RPA amplification primer group based on CRISPR-Cas system as well as detection method and application of RPA amplification primer group

Abstract

The invention discloses an RPA (recombinase polymerase amplification) primer group based on a CRISPR (clustered regularly interspaced short palindromic repeats)-Cas system as well as a detection method and application thereof. Relates to the technical field of gene detection. Comprising an RPA amplification primer of an FUM gene and / or a Ver4 gene of fusarium verticillioides; and / or, a TRI6 gene of fusarium graminearum and / or an RPA amplification primer of Fg16N, and also provides a detection product. The sample preparation time is greatly shortened and can be completed within 5 minutes. The detection sensitivity is extremely high, and target molecules with the concentration of 100 aM can be detected. The detection specificity is high, and double sites of a single pathogen or two pathogens can be detected in the same reaction system. The detection result can be visually read by naked eyes, and the result can be subjected to fluorescence acquisition on FAM or HEX through a portable handheld luminoscope and can also be directly read through a lateral flow test strip. The detection is completed within 20 to 30 minutes.

Description

Technical Field

[0001] The present invention relates to the field of gene detection technology, and more specifically to an RPA amplification primer set based on a CRISPR-Cas system and a detection method and application thereof. Background Art

[0002] Corn ear rot is a worldwide fungal disease of corn, with an average annual incidence of 10-20%. It not only causes corn ears to rot, affecting corn yield and quality, but its pathogens also produce a variety of secondary toxins in corn kernels, which have important toxic side effects on humans and animals, and can cause death in severe cases. There are more than 20 pathogens of corn ear rot, which are usually caused by multiple pathogens alone or in combination, and the pathogenesis is complex.

[0003] In my country's main corn producing areas, ear rot is mainly caused by Fusarium moniliformis and Fusarium graminearum. Rapid detection of the pathogen of corn ear rot can not only provide a basis for the prevention and control of ear rot, but also provide an important technical means for food safety quarantine inspection.

[0004] At present, the detection of corn ear rot pathogens is mainly achieved through polymerase chain reaction (PCR) amplification. This technical means not only relies on target gene-specific amplification primers, but also relies on PCR instruments, gel electrophoresis and other instruments and equipment. In addition, the amplification reaction has high requirements on the quality and concentration of substrate DNA, and fungi need to be cultured and genomic DNA extracted. The entire detection process takes from 3 hours to several days, which is difficult to meet the needs of rapid sample detection.

[0005] Therefore, whether it is possible to provide an RPA amplification primer set based on the CRISPR-Cas system and its detection method and application to achieve rapid, specific and highly sensitive detection is an urgent problem that needs to be solved by those skilled in the art. Summary of the invention

[0006] In view of this, the present invention provides an RPA amplification primer set based on the CRISPR-Cas system, and a detection method and application thereof. A rapid detection method for the pathogens of corn ear rot, Fusarium pseudo-verticillium and Fusarium graminearum, which is fast, highly sensitive, highly specific, highly accurate, easy to operate, and can be read visually with the naked eye, is provided, providing a basis for field diagnosis and prevention of corn ear rot and food processing inspection and quarantine. Among them, the detection steps include four main steps: rapid preparation of samples, design of target sites for detection of Fusarium pseudo-verticillium and Fusarium graminearum, primer screening and system establishment of isothermal amplification reaction, establishment of a side-cutting reaction system based on four CRISPR-Cas systems, collection of nonspecific shearing signals, and visualization of results.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] A CRISPR-Cas system-based RPA amplification primer set, comprising RPA amplification primers for the FUM gene and / or Ver4 gene of Fusarium pseudoverticillium;

[0009] and / or,

[0010] RPA amplification primers for TRI6 gene and / or Fg16N of Fusarium graminearum;

[0011] The nucleotide sequences of the RPA amplification primers for the FUM gene of Fusarium pseudoverticillium are as shown in SEQ ID NO:41 to SEQ ID NO:43;

[0012] The nucleotide sequences of the RPA amplification primers for the Ver4 gene of Fusarium spp. are as shown in SEQ ID NO: 44 to SEQ ID NO: 46;

[0013] The nucleotide sequences of the RPA amplification primers for the TRI6 gene of Fusarium graminearum are as shown in SEQ ID NO: 47 to SEQ ID NO: 49;

[0014] The nucleotide sequences of the RPA amplification primers for the Fg16N gene of Fusarium graminearum are shown as SEQ ID NO:50 to SEQ ID NO:52.

[0015] The present invention also provides a detection product comprising the above-mentioned RPA amplification primer set based on the CRISPR-Cas system.

[0016] Preferably: the product is a kit, comprising crRNA, Cas enzyme and at least one of the following probes: ssDNA probe, ssRNA probe and lateral flow test strip probe;

[0017] The CRISPR-Cas system includes at least one of the following: a CRSPR-Cas12a combined with fluorescence detection system, a CRSPR-Cas12a combined with lateral test strip detection system, a CRISPR-LwCas13a combined with fluorescence detection system, and a CRISPR-RfCas13d combined with fluorescence detection system.

[0018] Preferred: crRNA: including crRNA targeting the FUM gene and / or Ver4 gene of Fusarium spp.

[0019] and / or,

[0020] crRNA targeting the TRI6 gene and / or Fg16N of Fusarium graminearum;

[0021] Among them, in the CRSPR-Cas12a combined fluorescence detection system, the primers for amplifying crRNA targeting the FUM gene of Fusarium oxysporum include SEQ ID No.9 and SEQ ID No.10;

[0022] In the CRSPR-Cas12a combined with lateral test strip detection system, the primers for amplifying crRNA targeting the FUM gene of Fusarium oxysporum include SEQ ID No: 11 and SEQ ID No: 12;

[0023] In the CRISPR-LwCas13a combined fluorescence detection system, primers for amplifying crRNA targeting the FUM gene of Fusarium oxysporum include SEQ ID No: 13 and SEQ ID No: 14;

[0024] In the CRISPR-RfCas13d combined fluorescence detection system, the primers for amplifying crRNA targeting the FUM gene of Fusarium oxysporum include SEQ ID No: 15 and SEQ ID No: 16;

[0025] In the CRSPR-Cas12a combined fluorescence detection system, the primers for amplifying crRNA targeting the Ver4 gene of Fusarium oxysporum include SEQ ID No. 17 and SEQ ID No. 18;

[0026] In the CRSPR-Cas12a combined with lateral test strip detection system, the primers for amplifying crRNA targeting the Ver4 gene of Fusarium oxysporum include SEQ ID No: 19 and SEQ ID No: 20;

[0027] In the CRISPR-LwCas13a combined fluorescence detection system, the primers for amplifying crRNA targeting the Ver4 gene of Fusarium oxysporum include SEQ ID No: 21 and SEQ ID No: 22;

[0028] In the CRISPR-RfCas13d combined fluorescence detection system, the primers for amplifying crRNA targeting the Ver4 gene of Fusarium oxysporum include SEQ ID No: 23 and SEQ ID No: 24;

[0029] In the CRSPR-Cas12a combined fluorescence detection system, primers for amplifying crRNA targeting the TRI6 gene of Fusarium graminearum include SEQ ID No: 25 and SEQ ID No: 26;

[0030] In the CRSPR-Cas12a combined with lateral test strip detection system, primers for amplification of crRNA targeting the TRI6 gene of Fusarium graminearum include SEQ ID No: 27 and SEQ ID No: 28;

[0031] In the CRISPR-LwCas13a combined fluorescence detection system, primers for amplifying crRNA targeting the TRI6 gene of Fusarium graminearum include SEQ ID No: 29 and SEQ ID No: 30;

[0032] In the CRISPR-RfCas13d combined fluorescence detection system, primers for amplifying crRNA targeting the TRI6 gene of Fusarium graminearum include SEQ ID No: 31 and SEQ ID No: 32;

[0033] In the CRSPR-Cas12a combined fluorescence detection system, primers for amplifying crRNA targeting the Fg16N gene of Fusarium graminearum include SEQ ID No: 33 and SEQ ID No. 34;

[0034] In the CRSPR-Cas12a combined with lateral test strip detection system, the primers for amplifying crRNA targeting the Fg16N gene of Fusarium graminearum include SEQ ID No: 35 and SEQ ID No: 36;

[0035] In the CRISPR-LwCas13a combined fluorescence detection system, primers for amplifying crRNA targeting the Fg16N gene of Fusarium graminearum include SEQ ID No: 37 and SEQ ID No: 38;

[0036] In the CRISPR-RfCas13d combined fluorescence detection system, the primers for amplifying crRNA targeting the Fg16N gene of Fusarium graminearum include SEQ ID No: 39 and SEQ ID No: 40.

[0037] Preferably, the probe is a probe with labeling groups at both ends, including: Poly C, 5' end labeled with 6-FAM, 3' end labeled with BHQ1, sequence: CCCCCCCC; Poly rU, 5' end labeled with 6-FAM, 3' end labeled with BHQ1, sequence: rUrUrUrUrU; Lateral flow reporter with FAM / Biotin, 5' end labeled with 6-FAM, 3' end labeled with Biotin, sequence: CCCCCCCC.

[0038] The present invention also provides the application of the primer set or the product in agricultural disease detection.

[0039] Preferably: the disease is a corn fungal disease.

[0040] Preferably: the target of detection is:

[0041] The target site of the DNA-targeting CRSPR-Cas12a system on the toxin synthesis gene FUM5 of Fusarium oxysporum is as shown in SEQ ID No. 1; the target site sequence of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems is as shown in SEQ ID No. 2;

[0042] The target site of the DNA-targeting CRSPR-Cas12a system on the Ver4 gene, the sequence is as SEQ ID No. 3; the target site of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems, the sequence is as SEQ ID No. 4;

[0043] The target site of the DNA-targeting CRSPR-Cas12a system on the toxin synthesis gene TRI6 of Fusarium graminearum, the sequence is as SEQ ID No.5; the target site of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems, the sequence is as SEQ ID No.6;

[0044] The Fg16N gene targets the target site of the DNA CRSPR-Cas12a system, and the sequence is SEQ ID No.7; the target site of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems, and the sequence is SEQ ID No.8.

[0045] Preferred: A method for crude sample preparation: adding the sample to a lysate, grinding, and incubating; the lysate is directly added to the RPA reaction system for amplification reaction.

[0046] Preferably, the mass volume ratio of sample to lysate is 50 mg:100 μl; grinding time: 1 min; incubation: 37° C., 4 min.

[0047] It can be seen from the above technical solution that, compared with the prior art, the present invention discloses an RPA amplification primer set based on the CRISPR-Cas system and a detection method and application thereof, and the technical effects achieved are:

[0048] (1) Sample preparation time is greatly shortened and can be completed within 5 minutes.

[0049] (2) The detection sensitivity is extremely high and can detect target molecules at a concentration of 100aM.

[0050] (3) The detection specificity is high, and it can detect dual sites of a single pathogen or two pathogens in the same reaction system.

[0051] (4) The test results can be read visually. The results can be obtained by using a portable handheld fluorescence meter to obtain the fluorescence of FAM or HEX, or can be directly read through a lateral flow test strip.

[0052] (5) Compared with existing PCR tests, this detection technology is rapid and can be completed within 20 to 30 minutes from sample preparation to result presentation. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0054] Figure 1 The accompanying figure is a diagram of the rapid detection of corn ear rot pathogen Fusarium spp. based on the AsCas12a, LbCas12a, LWCas13a and RfCas13d systems provided by the present invention.

[0055] Figure 2 The accompanying figure is a diagram of the rapid detection of corn ear rot pathogen Fusarium graminearum based on the AsCas12a, LbCas12a, LWCas13a and RfCas13d systems provided by the present invention.

[0056] Figure 3 The accompanying figure is a diagram of rapid lateral flow test strip detection of two pathogens based on the LbCas12a system provided by the present invention.

[0057] Figure 4 The accompanying drawings show the dual site detection of Fusarium graminearum and Fusarium graminearum based on the LbCas12a and LWCas13a systems provided by the present invention, as well as the simultaneous detection of the two fungi.

[0058] Figure 5 The accompanying drawings are detection diagrams of crude extract sample dilutions of Fusarium graminearum and Fusarium graminearum based on the LbCas12a system provided by the present invention. DETAILED DESCRIPTION

[0059] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0060] The embodiments of the present invention disclose an RPA amplification primer set based on a CRISPR-Cas system and a detection method and application thereof.

[0061] Example 1

[0062] 1. Target site selection and crRNA preparation

[0063] (1) The target sites of the DNA-targeting CRSPR-Cas12a system were designed on the toxin synthesis gene FUM5 of Fusarium spp., with the sequence "TTAGTCCTTCGAGGATAACT" (SEQ ID No. 1), and the target sites of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems were designed with the sequence "CACCAAUCUCAAGAACACGAAGCGUGGGCC" (SEQ ID No. 2);

[0064] The target site of the DNA-targeting CRSPR-Cas12a system was designed on the Ver4 gene, with the sequence of "GCTCATGTTTTCGATTTAAG" (SEQ ID No. 3), and the target site of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems was designed with the sequence of "CAGGACAUGAUCAACG AGGUUGACGCUGAC" (SEQ ID No. 4).

[0065] (2) The target sites of the DNA-targeting CRSP R-Cas12a system were designed on the toxin synthesis gene TRI6 of Fusarium graminearum, with the sequence of "TGAGAGAAGATCTATTTCGA" (SEQ ID No. 5), and the target sites of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems were designed with the sequence of "CCUGCCAAGGACUUUGUCCCAGAUCUAAAC" (SEQ ID No. 6);

[0066] The target sites of the DNA-targeting CRSPR-Cas12a system were designed on the Fg16N gene, with the sequence of "TACTTGAAAAATCTCCTTTA" (SEQ ID No. 7), and the target sites of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems were designed with the sequence of "GCACAGUCGAA CAUCGUACCUAUAUACCAU" (SEQ ID No. 8).

[0067] (3) The relevant primers for synthesizing the targeting crRNA are as follows:

[0068]

[0069]

[0070] (4) In vitro transcription was performed using the T7 transcription kit (Vazyme, TR102-02).

[0071] (5) Purify crRNA by isopropanol precipitation and store it in aliquots at -80°C for future use.

[0072] 2. Synthesis of ssDNA, ssRNA probes and lateral flow test strip probes. The specific sequences are as follows:

[0073] Probe Name sequence PolyC / 56-FAM / CCCCCCCC / 3BHQ1 / U / 56-FAM / rUrUrUrUrU / 3BHQ1 / LateralflowreporterwithFAM / Biotin / 56-FAM / CCCCCCCC / 3Biotin /

[0074] 3. Design of primers for RPA (recombinase polymerase amplification) isothermal amplification reaction

[0075] The website http: / / www.ncbi.nlm.nih.gov / tools / primer-blast / was used to design RPA primers. The length of the amplified product was 300 bp. For the CRISPR-Cas system targeting RNA, a T7 sequence was required to be introduced into one section of a primer. The specific amplification primer sequence is as follows:

[0076]

[0077]

[0078] 4. Method for crude preparation of corn kernel samples infected with ear rot pathogens

[0079] (1) Scrape about 50 mg of sample from the infected corn kernels and place it in a 1.5 ml centrifuge tube.

[0080] (2) Add 100 μl of lysis buffer (TAKARA, 9164), insert the grinding rod and grind at room temperature for 1 min, and incubate for 4 min (37°C for better lysis effect).

[0081] (3) The lysate is directly added to the RPA reaction system for amplification reaction

[0082] 5.RPA isothermal amplification reaction (TwistDx, TABASA03KIT)

[0083] (1) Establish the RPA constant temperature amplification system as follows:

[0084] 2.4 μL of RPA-F primer (10 μM), 2.4 μL of RPA-R primer (10 μM), 29.5 μL of buffer, 2 μL of template, add water to make up to 47.5 μL, mix well, add 2.5 μL of MgOAc and react immediately.

[0085] (2) The RPA reaction system was placed in a 37°C constant temperature metal bath for 10 min.

[0086] (3) After completion, the amplified product is directly used as a detection substrate in the CRISPR-Cas detection reaction.

[0087] 6. CRISPR-Cas lateral cutting activity detection target molecule

[0088] (1) Establish the CRISPR-Cas detection system as follows:

[0089] Cas12 detection system: 2 μL NEB CutSmart Buffer (10×), 100 nM Cas12 protein, 1 μL probe (40 μM), 1 μL crRNA (20 ng / L), 1 μL detection substrate, supplemented to 20 μL with DNase- and RNase-free water.

[0090] Cas13 detection system: 2 μL NEB CutSmart Buffer (10×), 100 nM Cas13 protein, 1 μL probe (40 μM), 0.05 μL T7 polymerase (M0251L), 0.8 μL rNTP Mix (NEB, N0466L), 0.5 μL RNase inhibitor (NEB, M0314L), 1 μL crRNA (20 ng / μL), 1 μL detection substrate, supplemented to 20 μL with DNase- and RNase-free water.

[0091] (2) Place the reaction in a 37°C fluorescence instrument and collect the fluorescence signal every 5 minutes. The detection time is usually 20-60 minutes. The reaction can be taken out and placed under a handheld fluorescent lamp for photography.

[0092] 7. Lateral test strip detection system

[0093] The lateral test strip consists of a sample pad, a binding pad, a T line and a C line (or control line). The sample pad is used to place the sample, the binding pad is used to fix the antigen at the test line, and the T line and C line are used to detect positive and negative results, respectively. The detection principle is that the biotin-labeled PCR product is hybridized with the FITC-labeled specific probe, and the FITC-labeled specific probe is combined with the gold label of the anti-FITC antibody. The immune complex is then dripped onto the test strip. The immune complex diffuses through the chromatographic membrane. When it diffuses to the test line, the biotin-labeled amplification product is captured by the biotin ligand to form a colored test line. The immune complex that is not captured continues to diffuse to the quality control line and is captured by the specific antibody to form a colored quality control line.

[0094] (1) Establishing a CRISPR-LbCas12a detection reaction system suitable for test strips is as follows:

[0095] 2 μL NEB CutSmart Buffer (10×), 100 nM LbCas12a, 1 μL probe (20 μM), 1 μL crRNA (20 ng / μL), 1 μL detection substrate, supplemented to 20 μL with DNase- and RNase-free water.

[0096] (2) Test strip kit (Milenia, MGHD1) (Wuhan Aimejie Technology Co., Ltd.). After the reaction is completed, 20 μL of the detection solution is added to 80 μL of the test strip reaction buffer, mixed evenly, inserted into the test strip, and observed the color band.

[0097] Technical effect verification:

[0098] 1. Rapid detection of corn kernels infected with Fusarium spp.

[0099] Maize ears infected and uninfected by Fusarium spp. were selected respectively. Figure 1 In Figure A), the sample was prepared according to the above rapid sample preparation method. The detection site was the target site selected on the FUM5 gene. The reporter molecule was fluorescently labeled with a FAM group. RPA amplification was performed, and AsCas12a, LbCas12a, LwCas13 and RfCas13d were used for CRISPR-Cas flanking shearing, and the results were finally read.

[0100] Test results: AsCas12a, LbCas12a, LwCas13 and RfCas13d systems can effectively detect samples with and without pathogens, as shown by: the fluorescence signal reading of the sample without pathogens is the same as that of the water control, and the fluorescence values ​​of the three positive samples with pathogens all obtained higher fluorescence values ​​in the four systems. After half an hour of reaction, after irradiating the reaction with a handheld fluorescence meter, the samples with pathogens have visible green fluorescence, while the samples without pathogens and the water control samples have no fluorescence signals (see attached Figure 1 In addition, the lateral test strip test using the LbCas12a system found that the negative sample had only one quality control band, while the positive sample had a detection band in addition to the quality control band (see Appendix Figure 3 (A).

[0101] 2. Rapid detection of corn kernels with Fusarium graminearum

[0102] Corn ears infected and uninfected with Fusarium graminearum were selected (see Appendix Figure 2 In Figure A), the sample was prepared according to the above rapid sample preparation method. The detection site was the target site selected on the TRI6 gene. The reporter molecule was fluorescently labeled with a FAM group, and then amplified by RPA, and AsCas12a, LbCas12a, LwCas13 and RfCas13d were used for CRISPR-Cas cleavage, and finally the results were read.

[0103] Test results: AsCas12a, LbCas12a, LwCas13 and RfCas13d systems can effectively detect samples with and without pathogens, as shown by: the fluorescence signal reading of the sample without pathogens is the same as that of the water control, and the fluorescence values ​​of the three positive samples with pathogens all obtained higher fluorescence values ​​in the four systems. After half an hour of reaction, after irradiating the reaction with a handheld fluorescence meter, the samples with pathogens have visible green fluorescence, while the samples without pathogens and the water control samples have no fluorescence signals (see attached Figure 2 In addition, the lateral test strip test using the LbCas12a system found that the negative sample had only one quality control band, while the positive sample had a detection band in addition to the quality control band (see Appendix Figure 3 (B).

[0104] 3. Use LbCas12a system and LwCas13a system to detect single pathogens of ear and grain rot and detect two pathogens at the same time

[0105] For dual-site detection of Fusarium spp., the LwCas13a system targeting the VER4 gene was selected, and the reporter molecule was a FAM-labeled ssRNA probe. At the same time, a LbCas12a target site was designed on the FUM5 gene, and the reporter molecule was a HEX-labeled ssDNA probe.

[0106] Corn kernels infected and uninfected by Fusarium spp. were selected. After rapid preparation, the samples were subjected to composite RPA amplification reaction for the above two sites in the same reaction. The composite RPA amplification reaction products were then added with LbCas12a protein, LwCas13a protein, crRNA molecules of two sites, ssDNA probes and ssRNA probes for side-cut detection reaction. The fluorescence signals were collected in FAM channel and HEX channel at the same time. After 25 minutes of reaction, the samples were imaged by a handheld fluorescence microscope for the two fluorescences.

[0107] Results: The dual-site detection of Fusarium spp. showed that the pathogen samples could detect both FUM5 and VER4 sites in one reaction, while the negative samples and water controls had no signal detected (see Appendix Figure 4 (A).

[0108] For dual-site detection of Fusarium graminearum, the LwCas13a system targeting the Fg16N gene was selected, and the reporter molecule was a FAM-labeled ssRNA probe. At the same time, a LbCas12a target site was designed on the TRI6 gene, and the reporter molecule was a HEX-labeled ssDNA probe.

[0109] Corn kernels infected and uninfected with Fusarium graminearum were selected. After rapid preparation, the samples were subjected to composite RPA amplification reaction for the above two sites in the same reaction. The composite RPA amplification reaction product was then added with LbCas12a protein, LwCas13a protein, dual-site crRNA molecules, ssDNA probes and ssRNA probes for side-cutting detection reaction. The fluorescence signals were collected in FAM channel and HEX channel at the same time. After 25 minutes of reaction, the samples were imaged by a handheld fluorescence microscope for the two fluorescences.

[0110] Results: The dual-site detection of Fusarium graminearum found that the pathogen samples could detect both TRI6 and Fg16N sites in one reaction, while the negative samples and water controls had no signal detection (see Appendix Figure 4 (B).

[0111] For dual-site detection of Fusarium graminearum and Fusarium graminearum, the LwCas13a system targeting the FUM5 gene was selected, and the reporter molecule was a FAM-labeled ssRNA probe. The LbCas12a system targeting the TRI6 gene was selected, and the reporter molecule was a HEX-labeled ssRNA probe.

[0112] Corn kernels infected and uninfected by Fusarium graminearum and Fusarium graminearum were selected, and the materials infected by the two pathogens were mixed. After the samples were quickly prepared, the above two sites were subjected to a composite RPA amplification reaction in the same reaction. The composite RPA amplification reaction products were then added with LbCas12a protein, LwCas13a protein, dual-site crRNA molecules, ssDNA probes and ssRNA probes for side-cutting detection reaction. The fluorescence signals were collected in the FAM channel and the HEX channel at the same time. After 25 minutes of reaction, the samples were imaged by a handheld fluorescence microscope for the two fluorescences.

[0113] Results: The dual-site detection of Fusarium spp. and Fusarium graminearum found that the mixed samples with pathogens could detect both FUM5 and TRI6 sites in one reaction, while the single pathogen samples without mixing could only detect the corresponding single pathogen, and no signal was detected in the negative samples and water controls (see Appendix). Figure 4 Middle C).

[0114] 4. Dilution detection of crude sample extract using LbCas12a system

[0115] The crude extracts of the samples with Fusarium graminearum and Fusarium graminearum were diluted at different times, and the total dilution was 10 -1 , 10 -2 , 10 -3 , 10 -4 and 10 -5 A total of 5 dilution factors were used, followed by RPA amplification and LbCas12a detection to determine the sensitivity of pathogen detection using crude extraction.

[0116] Results: The LbCas12a system could regulate 10% of the crude extract of Fusarium spp. -5 Fluorescence signals were detected by dilution gradient. -3 Fluorescence signals were detected by dilution gradient, in which 10 -3 Obvious fluorescence can be observed in the dilution gradient of the naked eye bacteria, see attached Figure 5 A and B in Chinese.

[0117] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0118] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A CRISPR-Cas system-based RPA amplification primer set, characterized in that: comprising RPA amplification primers for the FUM gene and / or Ver4 gene of Fusarium pseudoverticillium; and / or, RPA amplification primers for TRI6 gene and / or Fg16N of Fusarium graminearum; The nucleotide sequences of the RPA amplification primers for the FUM gene of Fusarium pseudoverticillium are as shown in SEQ ID NO:41 to SEQ ID NO:43; The nucleotide sequences of the RPA amplification primers for the Ver4 gene of Pseudomonas verticillioides are as shown in SEQ ID NO: 44 to SEQ ID NO: 46; The nucleotide sequences of the RPA amplification primers for the TRI6 gene of Fusarium graminearum are as shown in SEQ ID NO: 47 to SEQ ID NO: 49; The nucleotide sequences of the RPA amplification primers for the Fg16N gene of Fusarium graminearum are as shown in SEQ ID NO:50 to SEQ ID NO:

52.

2. A detection product comprising the RPA amplification primer set based on the CRISPR-Cas system according to claim 1.

3. The product according to claim 2, characterized in that The product is a kit, comprising crRNA, Cas enzyme and at least one of the following probes: ssDNA probe, ssRNA probe and lateral flow test strip probe; The CRISPR-Cas system includes at least one of the following: a CRSPR-Cas12a combined with fluorescence detection system, a CRSPR-Cas12a combined with lateral test strip detection system, a CRISPR-LwCas13a combined with fluorescence detection system, and a CRISPR-RfCas13d combined with fluorescence detection system.

4. The product according to claim 3, characterized in that The crRNA includes a crRNA targeting the FUM gene and / or the Ver4 gene of Fusarium spp. and / or, crRNA targeting the TRI6 gene and / or Fg16N of Fusarium graminearum; Among them, in the CRSPR-Cas12a combined fluorescence detection system, the primers for amplifying crRNA targeting the FUM gene of Fusarium oxysporum include SEQ ID No.9 and SEQ ID No.10; In the CRISPR-Cas12a combined with lateral test strip detection system, the primers for amplifying crRNA targeting the FUM gene of Pseudomonas verticillioides include SEQ ID No: 11 and SEQ ID No: 12; in the CRISPR-LwCas13a combined with fluorescence detection system, the primers for amplifying crRNA targeting the FUM gene of Pseudomonas verticillioides include SEQ ID No: 13 and SEQ ID No: 14; In the CRISPR-RfCas13d combined fluorescence detection system, the primers for amplifying crRNA targeting the FUM gene of Fusarium oxysporum include SEQ ID No: 15 and SEQ ID No: 16; In the CRSPR-Cas12a combined fluorescence detection system, the primers for amplifying crRNA targeting the Ver4 gene of Fusarium oxysporum include SEQ ID No. 17 and SEQ ID No. 18; In the CRSPR-Cas12a combined with lateral test strip detection system, the primers for amplifying crRNA targeting the Ver4 gene of Fusarium oxysporum include SEQ ID No: 19 and SEQ ID No: 20; In the CRISPR-LwCas13a combined fluorescence detection system, the primers for amplifying crRNA targeting the Ver4 gene of Fusarium oxysporum include SEQ ID No: 21 and SEQ ID No: 22; In the CRISPR-RfCas13d combined fluorescence detection system, the primers for amplifying crRNA targeting the Ver4 gene of Fusarium oxysporum include SEQ ID No: 23 and SEQ ID No: 24; In the CRSPR-Cas12a combined fluorescence detection system, primers for amplifying crRNA targeting the TRI6 gene of Fusarium graminearum include SEQ ID No: 25 and SEQ ID No: 26; In the CRSPR-Cas12a combined with lateral test strip detection system, primers for amplification of crRNA targeting the TRI6 gene of Fusarium graminearum include SEQ ID No: 27 and SEQ ID No: 28; In the CRISPR-LwCas13a combined fluorescence detection system, primers for amplifying crRNA targeting the TRI6 gene of Fusarium graminearum include SEQ ID No: 29 and SEQ ID No: 30; In the CRISPR-RfCas13d combined fluorescence detection system, primers for amplifying crRNA targeting the TRI6 gene of Fusarium graminearum include SEQ ID No: 31 and SEQ ID No: 32; In the CRSPR-Cas12a combined fluorescence detection system, primers for amplifying crRNA targeting the Fg16N gene of Fusarium graminearum include SEQ ID No: 33 and SEQ ID No. 34; In the CRSPR-Cas12a combined with lateral test strip detection system, the primers for amplifying crRNA targeting the Fg16N gene of Fusarium graminearum include SEQ ID No: 35 and SEQ ID No: 36; In the CRISPR-LwCas13a combined fluorescence detection system, primers for amplifying crRNA targeting the Fg16N gene of Fusarium graminearum include SEQ ID No: 37 and SEQ ID No: 38; In the CRISPR-RfCas13d combined fluorescence detection system, the primers for amplifying crRNA targeting the Fg16N gene of Fusarium graminearum include SEQ ID No: 39 and SEQ ID No:

40.

5. The product according to claim 4, characterized in that The probe is a probe with labeling groups at both ends, including: Poly C, 5' end labeled with 6-FAM, 3' end labeled with BHQ1, sequence: CCCCC CCC; Poly rU, 5' end labeled with 6-FAM, 3' end labeled with BHQ1, sequence: rUrUrUrUrU; Lateral flow reporter with FAM / Biotin, 5' end labeled with 6-FAM, 3' end labeled with Biotin, sequence: CCCCCCCC.

6. Use of the primer set according to claim 1 or the products according to claims 2 to 5 in agricultural disease detection.

7. The use according to claim 6, characterized in that The disease is a corn fungal disease.

8. The use according to claim 7, characterized in that The targets of the detection are: The target site of the DNA-targeting CRSPR-Cas12a system on the toxin synthesis gene FUM5 of Fusarium oxysporum is as shown in SEQ ID No. 1; the target site sequence of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems is as shown in SEQ ID No. 2; The target site of the DNA-targeting CRSPR-Cas12a system on the Ver4 gene, the sequence is as SEQ ID No.3; the target site of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems, the sequence is as SEQ ID No.4; The target site of the DNA-targeting CRSPR-Cas12a system on the toxin synthesis gene TRI6 of Fusarium graminearum, the sequence is as SEQ ID No.5; the target site of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems, the sequence is as SEQ ID No.6; The Fg16N gene targets the target site of the DNA CRSPR-Cas12a system, and the sequence is SEQ ID No.7; the target site of the RNA-targeting CRISPR-LwCas13a and CRISPR-RfCas13d systems, and the sequence is SEQ ID No.

8.

9. The use according to claim 7, characterized in that The method for crude sample preparation is as follows: adding the sample to a lysis solution, grinding, and incubating; the lysis solution is directly added to the RPA reaction system for amplification reaction.

10. The use according to claim 9, characterized in that The mass volume ratio of the sample and the lysate is 50 mg:100 μl; the grinding time is 1 min; and the incubation is 37° C. for 4 min.

Images