Transcription factor gene specific fragment for delaying softening of postharvest apple fruits and regulation and control method

Abstract

The invention relates to a transcription factor gene specific fragment for delaying softening of postharvest apple fruits and a regulation and control method, and belongs to the technical field of plant genetic engineering. The MdWRKY33 transcription factor gene in an apple plant with poor storability is knocked out or silenced by using a transcription factor gene specific fragment as shown in SEQ ID NO.1 in a nucleotide sequence table, so as to delay the softening of postharvest apple fruits. The specific operation comprises the following steps: cloning a transcription factor gene specific fragment into a virus silencing vector pTRV2 to obtain a recombinant plasmid; respectively transferring the auxiliary vector pTRV1 and the recombinant plasmid into agrobacterium tumefaciens GV3101 strain cells by using a freeze thawing method to respectively obtain strain cells A and strain cells B; respectively carrying out culture medium culture and infection solution suspension treatment, and then preparing a mixed infection buffer solution; and immersing the apple fruits in the mixed infection buffer solution, and carrying out vacuum treatment to obtain the instantly silent apple fruits. Ethylene biosynthesis and cell wall degradation in the apple fruits are inhibited, and softening of the picked apple fruits is delayed.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to the regulation of a specific segment of an apple MdWRKY33 gene in the softening of postharvest apple fruits. Background Art

[0002] Apple is one of the most widely produced and economically important fruit crops in the temperate zone of the world. It is rich in minerals and vitamins. As one of the most important fruit trees in the world, its storage property is an important factor that determines the quality and commercial value of apple fruit. Fruit softening is a key process in the fruit ripening process. The softening characteristics of fruit texture are an important factor restricting the storage period of apples. When the fruit softens, the storage performance deteriorates and it is easy to rot and deteriorate, affecting its edible quality and economic value. Therefore, studying the key genes and molecular mechanisms that regulate apple ripening and softening has important scientific significance and application value for apple genetic improvement.

[0003] The hardness of fruit is closely related to its softening. The softening of fruit is mainly due to the change of cell wall structure and the degradation of its components. The fruit softening process involves the synergistic action of multiple cell wall modification enzymes, including cellulase, polygalacturonase, β-galactosidase, pectin lyase and xyloglucan hydrolase.

[0004] Transcription factors are a class of DNA-binding proteins that can specifically bind to cis-acting elements on the upstream promoter of eukaryotic genes, thereby regulating their spatiotemporal specific expression. With the in-depth study of transcription factors in model plants, the transcriptional regulatory mechanism related to fruit softening has become one of the key research areas. During the fruit ripening and development process, the softening of fruit texture is regulated by multiple transcription factors and genes.

[0005] WRKY transcription factors are considered to be key elements of plant evolution. They are not only involved in plant growth and development, but also can regulate the adaptability of plants to the external environment, thereby effectively promoting the normal growth and development of plants and having a positive impact on other environmental changes. As one of the largest transcription factor families in plants, the research on the role of WRKY transcription factors in plant growth and development mainly focuses on plant responses to biotic and abiotic stresses. For example, WRKY transcription factors have both positive and negative regulatory effects in the defense response of plants to different biotic stresses. At the same time, WRKY transcription factors participate in many complex signal transduction processes in the response of plants to abiotic stresses, such as drought, salt, high temperature and cold stress, and play an important role. Most of the research on WRKY transcription factors is in the field of biotic and abiotic stresses, and is still very limited in the maturation and aging of horticultural products.

[0006] Texture is an important component of apple quality. Softening can lead to postharvest deterioration and shortened storage life. Fruit softening is an extremely complex process, which is regulated by multiple genes, enzymes, transcription factors and hormones. Multiple transcription factors have been found to play a role in apple softening, but there are few studies on the role of WRKY transcription factors in regulating apple softening. Summary of the invention

[0007] In order to improve the storage stability of apples, the present invention provides an application of a transcription factor gene for delaying the softening of post-harvest apple fruits.

[0008] The invention discloses an application of a transcription factor gene specific fragment shown in SEQ ID NO.1 in a nucleotide sequence table in delaying the softening of post-harvest apple fruit. The operation is as follows: in apple varieties with poor storage tolerance, the transcription factor gene specific fragment shown in SEQ ID NO.1 in the nucleotide sequence table is used to knock out or silence the MdWRKY33 transcription factor gene, thereby inhibiting ethylene biosynthesis and cell wall degradation in apples, and delaying the softening of post-harvest apple fruit.

[0009] The regulation and operation steps of a transcription factor gene specific fragment shown in nucleotide sequence table SEQ ID NO.1 for delaying the softening of post-harvest apple fruit are as follows:

[0010] (1) Clone the transcription factor gene specific fragment shown in the nucleotide sequence table SEQ ID NO.1 into the viral silencing vector pTRV2 to obtain a recombinant plasmid;

[0011] (2) Preparation of strain cell monoclonal A and strain cell monoclonal B

[0012] (2.1) 5 μL of the auxiliary vector pTRV1 was transferred into 50 μL of Agrobacterium tumefaciens GV3101 cells by freeze-thaw method to obtain strain cell A;

[0013] Add strain cell A to 500 μL lysing broth liquid culture medium, and culture at 28°C and 200 rpm for 6 hours to obtain shake flask culture A.

[0014] 150 μL of shake flask culture A was spread on a solid medium containing lysate broth containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured at 28°C for 2 days to obtain a single clone of strain A.

[0015] (2.2) Transfer 5 μL of the recombinant plasmid into 50 μL of Agrobacterium tumefaciens GV3101 cells by freeze-thaw method to obtain strain cell B;

[0016] Add strain B cells to 500 μL lysing broth liquid culture medium, and culture at 28°C and 200 rpm for 6 hours to obtain shake flask culture B;

[0017] 150 μL of shake flask culture B was spread on a lysing broth plate solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured for 2 days at 28°C to obtain a single clone of strain B.

[0018] (3) Pick one cell clone A of the strain and inoculate it into 700 μL of lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin for expansion culture. Pick one cell clone B of the strain and inoculate it into 700 μL of lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. Expand and culture them at 28°C and 200 rpm, respectively. Shake the culture for 24 hours to obtain Agrobacterium culture liquid A and Agrobacterium culture liquid B, respectively.

[0019] (4) adding the Agrobacterium culture liquid A to a lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at a volume ratio of 1:100, and adding the Agrobacterium culture liquid B to a lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at a volume ratio of 1:100, and culturing the cultures at 28° C. and 200 rpm until the absorbance at a wavelength of 600 nm is 1.0, and collecting the cells by centrifugation to obtain cells A and B, respectively;

[0020] (5) adding the bacterial cells A to the infection solution in equal volumes, and adding the bacterial cells B to the infection solution in equal volumes, and breaking up the bacterial cells; suspending them at room temperature until the absorbance at a wavelength of 600 nm is 1, and incubating them at room temperature for 3 hours to obtain infection buffer A or infection buffer B, respectively;

[0021] (6) Mix infection buffer A and infection buffer B in a volume ratio of 1:1 to obtain a mixed infection buffer;

[0022] (7) Immerse the apple fruit in the mixed infection buffer and place it at -0.8 kg / cm 2 Under vacuum conditions, vacuum treatment was performed twice, each time for 5 minutes, to obtain instantaneously silent apple fruits.

[0023] The further technical solution is as follows:

[0024] In step (5), the infection solution is prepared by uniformly mixing 976 mL of distilled water, 10 mL of 1 mol / L magnesium chloride, 10 mL of 1 mol / L fatty acid methyl ester sulfonate and 4 mL of 50 mmol / L acetosyringone, and the pH value of the infection solution is 5.6.

[0025] The beneficial technical effects of the present invention are embodied in the following aspects:

[0026] (1) Currently, there are few reports on WRKY in fruit softening. This invention explains the mechanism of action of apple WRKY transcription factor gene in regulating apple softening from the molecular mechanism, providing a theoretical basis and gene resources for apple molecular assisted breeding and genetic engineering breeding. Apple transient injection experiments, physiological data determination and gene expression analysis show that knocking out or silencing the MdWRKY33 transcription factor gene using the transcription factor gene specific fragment shown in the nucleotide sequence table SEQ ID NO.1 can inhibit ethylene biosynthesis and cell wall degradation in apples, thereby delaying the softening of post-harvest apple fruits.

[0027] The mechanism of the regulation and control operation steps of the present invention is described as follows:

[0028] In step (2), the role of the auxiliary vector pTRV1 is to assist the movement of the viral silencing vector pTRV2 and the recombinant plasmid; the viral silencing vector pTRV2 and the auxiliary vector pTRV1 were both purchased from Beijing Coolable Technology Co., Ltd.; the sequences of the viral silencing vector pTRV2 and the auxiliary vector pTRV1 are both recorded in the instructions on the official website of Coolable Technology Co., Ltd.

[0029] In step (3), the purpose of culturing strain A and strain B in a lysing broth liquid culture medium containing kanamycin and rifampicin is to perform screening, and only strain A and strain B are expanded and cultured in the corresponding liquid culture medium.

[0030] In step (4), Agrobacterium culture solution A and Agrobacterium culture solution B are cultured until the absorbance at a wavelength of 600 nm is 1.0. The reason is that the absorbance is an important indicator for measuring the concentration of the Agrobacterium culture solution. When the absorbance is 1, the concentration of the Agrobacterium culture solution is moderate and the activity is high, which is conducive to improving the infection efficiency.

[0031] In step (5), infection buffer A and infection buffer B are cultured until the absorbance at a wavelength of 600 nm is 1.0. The reason is to make the ratio of strain cells A and strain cells B in plant cells appropriate and improve the efficiency of gene silencing.

[0032] (2) The present invention utilizes genetic engineering to silence the MdWRKY33 transcription factor gene in apple varieties with poor storability, thereby improving apple varieties and enhancing storability. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The diagram shows the co-expression network analysis of transcription factors in transcriptome sequencing, the clustering heat map of ethylene and cell wall-related transcription factors, and the expression level of the MdWRKY33 gene in 'Golden Crown' and 'Golden Crown Bud Mutation' apple fruits at different storage times.

[0034] Figure 2 The subcellular localization map of MdWRKY33-GFP fusion protein in onion epidermal cells and the verification map of MdWRKY33 self-activation.

[0035] Figure 3 A diagram showing the results of yeast one-hybrid and dual-luciferase reporter experiments using the MdWRKY33 and MdPG promoters.

[0036] Figure 4 This is the phenotype of silencing apple fruit.

[0037] Figure 5 This is a diagram showing the physiological data after silencing apple fruit.

[0038] Figure 6 This is the gene expression pattern of the cell wall degradation-related genes MdPG and MdWRKY33 after silencing apple fruit. DETAILED DESCRIPTION

[0039] The present invention will be further described in detail below through specific embodiments in conjunction with the accompanying drawings.

[0040] The present invention has conducted in-depth research and isolated and cloned the apple MdWRKY33 (MD04G1179100) gene from the fruit of the 'Golden Crown' apple variety. The full-length cDNA is 1563bp and is recorded in the Rosaceae database (https: / / www.rosaceae.org). As shown in the nucleotide sequence table SEQ ID NO.2, in the gene, ATG represents the start codon and TAG represents the stop codon.

[0041] In order to study the function of gene MdWRKY33, the present invention constructed an overexpression vector and a silencing vector of gene MdWRKY33.

[0042] The construction of the gene expression vector is as follows:

[0043] The forward and reverse primers of MdWRKY33 were designed, and then the gene sequence was cloned from the cDNA of 'Golden Crown', and constructed into the plant expression vector pSuper1300: GFP using the double restriction sites of XbaⅠ and SmaⅠ to form a recombinant plasmid, which was then transformed into Agrobacterium tumefaciens GV3101 strain cells by freeze-thaw method. The primer sequences are as follows:

[0044] First forward primer: GACTCTAGTCTAGATGACTTCTTCCTTCACGAACCT

[0045] First reverse primer: TTAAATGTCGACCCCAGAACTCAGAAAATCCATAACTTCCTTCAC

[0046] The gene silencing vector was constructed as follows:

[0047] The 200-400 bp fragment of the non-conserved region of the MdWRKY33 gene cDNA shown in the nucleotide sequence table SEQ ID NO.2 was selected as the specific fragment, and its sequence was shown in SEQ ID NO.1. Then, the transcription factor gene specific fragment shown in the nucleotide sequence table SEQ ID NO.1 was cloned into the viral silencing vector pTRV2 using the XbaⅠ and KpnⅠ double restriction sites to complete the construction of the recombinant plasmid, and then transformed into Agrobacterium tumefaciens GV3101 strain cells by freeze-thaw method. The primer sequences are as follows:

[0048] Second forward primer: GCTCTAGAGAAGAACCGAAAGTTCGAGAAGAC

[0049] Second reverse primer: GAGACGCGTGAGCTCGGTACCAATTGGCTCGAATTCCGACT

[0050] Apple transient injection experiments, physiological data determination and gene expression analysis showed that silencing the MdWRKY33 gene could delay the softening of apple fruit by inhibiting ethylene biosynthesis and cell wall degradation, indicating that MdWRKY33 plays an important role in the softening of postharvest apple fruit.

[0051] Example 1: Full-length cloning of apple MdWRKY33 gene and construction of related vectors

[0052] 1. RNA extraction and reverse transcription from 'Golden Delicious' apple fruit

[0053] 1. Plant Total RNA Extraction

[0054] RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit, produced by Beijing Tiangen Biochemical Technology Co., Ltd., was used to extract the total RNA content from apple leaf and apple fruit samples. The specific steps are as follows:

[0055] 1) Homogenization. 50-100 mg of plant leaves or fruit pulp were quickly ground into powder in liquid nitrogen, and 500 μL of lysis buffer SL was added. β-mercaptoethanol was added to lysis buffer SL before use, and the mixture was immediately vortexed and vigorously shaken to mix.

[0056] 2) Centrifuge at 12,000 rpm for 2 minutes.

[0057] 3) Place the filter column CS in the collection tube, transfer the supernatant to the filter column CS, centrifuge at 12,000 rpm for 2 minutes, and carefully pipette the supernatant in the collection tube into a new RNase-free centrifuge tube, trying to avoid the pipette tip from touching the cell debris precipitate in the collection tube.

[0058] 4) Slowly add 0.4 times the volume of the supernatant with anhydrous ethanol, mix well, transfer the resulting solution and precipitate into the adsorption column CR3, centrifuge at 12,000 rpm for 15 seconds, pour out the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0059] 5) Add 350 μL of deproteinization solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm for 15 seconds, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0060] 6) Preparation of DNase I working solution: Take 10 μL of DNase I stock solution and put it into a new RNase-Free centrifuge tube, add 70 μL of RDD buffer and mix gently.

[0061] 7) Add 80 μL of DNase I working solution to the center of adsorption column CR3 and leave at room temperature for 15 minutes.

[0062] 8) Add 350 μL of deproteinization solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm for 15 seconds, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0063] 9) Add 500 μL of rinse solution RW to the adsorption column CR3. Ethanol has been added to the rinse solution RW before use. Centrifuge at 12,000 rpm for 15 seconds. Pour away the waste liquid in the collection tube and put the adsorption column CR3 back into the collection tube.

[0064] 10) Repeat step 9.

[0065] 11) Centrifuge at 12,000 rpm for 2 minutes, place the adsorption column CR3 in a new RNase-free centrifuge tube, add 30 - 50 μL of RNase-free double-distilled water to the middle of the adsorption membrane, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 rpm for 1 minute to obtain the RNA solution.

[0066] The cells were stored at -80°C. The integrity of the RNA was checked by agarose gel electrophoresis and the concentration of the RNA was determined on an Agilent 2100 bioanalyzer before storage.

[0067] 2. Reverse transcription of RNA into cDNA

[0068] The samples were reverse transcribed using the HiScript II Q RT SuperMix for qPCR kit, which was purchased from Nanjing Novozyme Biotechnology Co., Ltd. The specific steps are as follows:

[0069] 1) Genomic DNA removal.

[0070]

[0071] Mix well by pipetting gently. Incubate at 42°C for 2 minutes.

[0072] 2) Prepare the reverse transcription reaction system.

[0073]

[0074] Mix by gently pipetting.

[0075] 3) Perform reverse transcription reaction.

[0076]

[0077] Obtain the reverse transcription product. The product can be used immediately for real-time fluorescence quantitative reverse transcription polymerase chain reaction, or stored at -20 degrees Celsius and used within half a year; for long-term storage, it is recommended to store at -70 degrees Celsius after aliquoting. Repeated freezing and thawing of cDNA should be avoided.

[0078] (II) Cloning of the full-length MdWRKY33 gene

[0079] The cDNA of 2 in step (i) of Example 1 was used as a template and amplified using Phanta Max Super-Fidelity DNA Polymerase (P505) high-fidelity enzyme, which was purchased from Nanjing Novozyme Biotechnology Co., Ltd. The primers for the upstream and downstream genes of MdMRKY33 are as follows:

[0080] Third forward primer: ACATGACTTCTTCCTTCACGAAC

[0081] Third forward primer: CTCGCGTAACATTGTAACCGAT

[0082] The amplification steps are as follows: 1)

[0084]

[0085] Template usage:

[0086]

[0087] 2) PCR reaction program: pre-denaturation at 95 degrees Celsius for 3 minutes; cycle parameters are denaturation at 95 degrees Celsius for 15 seconds, annealing at 58 degrees Celsius for 15 seconds, and extension at 72 degrees Celsius for 70 seconds, for 35 cycles; full extension at 72 degrees Celsius for 5 minutes.

[0088] After the PCR reaction, the PCR product was recovered, connected to the cloning vector pMD19-T, transformed into Escherichia coli DH5α strain cells, spread on lysate broth (Luria-Bertani) solid culture medium with 50 mg / L ampicillin, cultured overnight at 37 degrees Celsius, and single colonies were selected and sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing results were blasted against the Rosaceae plant database, and the cloned sequence was consistent with the MD04G1167700 sequence.

[0089] (III) Construction of MdWRKY33 gene-related vector

[0090] The nucleotide sequence table SEQ ID NO.2 of the MdWRKY33 gene obtained in step (ii) of Example 1 was amplified using the second forward primer and the second reverse primer with XbaI and KpnI restriction sites, respectively. The viral silencing vector pTRV2 was digested with restriction endonucleases XbaI and KpnI, agarose gel electrophoresis, gel excision recovery, and ClonExpress® II One Step Cloning Kit (C112) (Novagen, Nanjing) homologous recombinase ligated the linear viral silencing vector pTRV2 vector and the target gene MdWRKY33 specific fragment, and transformed into Escherichia coli DH5α strain cells. The recombinant plasmid was extracted from the single colony with the correct sequencing, and the recombinant plasmid was transferred into Agrobacterium tumefaciens GV3101 strain cells by freeze-thaw method.

[0091] Similarly, the full-length nucleotide sequence of MdWRKY33 (SEQ ID NO. 2) was cloned into the empty vector pSuper1300:GFP using the first forward primer and the first reverse primer with XbaI and SmaI restriction sites, respectively, to form a recombinant plasmid, which was then transferred into Agrobacterium tumefaciens GV3101 strain cells by freeze-thaw method.

[0092] Take 5 μL of the recombinant plasmid and add it to 50 μL of competent cells of Agrobacterium tumefaciens GV3101 strain, ice bath for 30 minutes, quick freeze in liquid nitrogen for 5 minutes, heat shock at 37 degrees Celsius for 5 minutes, and ice bath for 5 minutes. Take 500 μL of lysing broth (Luria-Bertani) liquid culture medium, add it to a 1.5 mL centrifuge tube, add the transformed product, and shake at 28 degrees Celsius and 200 rpm for 3-5 hours. Take 150 μL and spread it on a lysing broth solid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, put it in a 28 degrees Celsius incubator for 2-3 days, pick a white single colony from the lysing broth solid culture plate, add it to a lysing broth liquid culture medium containing 700 μL of 50 mg / L kanamycin and 25 mg / L rifampicin, and shake and culture it at 28 degrees Celsius and 200 rpm for 24 hours. The expanded bacterial solution was used as a template for polymerase chain reaction amplification verification to obtain a bacterial solution of Agrobacterium tumefaciens GV3101 strain cells containing the recombinant plasmid.

[0093] Example 2: Expression of the MdWRKY33 gene in the fruits of the 'Golden Crown' and 'Golden Crown Bud Mutation' apple varieties at different storage times

[0094] 1) In order to explore the transcription factor genes that affect the softening of postharvest apple fruit, co-expression network analysis was performed on the transcriptome data of 'Golden Crown' and 'Golden Crown Bud Mutation' apples, see Figure 1 A in Figure 1, 8 transcription factors related to ethylene and cell wall were found, and cluster heat map analysis was performed on the 8 transcription factors. Figure 1 In B, MdWRKY33 was found to be significantly upregulated in the softer 'Golden Crown Bud Mutation'.

[0095] 2) The pulp of 'Golden Delicious' and 'Golden Delicious Bud Mutation' apples at different storage periods were sampled and rapidly fixed in liquid nitrogen. Total RNA was extracted from the pulp at different storage periods and reverse transcribed into cDNA in the same manner as step (I) in Example 1.

[0096] 3) Design specific primers in the non-conserved region of the MdWRKY33 gene and the internal reference primer of apple. The sequence is as follows:

[0097] Fourth forward primer (MdWRKY33): ATCGGACAGGACAGGACTAAT;

[0098] Fourth reverse primer (MdWRKY33): GGAACATGGGTGAGCTGAAA;

[0099] Fifth forward primer (MdActin): GAAGCTGCTGGCATTCATGA;

[0100] Fifth reverse primer (MdActin): CTGGTGGAGCTACAACCTTG;

[0101] 4) Using the cDNA obtained in step (2) as a template, adjust these cDNA templates using the apple internal reference primers, the fifth forward primer (MdActin) and the fifth reverse primer (MdActin), so that the concentration of each cDNA template is consistent.

[0102] 5) Real-time fluorescence quantitative reverse transcription polymerase chain reaction was performed using cDNA templates of consistent concentration to detect MdWRKY33, see Figure 1 C, expression difference of MdWRKY33 gene in 'Golden Crown' and 'Golden Crown Bud Mutation' fruits at different storage periods. It was found that as the storage period prolonged and the firmness decreased, the expression level of MdWRKY33 increased significantly, and the expression level was high at 15 days of storage, until the firmness was low in the late storage period, the expression level of MdWRKY33 decreased, and the expression level of 'Golden Crown' was always lower than that of 'Golden Crown Bud Mutation'. The expression pattern of MdWRKY33 gene was consistent with the expected function of MdWRKY33 gene in this experiment, so MdWRKY33 was further studied in the later stage.

[0103] Example 3: Transient transformation of apple fruit with a silencing vector containing a specific fragment of the MdWRKY33 gene

[0104] The infection solution used in this Example 3 was prepared as follows: 1000 mL of the infection solution was prepared by uniformly mixing 976 mL of distilled water, 10 mL of 1 mol / L magnesium chloride, 10 mL of 1 mol / L fatty acid methyl ester sulfonate and 4 mL of 50 mmol / L acetosyringone, and the pH value of the infection solution was 5.6.

[0105] (1) The transcription factor gene-specific fragment shown in SEQ ID NO. 1 in the nucleotide sequence table was cloned into the viral silencing vector pTRV2 to obtain a recombinant plasmid; the specific operation steps are shown in (III) MdWRKY33 gene-related vector construction operation steps in Example 1.

[0106] (2) Prepare strain cell monoclone A, strain cell monoclone B and strain cell monoclone C. For the specific operation steps of the freeze-thaw method, refer to Example 1.

[0107] (2.1) 5 μL of the auxiliary vector pTRV1 was transferred into 50 μL of Agrobacterium tumefaciens GV3101 cells by freeze-thaw method to obtain strain cell A;

[0108] Add strain cell A to 500 μL lysing broth liquid culture medium, and culture at 28°C and 200 rpm for 6 hours to obtain shake flask culture A.

[0109] 150 μL of shake flask culture A was spread on a solid medium containing lysate broth containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured at 28°C for 2 days to obtain a single clone of strain A.

[0110] (2.2) Transfer 5 μL of the recombinant plasmid into 50 μL of Agrobacterium tumefaciens GV3101 cells by freeze-thaw method to obtain strain cell B;

[0111] Add strain B cells to 500 μL lysing broth liquid culture medium, and culture at 28°C and 200 rpm for 6 hours to obtain shake flask culture B;

[0112] 150 μL of shake flask culture B was spread on a lysing broth plate solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured for 2 days at 28°C to obtain a single clone of strain B.

[0113] (2.3) 5 μL of the viral silencing vector pTRV2 was transferred into 50 μL of Agrobacterium tumefaciens GV3101 cells by freeze-thaw method to obtain strain cell C;

[0114] Add strain C cells to 500 μL of lysing broth liquid culture medium, and culture at 28°C and 200 rpm for 6 hours to obtain shake flask culture C;

[0115] 150 μL of shake flask culture C was spread on a lysing broth plate solid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and screened and cultured for 2 days at 28°C to obtain strain cell monoclonal clone C, which was used as a comparison material.

[0116] (3) Pick one cell clone A of the strain and inoculate it into 700 μL of lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin; pick one cell clone B of the strain and inoculate it into 700 μL of lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin; pick one cell clone C of the strain and inoculate it into 700 μL of lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. Expand and culture them at 28°C and 200 rpm, respectively, and shake culture for 24 hours to obtain Agrobacterium culture liquid A, Agrobacterium culture liquid B and Agrobacterium culture liquid C, respectively.

[0117] (4) The Agrobacterium culture liquid A was added to a lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at a volume ratio of 1:100, the Agrobacterium culture liquid B was added to a lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at a volume ratio of 1:100, and the Agrobacterium culture liquid C was added to a lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at a volume ratio of 1:100, and the cultures were shaken at 28°C and 200 rpm until the absorbance at a wavelength of 600 nm was 1.0, and the cells were collected by centrifugation at a speed of 5000 rpm to obtain cell A, cell B, and cell C, respectively.

[0118] (5) Add equal volumes of bacterial cells A to the infection solution, add equal volumes of bacterial cells B to the infection solution, and add equal volumes of bacterial cells C to the infection solution, and break up the bacterial cells; suspend them separately at room temperature until the absorbance at a wavelength of 600 nm is 1, and incubate them at room temperature for 3 hours to obtain infection buffer A, infection buffer B, and infection buffer C, respectively.

[0119] (6) Mix infection buffer A and infection buffer B at a volume ratio of 1:1 to obtain a first mixed infection buffer; mix infection buffer A and infection buffer C at a volume ratio of 1:1 to obtain a second mixed infection buffer; and place the two mixed infection solutions in a dark incubator at 28 degrees Celsius for 3 hours.

[0120] (7) Immerse the apple fruit in the first mixed infection buffer and place it at -0.8 kg / cm 2 Under vacuum conditions, vacuum treatment was performed twice, each time for 5 minutes, to obtain instantaneously silent apple fruits.

[0121] Finally, the fruit transient transformation experiment was carried out by injection. The apples were divided into two groups, A and B, with 50 apples in each group. The first mixed infection buffer was injected into the apple fruits of group A, and the second mixed infection buffer was injected into the apple fruits of group B. The second mixed infection buffer was used as the control material. The specific injection operation was as follows: Use a needle to select 4 evenly distributed points at the equator of the 'Golden Crown Bud Mutation' fruit as injection points, pierce holes at the injection points, and gently press the syringe with the needle removed on the needle hole. Slowly inject 0.5 mL of the first mixed infection buffer or the second mixed infection buffer into the apple fruits of group A or group B through the needle hole, respectively. The injection speed is about 1 mL / minute, and then the injected apple fruits are stored at room temperature. The fruits of group A are silent fruits, and those of group B are control fruits.

[0122] Phenotypic observations and related physiological index measurements were performed on the injected silent fruits and control fruits, respectively, and it was found that the color of the control fruits deepened faster than that of the silent fruits; see Figure 4 Compared with the control fruits, the firmness of the silent fruits decreased more slowly, the ethylene production rate decreased, the respiration rate increased, and the ripening process was slower. Figure 5 As can be seen in A, the softening speed of silent fruit is slow; Figure 5 As can be seen in B, the ethylene production rate of silent fruits is reduced; Figure 5 As can be seen in Figure C, the respiration rate of silent fruits increased significantly.

[0123] Example 4: Subcellular localization of MdWRKY33 gene

[0124] Similar to the above-mentioned fruit transient overexpression method, the MdWRKY33 fragment cut with restriction endonucleases XbaI and SmaI was inserted into the pSuper1300:GFP vector to produce a recombinant plasmid of MdWRKY33 and green fluorescent protein (GFP) fusion protein. The obtained recombinant plasmid was transformed into Agrobacterium tumefaciens GV3101 strain cells and infected with fresh onion scales. The infected onion scales were observed using EVOS FL AUTO2 (Thermo Fisher Scientific, Massachusetts, USA). The specific steps are as follows:

[0125] 1) Use fresh onions, remove the outer scales first, then cut the inner skin of the onion into small pieces with a sterilized blade on a clean bench, remove the inner skin with sterilized tweezers, spread it flat on 1 / 2 MS solid culture medium without any hormones, and culture it in a dark incubator at 28 degrees Celsius for about 24 hours.

[0126] 2) In the dark, add the Agrobacterium culture liquid of the recombinant plasmid a containing the target gene to the lysing broth liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and culture it on a constant temperature shaker at 28 degrees Celsius at 200 rpm. Determine the absorbance at a wavelength of 600 nm to be about 1.0. At the same time, use the same steps to culture the recombinant plasmid b containing the nuclear localization marker and mCherry and P19 (promoting infection effect) until the absorbance at a wavelength of 600 nm is about 1.0. According to the final concentration of the recombinant plasmid a containing the target gene, the recombinant plasmid b containing the nuclear localization marker and mCherry, and P19, calculate the amount of each bacterial liquid, transfer it to a 50 mL centrifuge tube, centrifuge it at 5000 rpm for 10 minutes, then discard the supernatant, retain the bacteria, and resuspend them in 1 / 2 MS liquid medium containing acetosyringone to obtain the infection liquid.

[0127] 3) In a clean bench, place the pre-treated onion inner skin in the pre-prepared infection solution for 15 minutes, stirring regularly to improve the immersion effect. Then, remove the immersion solution using sterile filter paper and place it on 1 / 2 MS solid medium containing acetosyringone at 28 degrees Celsius for 16 hours.

[0128] 4) Under an AUTO2 microscope, first immerse the onion epidermis in 1 / 2 MS liquid culture medium, then wash it in sterile water, and finally spread the epidermis and place it on a clean glass slide. Cover it with a coverslip and then remove the bubbles to finally observe the localization of the target protein at the subcellular level.

[0129] The results showed that the fusion protein was localized in the nucleus. Figure 2 , scale bar is 125 µm.

[0130] Figure 2 A in the figure shows the distribution of the target protein in the cell after fusion with green fluorescent protein, which appears green; Figure 2 Figure B shows that the protein containing the nuclear localization marker and mCherry is located in the cell nucleus and appears red; Figure C shows the structural integrity and status of the cell; Figure 2 D in the figure shows the result of superimposing the GFP image and the nuclear marker image. Both are located in the cell nucleus, so they appear yellow after superposition.

[0131] Example 5: Phenotypic and physiological data determination of transiently transformed apple fruit

[0132] 1. Apple fruit phenotype photography

[0133] The apples of the two test groups were placed in a small studio and photographed with a camera aimed at the injection hole. The results showed that the color of the control apples deepened faster than that of the silent fruits, and the silent fruits matured more slowly. Figure 4 .

[0134] 2. Determination of apple fruit firmness, ethylene release rate and respiration rate

[0135] 1) Determination of fruit hardness: The hardness of apple fruits in the two test groups was measured using a CT3 texture analyzer (Brookfield, USA) with a 10 mm diameter probe. The fruit was peeled 1 mm from 1 cm away from the four injection points at the equator for measurement. The measurement speed was 1 mm / s and the depth was 10 mm. Five fruits were selected from each test group as replicates and the measurement was performed once every 4 days.

[0136] 2) Determination of fruit ethylene release rate: 5 apple fruits were taken from each of the 2 test groups. Each fruit was placed in a 1 L beaker and sealed with plastic wrap. Each container was kept stationary for 1 hour. Then three injections of 1 mL gas samples were drawn from it and injected into a GC-2010 gas chromatograph for the determination of ethylene release rate.

[0137] 3) Determination of fruit respiration rate: Take 5 apples from each of the two test groups, put each fruit into a 1 L beaker and seal it with plastic wrap. Keep each container still for 1 hour, and then use CAMBO580CO2 analyzer to measure the respiration rate of the fruit. Calculation formula: Respiration rate = (C1-C0) / W·t, where C1 represents the CO2 release during measurement (mg), C0 represents the CO2 release during initial measurement (mg), W represents the weight of fresh fruit (kg), and t represents the measurement time (hours).

[0138] Throughout the storage period, the ripening process of silent fruits was slower compared with that of control fruits, see Figure 5 . Silent fruit softens more slowly, see Figure 5 A in; the ethylene production rate of silent fruits is reduced, see Figure 5 B in; The respiration rate of the silent fruit increased significantly, see Figure 5 C in.

[0139] Example 6: Transient transformation of apple fruit and expression of softening-related genes

[0140] 1) Apple pulp from four test groups at different storage periods was sampled and rapidly fixed in liquid nitrogen. Total RNA from the pulp of the above different groups at different storage periods was extracted and reverse transcribed into cDNA, using the same method as step (I) in Example 1.

[0141] 2) The specific primer sequences of the MdWRKY33 gene are the fourth forward primer and the fourth reverse primer. Specific primers were designed in the non-conserved regions of the MdACO, MdACS, MdPG, and MdEXPA8 genes, and the sequences are as follows:

[0142] Sixth forward primer (MdACO): GGCTACACACAGAGCATACAA;

[0143] Sixth reverse primer (MdACO): GCTGCCACCATTTCCTTAAAC;

[0144] Seventh forward primer (MdACS): CTGGAAGAAGCCTACCAAGAAG;

[0145] Seventh reverse primer (MdACS): CCATGTCGTCGTTGGAGTAAA;

[0146] Eighth forward primer (MdPG): CACAGTTGTTGTGGTCATTTGT;

[0147] Eighth reverse primer (MdPG): CCTTCTATGGTGTCCGTGTATG;

[0148] Ninth forward primer (MdEXPA8): CCTCATCCTCTCTCTCCTTAGT;

[0149] Ninth reverse primer (MdEXPA8): TGGCTGTACAAGTTCCCATATC;

[0150] 3) Using the cDNA obtained in step (1) as a template, adjust these cDNA templates using the apple internal reference primers, the fifth forward primer (MdActin) and the fifth reverse primer (MdActin), so that the concentration of each cDNA template is consistent.

[0151] 4) Real-time fluorescence quantitative reverse transcription polymerase chain reaction was performed using cDNA templates of consistent concentration to detect the expression differences of MdACO, MdACS, MdPG, MdEXPA8, and MdWRKY33 genes in fruits of different experimental groups at different storage periods.

[0152] The results showed that the expression of MdWRKY33 in silenced fruits was significantly reduced compared with that in control fruits (empty vector pTRV), see Figure 6 A in the figure; in the silent fruit, the cell wall-related gene MdPG is downregulated, see Figure 6 The results showed that MdWRKY33 positively regulates cell wall degradation during fruit storage, and MdWRKY33 can positively regulate fruit softening by promoting cell wall degradation.

[0153] Example 7: Yeast one-hybrid and dual-luciferase reporter gene experiments of MdWRKY33 and MdPG

[0154] () Yeast one-hybridization between MdWRKY33 and MdPG

[0155] The full-length cDNA sequence of the MdWRKY3 gene obtained in step (ii) of Example 1 was amplified using the primer sequences of the tenth forward primer (MdWRKY33) and the tenth reverse primer (MdWRKY33) with EcoRI and Hind III restriction sites, respectively. The empty vector pJG4-5 was digested with restriction endonucleases EcoRI and HindIII, subjected to agarose gel electrophoresis, gel recovery, and the linear pJG4-5 vector and the target gene MdWRKY33 fragment were connected using the homologous recombination enzyme of ClonExpress® II One Step Cloning Kit (C112). The cells were transformed into Escherichia coli DH5α strain cells, plated on a solid culture medium of lysing broth supplemented with 50 mg / L ampicillin, and cultured at 37 degrees Celsius overnight. Single colonies were selected and sent to Shanghai Sangon Co., Ltd. for sequencing. Plasmids were extracted from single colonies with correct sequencing. The homologous recombination enzyme was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0156] Similarly, the 11th forward primer (MdPG1), 11th reverse primer (MdPG1), 12th forward primer (MdPG2):, 12th reverse primer (MdPG2):, 13th forward primer (MdPG3), 13th reverse primer (MdPG3) with EcoRI and XhoI restriction sites were used to construct MdPG segments on the vector pLacZi-2μ to form recombinant plasmids, which were transformed into Escherichia coli DH5α strain cells, spread on lysing broth solid medium with 50 mg / L ampicillin, cultured at 37 degrees Celsius overnight, and single colonies were selected and sent to Shanghai Sangon Co., Ltd. for sequencing. Plasmids were extracted from single colonies with correct sequencing. The above four recombinant plasmids were transferred into GV3101 Agrobacterium strain cells by freeze-thaw method.

[0157] Tenth forward primer (MdWRKY33): AGATTATGCCTCTCCCATGGAGAACAACGGGATCGGA;

[0158] Tenth reverse primer (MdWRKY33): GAAGAAGTCCAAAGCTTGAACTCAGAAAATCCATAACTTCC;

[0159] Eleventh forward primer (MdPG1): GGAATTCTCTTTTCATGGTTAAGTAATAAACT;

[0160] Eleventh reverse primer (MdPG1): CCGCTCGAGTTGAAAAATATGCCCTAACATAACT;

[0161] Twelfth forward primer (MdPG2): GGAATTCTTGCGGGGGATGTG;

[0162] Twelfth reverse primer (MdPG2): CGCTCGAGATATTCCATTTGGAGATTGTTT;

[0163] Thirteenth forward primer (MdPG3): GGAATTCTTAGATATGATATTTCGATGATGAT;

[0164] Thirteenth forward primer (MdPG3): CCGCTCGAGGAAATTCCTTCAAATTTACTAAAATG;

[0165] The specific steps of MdWRKY33 and MdPG yeast one-hybridization are as follows:

[0166] 1) Streak the EGY48 yeast strain on a YPD plate and culture at 28 degrees Celsius for 2-3 days

[0167] 2) Pick 5-10 large clones and incubate in 25 mL YPD medium at 28 degrees Celsius overnight.

[0168] 3) Centrifuge at 3000 rpm for 5 minutes

[0169] 4) Wash with 25 mL sterile water and vortex to suspend

[0170] 5) Centrifuge again at 3000 rpm for 5 minutes

[0171] 6) Wash with 25 mL sterile water and vortex to suspend

[0172] 7) Aliquot 1 mL into 1.5 mL tubes

[0173] 8) Centrifuge at 6000 rpm for 5 minutes

[0174] 9) Resuspend with 100 μL of one-step buffer

[0175] 10) Add 6 μL of vector DNA mixture (boil for 20 minutes before use and place on ice), add 1 μL of each vector according to the group, and mix.

[0176] 12) Incubate at 45°C for 30 minutes, vortexing every 10 minutes.

[0177] 13) Plate the cells on the corresponding deficiency medium and incubate at 28°C for 3 days

[0178]

[0179]

[0180] pH 7.0, sterilized

[0181]

[0182]

[0183]

[0184] According to the yeast one-hybrid experiment, it can be concluded that MdWRKY33 can bind to the MdPG promoter, see Figure 3 A in.

[0185] 2. Dual fluorescence reporter gene experiment

[0186] The full-length cDNA sequence of the MdWRKY3 gene obtained in step (ii) of Example 1 was amplified using the primer sequences of the fourteenth forward primer (MdWRKY33) and the fourteenth reverse primer (MdWRKY33) with XbaI and SmaI restriction sites, respectively. The empty vector pGreenII 62-SK was digested with restriction endonucleases XbaI and SmaI, subjected to agarose gel electrophoresis, gel recovery, and ClonExpress® II One Step Cloning Kit (Cat. No.: C112) homologous recombination enzyme to connect the linear pGreenII 62-SK vector and the target gene MdWRKY33 fragment, and transformed into Escherichia coli DH5α strain cells. The recombinant plasmid a was extracted from the single colony with correct sequencing, wherein the homologous recombination enzyme was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0187] Similarly, the primers with KpnI and SmaI restriction sites, the 15th forward primer (MdPG) and the 15th reverse primer (MdPG), were used to construct MdPG on the vector pGreenII 0800-LUC to form a recombinant plasmid b, which was transformed into Escherichia coli DH5α strain cells, spread on a solid medium of lysing broth with 50 mg / L kanamycin, cultured at 37 degrees Celsius overnight, and single colonies were selected and sent to Shanghai Sangon Co., Ltd. for sequencing. Plasmids were extracted from single colonies with correct sequencing. The above two recombinant plasmids were transferred into GV3101 Agrobacterium strain cells by freeze-thaw method.

[0188] The specific steps of the dual luciferase reporter gene experiment are as follows:

[0189] The infection solution used in this Example 7 was prepared as follows: 1000 mL of the infection solution was prepared by uniformly mixing 976 mL of distilled water, 10 mL of 1 mol / L magnesium chloride, 10 mL of 1 mol / L fatty acid methyl ester sulfonate and 4 mL of 50 mmol / L acetosyringone, and the pH value of the infection solution was 5.6.

[0190] 1) Plant tobacco in advance. When the tobacco reaches the 4-6 leaf stage, it can be used for infection.

[0191] 2) After the frozen Agrobacterium was inoculated into fresh lysing broth liquid culture medium, it was cultured overnight at 200 rpm and 28 degrees Celsius until the absorbance at 600nm was about 1.0, and then centrifuged at 5000 rpm for 10 minutes. The strain was resuspended in the infection solution until the absorbance at 600nm was 1.0, and the recombinant plasmid b bacterial solution: pGreenⅡ62-SK bacterial solution (or recombinant plasmid a bacterial solution): P19 bacterial solution were mixed at a volume ratio of 1:10:10 (variable ratio) to obtain the control group bacterial solution and the experimental group bacterial solution, and then allowed to stand for 3 hours. The tobacco leaves were divided into two parts according to the central veins, and the control group and experimental group bacterial solutions were injected respectively. After one day of dark culture, it was transferred to light culture for two days for detection.

[0192] Fourteenth forward primer (MdWRKY33): GCTCTAGAACATGACTTCTTCCTTCACG;

[0193] Fourteenth reverse primer (MdWRKY33): TCCCCCGGGCTCGCGTAACATTGTAACCGTCC;

[0194] Fifteenth forward primer (MdPG): GGGGTACCATTACCCTATCATTTGTCAA;

[0195] Fifteenth reverse primer (MdPG): TCCCCCGGGTGATGCTTTCTTTTTACTAT;

[0196] The results showed that MdWRKY33 could bind to the MdPG promoter and activate the expression of MdPG. Figure 3 B in.

[0197] Based on the above technology, a MdWRKY33 gene was isolated from apples. Through the functional verification and physiological phenotype determination of apple transient injection experiments, it can be seen that MdWRKY33 has a significant effect on apple fruit softening and can promote softening. The MdWRKY33 gene provides a basis for improving the intrinsic quality of apple fruit and has important economic and social benefits for improving apple quality.

[0198] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. An application of a transcription factor gene specific fragment shown in SEQ ID NO.1 in delaying the softening of post-harvest apple fruit, characterized in that: In apple varieties with poor storage tolerance, the transcription factor gene specific fragment shown in the nucleotide sequence table SEQ ID NO.1 is used to knock out or silence the MdWRKY33 transcription factor gene, thereby inhibiting ethylene biosynthesis and cell wall degradation in apples and delaying the softening of post-harvest apple fruits.

2. The method for controlling the use of the transcription factor gene specific fragment as claimed in claim 1 to delay the softening of post-harvest apple fruit, characterized in that: The steps are as follows: (1) Clone the transcription factor gene specific fragment shown in the nucleotide sequence table SEQ ID NO.1 into the viral silencing vector pTRV2 to obtain a recombinant plasmid; (2) Preparation of strain cell monoclonal A and strain cell monoclonal B (2.1) 5 μL of the auxiliary vector pTRV1 was transferred into 50 μL of Agrobacterium tumefaciens GV3101 cells by freeze-thaw method to obtain strain cell A; Add strain cell A to 500 μL lysing broth liquid culture medium, and culture at 28°C and 200 rpm for 6 hours to obtain shake flask culture A. 150 μL of shake flask culture A was spread on a solid medium containing lysate broth containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured at 28°C for 2 days to obtain a single clone of strain A. (2.2) Transfer 5 μL of the recombinant plasmid into 50 μL of Agrobacterium tumefaciens GV3101 cells by freeze-thaw method to obtain strain cell B; Add strain B cells to 500 μL lysing broth liquid culture medium, and culture at 28°C and 200 rpm for 6 hours to obtain shake flask culture B; 150 μL of shake flask culture B was spread on a lysing broth plate solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured for 2 days at 28°C to obtain a single clone of strain B. (3) Pick one cell clone A of the strain and inoculate it into 700 μL of lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin for expansion culture. Pick one cell clone B of the strain and inoculate it into 700 μL of lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. Expand and culture them at 28°C and 200 rpm, respectively. Shake the culture for 24 hours to obtain Agrobacterium culture liquid A and Agrobacterium culture liquid B, respectively. (4) adding the Agrobacterium culture liquid A to a lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at a volume ratio of 1:100, and adding the Agrobacterium culture liquid B to a lysing broth liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at a volume ratio of 1:100, and culturing the cultures at 28° C. and 200 rpm until the absorbance at a wavelength of 600 nm is 1.0, and collecting the cells by centrifugation to obtain cells A and B, respectively; (5) adding the bacterial cells A to the infection solution in equal volumes, and adding the bacterial cells B to the infection solution in equal volumes, and breaking up the bacterial cells; suspending them respectively at room temperature until the absorbance at a wavelength of 600 nm is 1, and incubating them at room temperature for 3 hours to obtain infection buffer A and infection buffer B, respectively; (6) Mix infection buffer A and infection buffer B in a volume ratio of 1:1 to obtain a mixed infection buffer; (7) Immerse the apple fruit in the mixed infection buffer and place it at -0.8 kg / cm 2 Under vacuum conditions, vacuum treatment was performed twice, each time for 5 minutes, to obtain instantaneously silent apple fruits.

3. The control method according to claim 2, characterized in that: In step (5), the infection solution is prepared by uniformly mixing 976 mL of distilled water, 10 mL of 1 mol / L magnesium chloride, 10 mL of 1 mol / L fatty acid methyl ester sulfonate and 4 mL of 50 mmol / L acetosyringone, and the pH value of the infection solution is 5.6.

Images