The co-cultured explants in Example 1 were taken and the growth of Agrobacterium was detected on the 1st to 9th day of co-culture. During the detection, 2 mL of ddH2O was used to elute every 3 explants, and the absorbance of the eluate at 600 nm was measured to measure the growth of Agrobacterium. The eluate of explants cultured on a sugar-containing medium for the same time but not infected with Agrobacterium was used as a control. The results are shown in FIG. Figure 2 As shown. Figure 2 It can be seen that as the co-cultivation time increases, the content of Agrobacterium on the explants in different treatments gradually increases. On the 8th day of co-cultivation with sucrose medium, Agrobacterium reaches a maximum value of 0.55; without adding sucrose, Agrobacterium reaches a maximum value of 0.17 on the 6th day of co-cultivation, and then gradually decreases. On the 6th day of co-cultivation, the content of Agrobacterium in the sugar-free co-cultivation is 41% of that in the sugar-containing co-cultivation, and on the 8th day it is 15% of that in the sugar-containing culture. Therefore, it can be seen that the sucrose-free medium, that is, removing sucrose from the medium, can significantly slow down the growth of Agrobacterium during the co-cultivation process.

[0043] (2) Observation of Agrobacterium contamination during bud induction The explants co-cultured in the sucrose-containing medium for 8 days and the explants co-cultured in the sucrose-free medium for 8 days in Example 1 were further transferred to bud induction culture.

[0044] The preparation method of the bud induction medium is as follows: 4.43 g MS powder and 30 g sucrose are dissolved in 1 L ddH2O, the pH is adjusted to 5.8, 8 g agar is added, and the medium is sterilized at 121°C for 20 min. When the medium is cooled to about 60°C, the following reagents that have been sterilized by filtration are added in the clean bench: 1 mL of 6-BA at 1 mg / mL, 0.5 mL of ABA at 2 mg / mL, 1 mL of silver nitrate at 2 mg / mL, 1 mL of timentin at 200 mg / mL, and 1 mL of cephalosporin at 200 mg / mL.

[0045] The bud induction conditions were 26°C / light for 16 h, 22°C / dark for 8 h. After 14 days of bud induction, the growth of Agrobacterium was observed. Figure 3 As shown. Figure 3 It can be seen that after 8 days of co-cultivation on sugar-containing medium and 14 days of bud induction culture, a large number of Agrobacterium visible to the naked eye grew on the explants, while no obvious Agrobacterium contamination was observed on the explants co-cultivated on sugar-free medium after 14 days of bud induction culture.

[0046] Example 3: Effect of sucrose-free culture medium on the expression of immune response marker genes in melon explants during co-cultivation The explants co-cultured in the sucrose medium for 4 days and the non-sucrose medium for 4 days in Example 1 were taken as controls. The total RNA was extracted by Trizol method, and the cDNA was obtained by reverse transcription as a template. The immune response marker genes were detected by Realtime PCR. CmPR1 , CmNPR1 , CmFRK1 , CmICS1 , CmMAPK4 The expression level of CmActin1 As an internal reference gene, 2 -ΔΔCt The gene expression was calculated by the method, and the designed primer sequences were as follows: q CmPR1 -F: TGGATGTTCTCAAGCTTCCC (SEQIDNO.2); q CmPR1 -R:CGTTGTGGGCATTGACGAAG(SEQIDNO.3); q CmNPR1 -F:AGTGGTAGCTTTCCACTGCC(SEQIDNO.4); q CmNPR1 -R: CGAGGGAAGCACAATCGAGA (SEQIDNO.5); q CmFRK1-F:GCTTGGAAGGCAGTGGAGAT(SEQIDNO.6); q CmFRK1 -R:TCTAACGCCAAACACTCGCT(SEQIDNO.7); q CmICS1 -F:ATCAAGAAGCTGGAGGCACC(SEQIDNO.8); q CmICS1 -R: TTTCAACTCCGCCACTCCTC (SEQIDNO.9); q CmMAPK4 -F:GTCCTGCACCGTGATCTCAA(SEQIDNO.10); q CmMAPK4 -R: TGTCCTTGCCAACCCAAAGT (SEQIDNO.11); q CmActin1 -F: ATTCTTGCATCTCTAAGTACCTTCC (SEQIDNO.12); q CmActin1 -R: CCAACTAAAGGGAAATAACTCACC (SEQ ID NO.13).

[0047] The results of the relative expression of each gene are shown in Figure 4 shown. Figure 4 The results showed that compared with explants not infected by Agrobacterium, the expression levels of various marker genes in explants co-cultured with sucrose for 4 days after infection were significantly increased, indicating that Agrobacterium infection stimulated the immune response of melon. CmPR1 , CmFRK1 , CmICS1 , CmMAPK4 The expression of was significantly reduced, indicating that the melon explants had a low immune response to Agrobacterium. The underlying reason may be that compared with the co-culture with sucrose, the growth of Agrobacterium in the co-culture without sucrose was low, and the degree of stimulation of plant immune response was also lower. Reducing the immune response of the explants to Agrobacterium enhances the ability of Agrobacterium to infect the explants.

[0048] Example 4: Effects of Extended Co-cultivation Time and Sugar-free Culture Medium on Genetic Transformation Efficiency of Melon (1) Induction of regenerated shoots The melon cotyledon explants obtained in Example 1, which were co-cultured for 4 days with sucrose and for 8 days without sucrose, were transferred to bud induction medium for bud induction culture. The culture conditions for bud induction were the same as those in Example 2, and the culture time was 3 to 4 weeks.

[0049] (2) Rooting of regenerated seedlings Transgenic positive shoots expressing GFP fluorescence were selected and cut from the stem base when they grew to 2 to 3 cm. They were then transferred to rooting medium and induced to root for about 2 weeks. Figure 5 shown. Figure 5 The results showed that transgenic positive plants could emit green GFP fluorescence under 440 nm blue light, while transgenic negative plants could only observe red autofluorescence of chlorophyll. In addition, transgenic positive plants showed an albino phenotype, indicating that pBSE402-PDS functions normally in melon. CmPDS Genes are damaged.

[0050] The preparation method of rooting medium is as follows: add 50 mL of vermiculite and 40 mL of 4.43 g / L MS culture solution into a glass bottle and sterilize at 121°C for 20 min.

[0051] (3) Analysis of genetic transformation efficiency The ratio of the number of transgenic positive plants to the number of seeds used was used as the genetic transformation efficiency of melon. As shown in Table 1, through genetic transformation with sucrose co-cultivation for 4 days, 514 seeds were used to obtain 1 transgenic seedling, and the genetic transformation efficiency was 0.20%, while through genetic transformation without sucrose co-cultivation for 8 days, 530 seeds were used to obtain 15 transgenic seedlings, and the genetic transformation efficiency was 2.84%, which was 14.2 times the genetic transformation efficiency of co-cultivation with sucrose for 4 days.

[0052] Table 1. Statistics of genetic transformation efficiency In summary, the embodiment of the present invention adopts a sugar-free co-cultivation medium and prolongs the co-cultivation time, which increases the infection intensity of Agrobacterium on explants during the genetic transformation of melons; at the same time, it also reduces the growth of Agrobacterium, weakens the immune response of melon explants to Agrobacterium, and avoids the contamination of Agrobacterium in the subsequent cultivation process, and finally improves the genetic transformation efficiency of melons. And compared with the melon genetic transformation method using the existing sugar-containing medium with a co-cultivation time of 4 days, the genetic transformation method provided by the embodiment of the present invention adopts a sugar-free medium and prolongs the co-cultivation time to 8 days, which can increase the genetic transformation efficiency of melons by more than 14 times.

[0053] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, ordinary technicians in the field should understand that the specific implementation methods of the present invention can still be modified or some technical features can be replaced by equivalents without departing from the spirit of the technical solution of the present invention, which should be included in the scope of the technical solution for protection of the present invention.

Claims

1. A method for genetic transformation of melon, comprising: Co-culturing the infected melon explants with the engineered Agrobacterium in a sugar-free medium, wherein the sugar-free medium does not contain soluble sugar; Preferably, the soluble sugar includes at least one of sucrose, glucose, fructose, maltose and arabinose.

2. The genetic transformation method according to claim 1, characterized in that The co-cultivation treatment lasts for 7 to 9 days.

3. The genetic transformation method according to claim 2, characterized in that The co-cultivation treatment method comprises: covering the sugar-free culture medium with a sterilized filter paper, placing the infected melon cotyledon explants on the culture medium, sealing with a breathable medical tape, and incubating at 25° C. in the dark for 7 to 9 days.

4. The genetic transformation method according to claim 3, characterized in that The formula of the sugar-free culture medium includes 4-5 g / L MS powder, 7.5-8.5 g / L agar, 18-22 mg / L acetosyringone, 0.9-1.1 mg / L 6-BA, 0.9-1.1 mg / L ABA, 60-65 mg / L 2-morpholineethanesulfonic acid, 1.8-2.2 mg / L silver nitrate, and the pH is 5.6-5.

8.

5. The genetic transformation method according to any one of claims 1 to 4, characterized in that The explant is a muskmelon cotyledon explant; Preferably, the method for preparing the explant comprises preparing the explant using live melon seeds that have not been subjected to germination treatment.

6. The genetic transformation method according to claim 5, characterized in that The method for preparing the Agrobacterium engineering bacteria comprises transforming a plasmid vector into Agrobacterium to prepare the Agrobacterium engineering bacteria.

7. The genetic transformation method according to claim 6, characterized in that The construction method of the plasmid vector comprises: CmPDS A gene editing target site was designed on the gene, and the nucleotide sequence of the target site was shown in SEQ ID NO.1: TAGTGAGATTGTGGGCGAT. The target site sequence was assembled into the gene editing vector pBSE402 to obtain melon CmPDS The gene editing plasmid vector pBSE402-PDS.

8. The genetic transformation method according to any one of claims 1 to 4 or 6 or 7, characterized in that: Also includes the steps: Induction of regenerating shoots; Regenerated shoots take root.

9. Use of the genetic transformation method according to any one of claims 1 to 8 in preparing a melon genetic transformation product, the use comprising at least one of the following aspects: 1) Improve the infection efficiency of Agrobacterium on explants; 2) Enhance the ability of Agrobacterium to infect explants; 3) Slow down the growth of Agrobacterium during co-cultivation; 4) Reduce or avoid Agrobacterium contamination during bud induction; 5) Improve the efficiency of genetic transformation.

Images