Primer probe combination for rapidly detecting methylomonas in cold spring water body at constant temperature, kit and application

Abstract

The invention discloses a primer probe combination for rapidly detecting methylomonas in a cold spring water body at a constant temperature, a kit and application. The primers are shown as SEQ ID NO.2 and SEQ ID NO.3, and the fluorescent probe is 5 '-CCGTCCGCCACCTGTCATGGAGCAAGC (FAM-dT) C (THF) AA (BHQ1-dT) GTTACCGTT CGACT-C3-pacer-3', and the fluorescent probe is 5 '-CCGTCCGCCACCTGTCATGAGCAAGC (FAM-dT) C (THF) AA (BHQ1-dT) GTTACCGTT CGACT-C3-pacer-3'. According to the present invention, the real-time fluorescence recombinase polymerase amplification is performed on the to-be-detected sample by using the primer probe combination, the detection result can be obtained within 10 min at the temperature of 39 DEG C, the detection device is small and easy to carry, and the more convenient detection means is provided for the site and the resource-deficient place. The detection sensitivity of the kit is 10 times that of qPCR, and the reaction speed of the kit is higher than that of qPCR.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a primer-probe combination, a kit and an application thereof for rapid constant-temperature detection of high-abundance Methylomonas in a class of cold spring water bodies. Background Art

[0002] Methylomonas is a prominent microbial group in cold seeps. As a typical methanotroph, it plays a crucial role as a chemoautotroph in cold seep waters. Methylomonas also, to a certain extent, reflects methane concentrations in the in situ environment. Deep-sea experimental equipment is a crucial tool for effectively conducting deep-sea scientific experiments and verifying cutting-edge scientific and technological advancements. This equipment enables in situ detection of several microbial groups. Establishing effective microbial detection methods and applying them to deep-sea equipment is of great value for studying deep-sea ecosystems and uncovering extreme life processes.

[0003] Currently, qPCR is a common method for detecting specific microorganisms. However, conventional qPCR methods require complex processes, and the high temperatures required in the process lead to rapid power consumption, making long-term observation impossible. Therefore, in view of the special environmental conditions of cold springs, we need to establish simple, rapid, and low-energy detection methods as an effective technical means that can be used in deep-sea experimental platforms in the future. Currently, RPA technology has been applied to the detection of various nucleic acid viruses due to its simple operation, super specificity and sensitivity, and because it requires a low reaction temperature and short reaction time, it meets the low energy consumption requirements. Summary of the Invention

[0004] The purpose of the present invention is to overcome the technical problems of high complexity, slow reaction and high energy consumption in existing PCR technology, which limit its application in resource-scarce environments, and provide a primer-probe combination, a kit and its application for the rapid detection of high-abundance Methylomonas in a type of cold spring water at a constant temperature.

[0005] The kit constructed by the primer-probe combination of the present invention is used for detecting environmental samples and can quickly determine a type of high-abundance Methylomonas in cold spring environments.

[0006] In order to achieve the above-mentioned purpose of the present invention, the present invention adopts the following technical solutions:

[0007] The first object of the present invention is to provide a primer-probe combination for rapid detection of Methylomonas in cold spring water at a constant temperature, comprising an RPA primer pair and a fluorescent probe; the sequence of the RPA primer pair is as follows:

[0008] Forward primer: 5′-ATTGAACGCTGGTGGTATGCTTAACACATG-3′;

[0009] Reverse primer: 5′-ATTCCTACGCGTTACTCACCCGTCCGCCACTCGTC-3′;

[0010] The sequence of the fluorescent probe is as follows: 5′-CCGTCCGCCACTCGTCATCTGGAGCAAGC(FAM-dT)C(THF)AA(BHQ1-dT)GTTACCGTTCGACT-C3-spacer-3′.

[0011] In the above fluorescent probe sequence, the 29th C is a FAM-dT modified base; the 32nd A is a BHQ1-dT modified base.

[0012] The second object of the present invention is to provide the use of the above primer-probe combination in the preparation of a kit for rapid constant temperature detection of Methylomonas in cold spring water.

[0013] The third object of the present invention is to provide a kit for rapid constant temperature detection of Methylomonas in cold spring water, which comprises the above-mentioned primer-probe combination.

[0014] Preferably, the kit further comprises a fluorescence basic buffer, magnesium acetate and ultrapure water.

[0015] A fourth object of the present invention is to provide the use of the above-mentioned primer-probe combination or the above-mentioned kit in the rapid detection of Methylomonas in cold spring water at a constant temperature.

[0016] The application is an application in the constant temperature rapid detection of whether a type of high-abundance Methylomonas is contained in a cold spring environmental sample.

[0017] Preferably, the constant temperature is 39°C.

[0018] A fifth object of the present invention is to provide a method for rapid detection of Methylomonas in cold spring water at a constant temperature, comprising the following steps:

[0019] a. Collect cold spring water samples to be tested and extract total environmental DNA;

[0020] b. Using the DNA of step a as a template, performing real-time fluorescent recombinase polymerase amplification using the above primer probe combination or the above kit to obtain an amplified product;

[0021] c. If a fluorescent signal appears, the sample to be tested contains the target Methylomonas; if no fluorescent signal appears, the sample to be tested does not contain Methylomonas.

[0022] Preferably, the reaction system for real-time fluorescent recombinase polymerase amplification is: 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.8 μL of 10 μM probe, 25 μL of fluorescent basic buffer, 12.7 μL of ultrapure water, 5 μL of DNA template and 2.5 μL of magnesium acetate solution, a total of 50 μL.

[0023] Preferably, the reaction conditions of the real-time fluorescent recombinase polymerase amplification are: reaction at 39° C. for 10 minutes.

[0024] Preferably, the concentration of the DNA is 100-150 ng / μL.

[0025] The present invention has the following beneficial effects:

[0026] 1. The real-time RPA (real-time fluorescent recombinase polymerase amplification) technology established in this kit can obtain test results within 10 minutes at 39°C. The process is simple and energy consumption is low, providing a more convenient detection method for on-site and resource-scarce areas.

[0027] 2. The detection sensitivity of the kit of the present invention is 10 times that of qPCR. The detection of this kit is more sensitive than qPCR, and the reaction speed is faster than qPCR. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 From left to right: methyF1 and methyR1 (Methy_M1), methyF2 and methyR2 (Methy_M2), methyF3 and methyR3 (Methy_M3), methyF4 and methyR4 (Methy_M4), 2k marker, methyF1 and methyR1 (negative control), methyF2 and methyR2 (negative control), methyF3 and methyR3 (negative control), methyF4 and methyR4 (negative control).

[0029] Figure 2 This is the amplification curve of RPA using the forward primer methyF1, reverse primer methyR1, and probe probe_methy1.

[0030] Figure 3 This is the amplification curve of RPA under the conditions of 5-fold serial dilution of DNA using the forward primer methyF1, reverse primer methyR1, and probe probe_methy1. In order to collect fluorescence more concentratedly, 20 cycles were set, with 1 cycle of 30 seconds, for a total of 10 minutes. The undiluted concentration was 100 ng / μL, the 5-fold dilution concentration was 20 ng / μL, and the 5-fold dilution concentration was 20 ng / μL. 2The dilution was 4 ng / μL, 5 3 The dilution was 0.8 ng / μL, 5 4 The dilution factor was 0.16 ng / μL. The experimental results show that RPA showed a fluorescence signal in the first cycle, and a clear curve appeared at 10 minutes after 20 cycles.

[0031] Figure 4 This is the amplification curve of qPCR under the conditions of 5-fold serial dilution of DNA using the forward primer methyF1 and the reverse primer methyR1. In order to collect fluorescence more concentratedly, 20 cycles were set, 1 cycle 30s, and a total of 10 minutes. The undiluted value is 100ng / μL, the 5-fold dilution value is 20ng / μL, and the 5-fold dilution value is 20ng / μL. 2 The dilution was 4 ng / μL, 5 3 The dilution was 0.8 ng / μL, 5 4 The dilution was 0.16 ng / μL. DETAILED DESCRIPTION

[0032] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.

[0033] Example 1:

[0034] 1. Primer design: Design the required primers and probes

[0035] The RPA primer set was designed by selecting target fragments of different sizes based on 16s rRNA and designing 4 pairs of primers and probes.

[0036] The 16S rRNA sequence is as follows (SEQ ID NO. 1, which is the most abundant Methylomonas sequence obtained from full-length amplicon sequencing of cold spring bottom water):

[0037]

[0038] The sequences of the four pairs of primers are as follows:

[0039] Target fragment size is 100bp:

[0040] Forward primer methyF1: ATTGAACGCTGGTGGTATGCTTAACACATG (SEQ ID NO. 2) Reverse primer methyR1: ATTCCTACGCGTTACTCACCCGTCCGCCACTCGTC (SEQ ID NO. 3) Target fragment size is 100 bp:

[0041] Forward primer methyF2: CTCCTACGGGAGGCAGCAGTGGGGAATATTGGA (SEQ ID NO. 4) Reverse primer methyR2: AAGTGCTTTACAACCCTCAGGCCTTCTTCACACAC (SEQ ID NO. 5)

[0042] The target fragment size is 116 bp:

[0043] Forward primer methyF3: GCGGTGGAGCATGTGGTTTAATTCGATGCA (SEQ ID NO. 6) Reverse primer methyR3: GCAGCACCTGTATCTAAGCTCCCGAAGGCACCAAT (SEQ ID NO. 7)

[0044] The target fragment size is 115bp:

[0045] Forward primer methyF4: AATGGCCGGTACAGAGGGCTGCAAACTCGC (SEQ ID NO. 8) Reverse primer methyR4: GATTACTAGCGATTCCGACTTCATGCAGTC (SEQ ID NO. 9)

[0046] The sequences of the four probes are as follows:

[0047] probe_methy1:

[0048] CCGTCCGCCACTCGTCATCTGGAGCAAGC(FAM-dT)C(THF)AA(BHQ1-dT)GTTACCGTTCGACT-C3-spacer

[0049] probe_methy2:

[0050] TCAGGCCTTCTTCACACACGTGGTATTGC(FAM-dT)G(THF)A(BHQ1-dT)CAGGCTTG CGCCCA-C3-spacer

[0051] probe_methy3:

[0052] AACGCGAAGAACCTTACCTACCCTTGACA(FAM-dT)A(THF)(BHQ1-dT)AAGAACTTT CCAGA-C3-spacer

[0053] probe_methy4:

[0054] GCAGACTGCAATCCGGACTAAGACCGGCT(FAM-dT)(THF)C(BHQ1-dT)GAGATTCGC TTACT-C3-spacer

[0055] To verify the amplification effects of 4 pairs of primers, template sequences were synthesized correspondingly, and the template sequences are as follows:

[0056] Methy_M1: ATTGAACGCTGGTGGTATGCTTAACACATGCAAGTCGAACGGTAACATT GGAGCTTGCTCCAGATGACGAGTGGCGGACGGGTGAGTAACGCGTAGGAATCTGCCTA GTA(SEQ ID NO.10)

[0057] Methy_M2: ACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATG GGCGCAAGCCTGATCCAGCAATACCACGTGTGTGAAGAAGGCCTGAGGGTTGTAAAGC ACTTTCAATTGGGA(SEQ ID NO.11)

[0058] Methy_M3: GCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAG AACCTTACCTACCCTTGACATACTAAGAACTTTCCAGAGATGGATTGGTGCCTTCGGGAGCTTAGATACAGGTGCTGCATGGCTGTCG(SEQ ID NO.12)

[0059] Methy_M4: CACGTGCTACAATGGCCGGTACAGAGGGCTGCAAACTCGCGAGAGTAA GCGAATCTCAGAAAGCCGGTCTTAGTCCGGATTGCAGTCTGCAACTCGACTGCATGAAGTCGGAATCGCTAGTAATCGCGAATCAGA (SEQ ID NO. 13)

[0060] 2. Establish a non-fluorescent RPA reaction system

[0061] Real-time RPA reactions were performed in a 50 μL volume using the basic nucleic acid amplification reagent (Cat. No. S001ZC) from Hangzhou Zhongce Biotechnology Co., Ltd. The RPA reaction system in each reaction tube consisted of: 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.8 μL of 10 μM probe, 25 μL of ABuffer (basic buffer) provided by the kit, 12.7 μL of ultrapure water, 5 μL of the designed DNA template (5 μL of ultrapure water for the negative control), and 2.5 μL of B Buffer (magnesium acetate solution) provided by the kit, for a total of 50 μL.

[0062] Add the reactants to each reaction tube in the following order: 12.7 μL of ultrapure water, 25 μL of A Buffer, 5 μL of DNA template, 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.8 μL of 10 μM probe, and 2.5 μL of B Buffer. Then place the reaction tube in a PCR instrument and react at 39°C for 10 min.

[0063] After the reaction is completed, 50 μL of Tris-saturated phenol: chloroform: isoamyl alcohol (volume ratio 25:24:1) extract (Product No. P1012) produced by Beijing Solebow Technology Co., Ltd. is added to the detection unit tube. After shaking, centrifuge at 12000 rpm / min for 5 minutes. Take 8 μL of the supernatant and mix it with 2 μL of 6× loading buffer (Product No. 9156) produced by Takara and perform electrophoresis detection.

[0064] Figure 1From left to right: methyF1 and methyR1 (Methy_M1), methyF2 and methyR2 (Methy_M2), methyF3 and methyR3 (Methy_M3), methyF4 and methyR4 (Methy_M4), 2k marker, methyF1 and methyR1 (negative control), methyF2 and methyR2 (negative control), methyF3 and methyR3 (negative control), and methyF4 and methyR4 (negative control). Electrophoresis results showed that the methyF1 and methyR1 primer pair had the best amplification effect, while the other primer negative controls all produced clear products. Fluorescence RPA was subsequently performed using the methyF1 and methyR1 primer pair.

[0065] 3. Establish a real-time fluorescence RPA reaction system

[0066] Real-time RPA reactions were performed in a 50 μL volume using the Nucleic Acid Amplification Reagent (Fluorescent) (Cat. No. S002ZC) from Hangzhou Zhongce Biotechnology Co., Ltd., using the primer pairs methyF1 and methyR1, the probe probe_methy1, and the template Methy_M1. The RPA reaction system used in each reaction tube was as follows: 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.8 μL of 10 μM probe, 25 μL of the A Buffer (fluorescent basal buffer) provided by the kit, 12.7 μL of ultrapure water, 5 μL of DNA template, and 2.5 μL of the B Buffer (magnesium acetate solution) provided by the kit, for a total of 50 μL.

[0067] The reactants were added to each reaction tube in the following order: 12.7 μL of ultrapure water, 25 μL of A Buffer, 5 μL of DNA template, 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.8 μL of 10 μM probe, and 2.5 μL of B Buffer. The reaction tube was then placed in a fluorescence analyzer with a micro-optical detector and reacted at 39°C for 10 min.

[0068] 4. Stability and sensitivity test

[0069] The stability of RPA was tested, and the combination of forward primer methyF1, reverse primer methyR1, and probe probe_methy1 showed a stable specific amplification curve ( Figure 2 The negative control was tested by adding the following reagents according to the kit instructions: 1 tube of reaction powder, 25 μL of A Buffer, 4 μL of C Buffer, 13.5 μL of pure water, 5 μL of negative control, 2.5 μL of B Buffer, for a total volume of 50 μL.

[0070] For sensitivity testing, the synthesized template Methy_M1 (sample template concentration 100 ng / μL) DNA was serially diluted 5 1 , 5 2 , 5 3 , 5 4 Then, the forward primer methyF1, the reverse primer methyR1, and the probe probe_methy1 were used for RPA test, and stable RPA amplification fluorescence signals were detected ( Figure 3 ).

[0071] Figure 3 This is the amplification curve of RPA under the conditions of 10-fold serial dilution of DNA using the forward primer methyF1, reverse primer methyR1, and probe probe_methy1. In order to collect fluorescence more concentratedly, 20 cycles were set, with 1 cycle of 30 seconds, for a total of 10 minutes. The undiluted concentration was 100 ng / μL, the 5-fold dilution concentration was 20 ng / μL, and the 5-fold dilution concentration was 20 ng / μL. 2 The dilution was 4 ng / μL, 5 3 The dilution was 0.8 ng / μL, 5 4 The experimental results show that RPA has a fluorescence signal in the first cycle, and a clear curve appears at 10 minutes after 20 cycles, with a detection limit of 0.16 ng / μL.

[0072] In order to compare the sensitivity of RPA and traditional qPCR, qPCR amplification was performed on a 5-fold serial dilution template using ChamQ Blue Universal SYBR qPCR Master Mix (Cat. No. Q312-02) from Novozymes Biotech according to the instructions. Stable RPA amplification fluorescence signals were detected in both samples ( Figure 4 ).

[0073] Figure 4 This is a qPCR amplification curve using the forward primer methyF1 and reverse primer methyR1 combination under conditions of a five-fold serial dilution of DNA. The results show that the fluorescence signal in the low-concentration qPCR group did not appear until 10-15 cycles, significantly lower than that of RPA.

[0074] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer-probe combination for rapid detection of Methylomonas in cold spring water at a constant temperature, characterized in that: It includes an RPA primer pair and a fluorescent probe; the sequence of the RPA primer pair is as follows: Forward primer: 5′-ATTGAACGCTGGTGGTATGCTTAACACATG-3′; Reverse primer: 5′-ATTCCTACGCGTTACTCACCCGTCCGCCACTCGTC-3′; The sequence of the fluorescent probe is as follows: 5'-CCGTCCGCCACTCGTCATCTGGAGCAAGC(FAM-dT)C(THF)AA(BHQ1-dT)GTTACCGTTCGACT-C3-spacer-3'.

2. Use of the primer-probe combination according to claim 1 in preparing a kit for rapid constant temperature detection of Methylomonas in cold spring water.

3. A kit for rapid detection of Methylomonas in cold spring water at a constant temperature, characterized in that: Comprising the primer-probe combination of claim 1.

4. The kit according to claim 3, characterized in that The kit also contains fluorescence basic buffer, magnesium acetate and ultrapure water.

5. Use of the primer-probe combination of claim 1 or the kit of claim 3 or 4 in the rapid detection of Methylomonas in cold spring water at a constant temperature.

6. The use according to claim 5, characterized in that: The constant temperature is 39°C.

7. A method for rapid detection of Methylomonas in cold spring water at a constant temperature, characterized in that: The following steps are involved: a. Collect cold spring water samples to be tested and extract total environmental DNA; b. Using the DNA of step a as a template, performing real-time fluorescent recombinase polymerase amplification using the primer-probe combination of claim 1 or the kit of claim 3 or 4 to obtain an amplified product; c. If a fluorescent signal appears, the sample to be tested contains the target Methylomonas; if no fluorescent signal appears, the sample to be tested does not contain Methylomonas.

8. The method according to claim 7, characterized in that The reaction system of the real-time fluorescent recombinase polymerase amplification is: 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.8 μL of 10 μM probe, 25 μL of fluorescent basic buffer, 12.7 μL of ultrapure water, 5 μL of DNA template and 2.5 μL of magnesium acetate solution, a total of 50 μL.

9. The method according to claim 7 or 8, characterized in that: The reaction conditions of the real-time fluorescent recombinase polymerase amplification are: reaction at 39° C. for 10 minutes.

10. The method according to claim 7 or 8, characterized in that: The concentration of the DNA is 100-150 ng / μL.

Images