Method for biosynthesizing human body structural material type VI collagen

Abstract

The invention provides a method for biosynthesizing human structural material type VI collagen. The collagen comprises an amino acid sequence as shown in SEQ ID NO: 2 or a variant amino acid sequence obtained by mutating the amino acid sequence, and the variant amino acid sequence retains the function of the amino acid sequence as shown in SEQ ID NO: 2. The collagen provided by the invention can promote cell adhesion and has a triple helix structure.

Description

Technical Field

[0001] The present application relates to the field of proteins or polypeptides, and specifically to collagen, a preparation method and use thereof. Background Art

[0002] Collagen is a type of protein widely distributed in human connective tissues. It is also the most abundant protein in the human body, accounting for 25% to 35% of the total protein. Its main functions are to maintain the extracellular environment, maintain the normal physiological functions of tissues and organs, and repair body damage. Collagen is a natural biological resource with bio-tissue compatibility, cell-supporting elasticity and degradability that other polymer materials cannot match. Therefore, collagen can be widely used in industries such as medicine and cosmetics.

[0003] In recent years, with the widespread application of genetic engineering technology, researchers have created various types of recombinant collagen. For example, recombinant collagen can be constructed by selecting short amino acid sequences from natural human collagen. The recombinant collagen constructed in this way has advantages such as low immunogenicity, high biological activity, and good stability. In theory, the shorter the amino acid sequence of this recombinant collagen, the better the transdermal absorption performance, but the shorter the amino acid sequence is, the better. How to design a short amino acid sequence so that the constructed recombinant collagen has better transdermal absorption performance, there is no theory in the prior art that can serve as a guide.

[0004] Type VI collagen is a component of the extracellular matrix of virtually all connective tissues, including cartilage, bone, tendon, muscle, and cornea, where it forms abundant and structurally distinct microfibrils organized into distinct structural assemblies. The absence of type VI collagen affects the arrangement of fibronectin in the extracellular matrix. The non-triple-helical form of the type IV collagen α1 chain inhibits endothelial-cadherin-mediated cell-cell junctions.

[0005] There is a need in the art for new type VI collagen and methods for making the same. Summary of the invention

[0006] In response to current needs, the inventors provide a novel type VI collagen. The type VI collagen herein can be expressed using engineered bacteria. The present invention also provides a method for biosynthesizing type VI collagen as a structural material for the human body.

[0007] In a first aspect, a collagen is provided, which comprises a plurality of repeating units, the repeating units comprising the amino acid sequence shown in SEQ ID NO:1, or an amino acid sequence in which one or more amino acid residues are mutated in the amino acid sequence shown in SEQ ID NO:1, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO:1; the number of repeating units is 10-20, 12-18 or 13-16.

[0008] In one embodiment, the number of repeating units is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0009] In one embodiment, each repeating unit is directly linked or connected through a linker of one amino acid or multiple amino acid residues.In one embodiment, the linker comprises 2, 3, 4, 5, 6, 7 or 8 amino acid residues.

[0010] In one embodiment, the mutation is a substitution, insertion, deletion or addition. In one embodiment, the substitution is a conservative amino acid substitution.

[0011] In one embodiment, the collagen is derived from humans. In one embodiment, the collagen has a triple helical structure. In one embodiment, the collagen has cell adhesion function. In one embodiment, the collagen is recombinant collagen, recombinant humanized collagen or recombinant humanized type VI collagen.

[0012] In one embodiment, the collagen comprises the following amino acid sequence:

[0013] (1) the amino acid sequence shown in any one of SEQ ID NOs: 2 and 4-7;

[0014] (2) an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 2 and 4-7; or

[0015] (3) An amino acid sequence in which one or more amino acid residues are mutated in the amino acid sequence shown in any one of SEQ ID NOs: 2 and 4-7.

[0016] In one embodiment, the mutation is a substitution, insertion, deletion or addition. In one embodiment, the substitution is a conservative amino acid substitution.

[0017] In a second aspect, a nucleic acid is provided which encodes the collagen described herein.

[0018] In one embodiment, the nucleic acid has the nucleotide sequence shown in SEQ ID NO:3.

[0019] In a third aspect, a vector is provided, comprising a nucleic acid according to the present invention. In one embodiment, the vector comprises nucleotides encoding a purification tag, nucleotides encoding a leader and / or a regulatory element.

[0020] In one embodiment, the purification tag is selected from a His tag, a GST tag, an MBP tag, a SUMO tag or a NusA tag.

[0021] In one embodiment, the regulatory element is selected from a promoter, a terminator and / or an enhancer.

[0022] In a fourth aspect, a host cell is provided, comprising a nucleic acid as described herein or a vector as described herein.

[0023] In one embodiment, the host cell is a eukaryotic cell or a prokaryotic cell. In one embodiment, the eukaryotic cell is a yeast cell, an animal cell and / or an insect cell, and / or the prokaryotic cell is an E. coli cell, such as E. coli BL21.

[0024] In a fifth aspect, a method for producing collagen is provided, comprising:

[0025] (1) culturing the host cell described herein under appropriate culture conditions;

[0026] (2) harvesting host cells and / or culture medium containing collagen; and

[0027] (3) Purifying collagen, for example, including (1) purifying collagen on a Ni affinity chromatography column; (2) adding collagen tools for enzymatic cleavage; and / or (3) purifying collagen on an ion exchange column.

[0028] In a sixth aspect, a composition is provided, comprising the collagen, nucleic acid, vector and / or host cell described herein.

[0029] In one embodiment, the composition is a pharmaceutical composition or a cosmetic composition.

[0030] In one embodiment, the composition is one or more of biological dressings, human bionic materials, plastic surgery materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetrics and gynecology biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials, pharmaceutical excipients and food additives.

[0031] In one embodiment, the composition comprises a pharmaceutically and / or cosmetically acceptable carrier.

[0032] In one embodiment, the composition is a solid, liquid or gel composition.

[0033] In one embodiment, the composition is an oral and / or topical composition, preferably a smear composition.

[0034] In one embodiment, the composition is a kit.

[0035] In one embodiment, the composition is a liquid formulation comprising the collagen described herein and a pharmaceutically and / or cosmetically acceptable carrier.

[0036] In one embodiment, the carrier is a buffer, such as D-PBS buffer or PBS buffer.

[0037] In a seventh aspect, a method for promoting cell adhesion or attachment is provided, the method comprising contacting cells with the collagen and / or composition herein.

[0038] In an eighth aspect, provided is the use of the collagen, nucleic acid, vector, host cell and / or composition described herein in biological dressings, human bionic materials, plastic surgery materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetrics and gynecology biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials or 3D printed artificial organ biomaterials.

[0039] In a ninth aspect, provided is the use of the collagen and / or composition described herein in the preparation of a drug or kit for promoting cell adhesion or cell attachment.

[0040] The advantages of the present invention include: the collagen described in this article is a new humanized type VI collagen, which has the effect of promoting cell adhesion and has a triple helix structure; the recombinant humanized collagen C6A1 in this article has higher (more than 2 times) cell adhesion activity than bovine type I collagen, achieving unexpected technical effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 The electrophoresis diagram of recombinant humanized type VI collagen is shown.

[0042] Figure 2 The cell adhesion activity of recombinant humanized type VI collagen was demonstrated. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0044] As used herein, recombinant humanized collagen is a full-length or partial amino acid sequence fragment encoded by a sex-specific gene of human collagen prepared by DNA recombinant technology, or a combination of functional fragments of human collagen. In this article, recombinant humanized collagen is recombinant humanized type VI collagen, which is a peptide or polypeptide of multiple amino acid residues connected by peptide bonds.

[0045] As used herein, the term "and / or" should be considered as a specific disclosure of each of the two specified features or components, including or excluding the other. Thus, the term "and / or" as used herein in phrases such as "A and / or B" is intended to include A and B, A or B, A (alone), and B (alone). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to cover each of the following: A, B, and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0046] As used herein, "one or more" can be any suitable integer. In the case of collagen mutations (e.g., substitutions, deletions, insertions or additions), "one or more" is a number that is easily determined by those skilled in the art, such as 1-90 and any integers and ranges therebetween, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 or 39, etc.

[0047] As used herein, "nucleic acid" refers to a plurality of nucleotides linked by internucleotides. Internucleotide linkages may be, for example, phosphodiester bonds. The nucleic acid herein may comprise a polynucleotide encoding a polypeptide of the present invention. In order to facilitate subsequent processing of the polypeptide, the nucleic acid of the present invention may also comprise nucleotides encoding a purification tag, such as a His tag, a GST tag, an MBP tag, a SUMO tag or a NusA tag, and a nucleotide sequence encoding a leader sequence when necessary.

[0048] As used herein, the term "vector" is a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector can express the protein encoded by the inserted polynucleotide, the vector is called an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection so that the genetic material elements it carries are expressed in the host cell. Vectors are well known to those skilled in the art, including but not limited to: plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or artificial chromosomes (PAC) derived from P1; bacteriophages such as lambda phage or M13 phage and animal viruses, etc. The vector may contain a variety of elements for controlling expression, including but not limited to promoter sequences, transcription start sequences, enhancer sequences, selection elements and reporter genes. In addition, the vector may also contain a replication initiation site. The vector may contain a nucleic acid of the present invention to facilitate introduction into cells for expression. The vector may contain expression control elements such as promoters, terminators and / or enhancers that are operably linked to the nucleic acid.

[0049] As used herein, the term "host cell" is a cell into which a nucleic acid molecule has been introduced by molecular biology techniques. These techniques include transfection of viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration. The host cell can be a eukaryotic cell or a prokaryotic cell. For example, a eukaryotic cell is a yeast cell, an animal cell, and / or an insect cell. A prokaryotic cell can be an E. coli cell.

[0050] As used in this article, "biological dressing" is a new type of medical dressing that can be used to repair and treat wounds. It is a special medical material made by professional manufacturers using biological materials and combined with drugs or other therapeutic substances. The collagen in the biological dressing will form a protective layer on the wound surface, promote cell proliferation and regeneration, and accelerate wound healing.

[0051] As used herein, "bionic materials" refers to materials developed by imitating various characteristics or properties of organisms. Artificial materials designed and manufactured by imitating the operating mode of life systems and the structural laws of biological materials are usually called bionic materials. "Human bionic materials" refers to materials developed by imitating various characteristics or properties of the human body. Artificial materials designed and manufactured by imitating the operating mode of life systems and the structural laws of biological materials are usually called bionic materials.

[0052] As used herein, "organoid culture material" refers to artificial materials used to culture and construct organoid functions to address the needs of organ transplantation and replacement.

[0053] As used herein, "biomaterial" refers to a material that is compatible with living tissues and is generally used to make artificial organs or replacement tissues. "3D printed artificial organ biomaterial" refers to the biomaterial used in 3D printed artificial organs.

[0054] As used herein, the degree of association between two amino acid sequences or between two nucleotide sequences is described by parameter " sequence identity ".For purposes of the present invention, use as in EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. [Genetics Trend] 16: 276-277) (preferred 5.0.0 version or updated version) Niederman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol. [J.Molecular Biology] 48: 443-453) determine the sequence identity between two amino acid sequences.The parameter used is gap opening penalty 10, gap extension penalty 0.5 and EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.The output (using non-simplified option to obtain) of Nieder marked as "longest identity" is used as identity percentage and is calculated as follows:

[0055] (number of identical residues x 100) / (length of alignment - total number of gaps in the alignment)

[0056] For the purposes of the present invention, the sequence identity between two deoxynucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) implemented by the Needle program of the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, supra) (preferably 5.0.0 version or updated version). The parameters used are gap opening penalty 10, gap extension penalty 0.5, and EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle, labeled "longest identity", (obtained using the non-simplified option) is used as identity percentage and is calculated as follows:

[0057] (number of identical deoxyribonucleotides x 100) / (alignment length - total number of gaps in the alignment)

[0058] In the context of the present invention, conservative amino acid substitutions or conservative substitutions may be defined by substitutions within the amino acid classes reflected in one or more of the following tables:

[0059] Conservative categories of amino acid residues:

[0060] Acidic residue D and E Basic residues K, R, and H Hydrophilic uncharged residues S, T, N and Q Aliphatic uncharged residue G, A, V, L, and I Nonpolar uncharged residues C, M and P Aromatic residues F, Y and W

[0061] Physical and functional classification of candidate amino acid residues:

[0062] Alcohol residue S and T Aliphatic residues I, L, V, and M Cycloalkenyl related residues F, H, W, and Y Hydrophobic residues A, C, F, G, H, I, L, M, R, T, V, W and Y Negatively charged residues D and E Polar residues C, D, E, H, K, N, Q, R, S, and T Positively charged residues H, K and R Small residues A, C, D, G, N, P, S, T and V Minimal residue A, G, and S Residues involved in turn formation A, C, D, E, G, H, K, N, Q, R, S, P and T Flexible residues Q, T, K, S, G, P, D, E, and R

[0063] As used herein, the term "triple helical" protein is understood to refer to a homotrimeric or heterotrimeric protein comprising at least one "triple helical domain". The term encompasses variants and fragments of triple helical proteins and functional equivalents and derivatives thereof, preferably retaining the (Gly-XY)n sequence. The term "triple helical structure" refers to a protein comprising the general formula (Gly-XY)n, wherein Gly is glycine, X and Y represent identical or different amino acids (which may vary within the range of different Gly-XY triplets), wherein n may be between 2 and 300. A triple helical domain consists of three chains, which are characterized by a repeating (Gly-XY)n motif that folds into a triple helical protein conformation.

[0064] Recombinant humanized collagen type VI

[0065] In this article, the recombinant humanized type VI collagen of the present invention may have certain mutations. For example, the amino acid sequence of one or more of these parts may have substitutions, deletions, additions or insertions of amino acid residues. That is to say, variants can be used in the present invention as long as the variants retain the activity of promoting cell adhesion and / or proliferation. Specifically, the variants may have a certain percentage identity with the specified sequence, such as at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity, or any numerical range therebetween. The specified sequence may be any sequence of the present invention, such as any one of SEQ ID NO:1 or 2 or 4-7, but it is preferred that these variants retain the function of the recombinant humanized type VI collagen of the present invention. The recombinant humanized type VI collagen of the present invention may have good cell adhesion efficacy and have a triple helix structure.

[0066] The recombinant humanized type VI collagen of the present invention can be prepared by any suitable method, for example, it can be prepared by synthesis. Preferably, the recombinant humanized type VI collagen of the present invention can be prepared by recombinant means.

[0067] The collagen of the present invention may have a triple helical structure region, that is, collagen in the form of a triple helical structure, that is, it has three identical collagen chains. For example, collagen has a flexible triple helical structure region. The collagen of the present invention can form a triple helical structure. After measurement, the recombinant humanized type VI collagen C6A1 of the present invention can form a triple helical structure. The triple helical structure of collagen is formed by three polypeptide chains entangled with each other. Each polypeptide chain is formed by many amino acids connected together, among which amino acids such as glycine, proline and hydroxyproline are particularly important in the structure of collagen. Each of these amino acids can form a hydrogen bond, which can link the three polypeptide chains to form a three-helical structure. In this process, each polypeptide chain is intertwined with the other two polypeptide chains in the same way. Studies have shown that the triple helical structure of collagen plays a vital role in its thermal stability. The three-dimensional structure formed when the polypeptide chains are entangled with each other through hydrogen bonds is very stable. A large number of experimental results show that it takes a very high temperature or pH to destroy the triple helical structure of collagen. In vivo, the thermal stability of collagen can bring many benefits. For example, due to its high thermal stability, collagen can remain stable and perform its functions in the human body for a long time. This stability also provides collagen with endurance, allowing it to withstand the stress generated by daily physical movement and body metabolism without breaking or decomposing.

[0068] As used herein, recombinant humanized collagen is a full-length or partial amino acid sequence fragment encoded by a sex-specific gene of human collagen prepared by DNA recombination technology, or a combination of functional fragments of human collagen. In this article, recombinant humanized collagen is a collagen type such as recombinant humanized VI, which is a peptide or polypeptide of multiple amino acid residues connected by peptide bonds. Recombinant humanized collagen can be a recombinant humanized collagen formed by tandem repetition of multiple repeating units. The method for preparing recombinant humanized collagen by a tandem repetition strategy is known to those skilled in the art. The selection of the number of repeating units is conventional for those skilled in the art. For example, recombinant humanized collagen can have 2-50 repeating units, such as 2-10. It should be understood that recombinant humanized collagen formed by repeating units within this range has similar functions. Prior art literature reports that recombinant collagen can be constructed by tandem repetition of repeating units. The number of repeating units may vary. For example, Chen Hua et al. Biochemical and Biophysical Research Communications 508 (2019) 1018e1023 disclosed that the T16 with 16 tandem repeats of the GERGAPGFRGPAGPNGIPGEKGPAGERGAP repeating unit and the repeating unit has cell adhesion activity, and it is believed that recombinant proteins containing multiple tandemly repeated triple helical fragments can have a more stable helical conformation or a more favorable ligand binding configuration to promote cell membrane attachment and adhesion. R. Strawn et al., Biopolymers 109 (2018), e23226 demonstrated that recombinant collagen-like proteins with multiple identical triple helical peptide units arranged in a tandem repeat manner can self-assemble into microfibers for use in biopharmaceuticals and industrial fields. J. Yao et al., J. Biochem. 136 (2004) 643e649 reported that recombinant collagen-like proteins containing tandem repeats of type I collagen peptides showed high cell adhesion activity.

[0069] Composition

[0070] The recombinant humanized type VI collagen of the present invention can be prepared as a composition. The composition may include the recombinant humanized type VI collagen described herein, nucleic acid, vector and / or host cell. The composition may also include a pharmaceutically and / or cosmetically acceptable carrier or solvent. The composition may be a pharmaceutical composition or a cosmetic composition for the purpose of medicine and / or cosmetics. For example, the composition is one or more of a biological dressing, a human bionic material, a plastic surgery material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue injection filling material, an ophthalmic material, a gynecological biomaterial, a nerve repair and regeneration material, a liver tissue material and a vascular repair and regeneration material, a 3D printed artificial organ biomaterial, a cosmetic raw material, a pharmaceutical excipient and a food additive.

[0071] The part to which the cosmetic composition is applied is not particularly limited, and may be the face, hands, legs, torso, etc. The form of the composition is not particularly limited, as long as the intended function can be achieved. For example, the composition is a solid, liquid or gel composition.

[0072] The composition can be used in any suitable manner, for example, for oral and / or topical compositions. The composition can also be prepared as a test kit. The test kit can include additional ingredients, for example auxiliary ingredients, such as buffers, and include instructions for use. In particular, the composition can be formulated into a suitable formulation, such as a liquid formulation. The formulation can include a buffer, such as a D-PBS buffer or a PBS buffer.

[0073] Methods and uses

[0074] Provided herein is a method for causing cell adhesion or adherence, the method comprising contacting cells with recombinant humanized type VI collagen, compositions and / or liquid formulations described herein. The method of the present invention can be performed in vitro to increase cell adhesion to a culture vessel. Alternatively, the method of the present invention can also be performed in vivo. The present invention also provides the use of the recombinant humanized type VI collagen, compositions and / or liquid formulations described herein in the preparation of a drug and / or a kit, which is used to increase cell adhesion. In addition to the collagen described herein, the kit may also include a suitable carrier, diluent or excipient, etc., as well as instructions for using the collagen.

[0075] Example

[0076] The following examples are provided to illustrate the present invention. Those skilled in the art should understand that the examples are merely illustrative and not limiting. The present invention is limited only by the scope of the appended claims.

[0077] Example 1: Construction, expression and screening of humanized type VI collagen fragments

[0078] 1. Perform large-scale functional region screening to obtain the following target gene functional regions of humanized type VI collagen.

[0079] C6A1 amino acid sequence: ENLYFQ

[0080] Gppgekgeagdegnpgpdgapgerggpger

[0081] Gppgekgeagdegnpgpdgapgerggpger

[0082] Gppgekgeagdegnpgpdgapgerggpger

[0083] Gppgekgeagdegnpgpdgapgerggpger

[0084] (SEQ ID NO: 2; repeating unit: Gppgekgeagdegnpgpdgapgerggpger, SEQ ID NO: 1).

[0085] The inventors designed the C6A1 nucleotide sequence based on the C6A1 amino acid sequence.

[0086] C6A1 Nucleotide Sequence:

[0087] GGATCCGAAAATCTGTATTTTCAGGTCCGCCGGGTGAAAAAGGTGAAGCAGGTGATGAAGGTAATCCGGGTCCGGATGGTGCACCGGGTGAACGTGGTGGTCCTGGTGAACGTGGTCCGCCTGGTGAAAAAGGTGAAGCAGGTGATGAAGGTAATCCGGGTCCGGATGGTGCACCGGGTGAACGTGGTGGTCCTGGT GAACGTGGTCCGCCTGGTGAAAAAGGTGAAGCAGGTGATGAAGGTAATCCGGGTCCGGATGGTGCACCGGGTGAACGTGGTGGTCCTGGTGAACGTGGTCCGCCTGGTGAAAAAGGTGAAGCAGGTGATGAAGGTAATCCGGGTCCGGATGGTGCACCGGGTGAACGTGGTGGTCCTGGTGAACGTTAAAAGCTT(SEQ ID NO:3).

[0088] 2. Construction of genetically engineered Escherichia coli

[0089] The C6A1 nucleotide sequence is cloned into an expression vector, and then the expression vector is transferred into an Escherichia coli expression strain, and the Escherichia coli genetic engineering bacteria are screened to obtain.

[0090] Specifically, according to the amino acid sequence of C6A1 (SEQ ID NO: 2), the codon gene SEQ ID NO: 3 preferred by Escherichia coli was optimized and selected. The nucleotide sequence of SEQ ID NO: 3 was synthesized. The C6A1 gene fragment was inserted into the pET-32a expression vector (Beijing Liuhe BGI Gene Technology Co., Ltd.) through the restriction sites of Kpn I (NEB Company, Catalog No.: R0136L) and Xho I (NEB Company, Catalog No.: R0146L) to construct the pET-32a-C6A1 expression vector. The expression vector was introduced into Escherichia coli BL21 (DE3), and positive Escherichia coli genetically engineered bacteria were screened. The above operations were entrusted to Beijing Liuhe BGI Gene Technology Co., Ltd.

[0091] 3. Fermentation of genetically engineered Escherichia coli

[0092] The successfully constructed expression plasmid was transformed into E. coli competent cells BL21 (DE3). The specific process is:

[0093] (1) Take out the E. coli competent cells BL21(DE3) from the ultra-low temperature refrigerator and place them on ice. Take 2 μl of the plasmid to be transformed and add it to the competent cells BL21(DE3). Mix gently 2-3 times.

[0094] (2) Place the mixture on ice for 30 min, then heat shock in a 42°C water bath for 45-90 s, remove from the heat and place on ice for 2 min.

[0095] (3) Transfer to a biosafety cabinet and add 700 μl of liquid LB medium, then culture at 37°C and 220 rpm for 60 min.

[0096] (4) Take 200 μl of bacterial solution and spread it evenly on LB plate containing ampicillin sodium.

[0097] (5) Incubate the plate in a 37°C incubator for 15-17 hours until colonies of uniform size grow.

[0098] (6) Pick 5-6 single colonies from the transformed LB plate and place them in a shake flask containing LB medium containing antibiotic stock solution, and incubate in a constant temperature shaker at 220 rpm and 37°C for 7 hours. Then cool the shake flask to 16°C, add IPTG to induce expression for a period of time, divide the bacterial solution into centrifuge bottles, centrifuge at 8000 rpm and 4°C for 10 minutes, collect the bacteria, record the bacterial weight, and take samples for electrophoresis detection.

[0099] (7) Resuspend the collected bacteria with a balanced working solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole, pH 8.0), cool the bacterial solution to ≤15°C, homogenize, and homogenize twice under high pressure. Collect the bacterial solution after completion. Divide the homogenized bacterial solution into centrifuge bottles, centrifuge at 17,000 rpm and 4°C for 30 min, collect the supernatant, and take the supernatant and precipitate for electrophoresis detection.

[0100] (8). Purify and digest C6A1. The specific process is as follows: (1) Crude purification: a. Wash the column (Ni6FF, Cytiva) with water for 5 CV. b. Equilibrate the column with equilibration solution (200mM sodium chloride, 25mM Tris, 20mM imidazole, pH8.0) for 5 CV. c. Load the sample: Add the supernatant after centrifugation to the column until the liquid flows out, and take the flow-through for electrophoresis. d. Wash the impurities: Add 25mL of washing solution (200mM sodium chloride, 25mM Tris, 20mM imidazole) until the liquid flows out, and take the washing flow-through for electrophoresis. e. Collect the target protein: Add 20mL of elution solution (200mM sodium chloride, 25mM Tris, 250mM imidazole, pH8.0), collect the flow-through, detect the protein concentration, calculate the protein amount, and perform electrophoresis. f. Wash the column with 1M imidazole working solution. g. Wash the column with purified water. (2) Enzyme digestion: Add TEV enzyme at a ratio of 50:1 between total protein and total TEV enzyme, digest at 16℃ for 4h, and take samples for electrophoresis detection. Put the protein solution after enzyme digestion into a dialysis bag, dialyze at 4℃ for 2h, and then transfer to new dialysis solution for overnight dialysis at 4℃. (3) Purification: a. Equilibrate the column (Ni6FF, Cytiva): Use solution A (20mM Tris, 20mM sodium chloride, pH8.0) to equilibrate the column at a flow rate of 10ml / min. b. Loading: Load and collect the flow-through at a flow rate of 5ml / min, and perform electrophoresis detection. c. Gradient elution: Set 0-15% B solution (20mM Tris, 1M sodium chloride, pH8.0) for 2min and then keep for 3CVs, 15-30% B solution for 2min and then keep for 3CVs, 30-50% B solution for 2min and then keep for 3CVs, 50-100% B solution for 2min and then keep for 3CVs, collect the peaks and perform electrophoresis detection (for pure protein). d. Wash the column. Store the protein at 4°C.

[0101] Concentration detection: Accurately measure an appropriate amount of sample, dilute it 10-50 times with eluent, and stir it thoroughly with a glass rod. Use a UV-visible spectrophotometer to measure the absorbance at 280nm, and calculate the protein concentration according to the formula C (mg / ml) = A280 x absorbance coefficient x dilution factor (Note: the absorbance value must be between 0.1-1).

[0102] The specific process of electrophoresis detection is as follows: take 40 μl of sample solution, add 10 μl 5x protein loading buffer (250 mM Tris-HCl (pH: 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol), place in 100°C boiling water for 10 minutes, then add 10 μl per well to SDS-PAGE protein gel, run at 80V for 2 hours, use Coomassie brilliant blue staining solution (0.1% Coomassie brilliant blue R-250, 25% isopropanol, 10% glacial acetic acid) for protein staining for 20 minutes, and then use protein decolorization solution (10% acetic acid, 5% ethanol) for decolorization. The experimental results are shown in Figure 1 .according to Figure 1 It can be seen that a protein with a molecular weight of 29.6 kDa was separated, which is consistent with the predicted molecular weight (29647.20) of humanized type VI collagen C6A1, indicating that C6A1 was correctly expressed.

[0103] By the same method as above, the following recombinant collagen was constructed:

[0104] C6A2:Gppgekgeagdegnpgpdgapgerggpger(SEQ ID NO:4)

[0105] C6A3: Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger (SEQ ID NO: 5)

[0106] C6A4: Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger

[0107] Gppgekgeagdegnpgpdgapgerggpger(SEQ ID NO:6)

[0108] C6A5: Gppgekgeagdegnpgpdgapgerggpger GppgekgeagdegnpgpdgapgerggpgerGppgekgeagdegnpgpdgapgerggpger GppgekgeagdegnpgpdgapgerggpgerGppgekgeagdegnpgpdgapgerggpgerGppgekgeagdegnpgpdgapgerggpgerGppgekgeagdegnpgpdgapgerggpgerGppgekgeagdegnpgpdgapgerggpgerGppgekgeagdegnpgpdgapgerggpger (SEQ ID NO: 7). C6A2-C6A5 were separated and detected by electrophoresis by the above method, which proved that the actual molecular weight of C6A2-C6A5 was consistent with the expected molecular weight, and these recombinant collagens were correctly expressed.

[0109] Example 2: Detection of biological activity of recombinant humanized collagen

[0110] The adhesion activity detection method of recombinant humanized collagen can refer to the literature Juming Yao, Satoshi Yanagisawa, Tetsuo Asakura, Design, Expression and Characterization of Collagen-Like Proteins Based on the Cell Adhesive and Crosslinking Sequences Derived from Native Collagens, J Biochem. 136, 643-649 (2004). The specific implementation method is as follows:

[0111] (1) The concentration of the protein sample to be tested is detected by ultraviolet absorption method, including bovine type I collagen (China Food and Drug Inspection Institute, No.: 380002) and the recombinant humanized collagen C6A1 provided by the present invention. Specifically, the ultraviolet absorption of the sample at 215nm and 225nm is measured respectively, and the protein concentration is calculated using the empirical formula C (μg / mL) = 144×(A215-A225). Note that the detection must be performed when A215<1.5. The principle of this method is: to measure the characteristic absorption of peptide bonds under far-ultraviolet light, which is not affected by the chromophore content, has few interfering substances, is easy to operate, and is suitable for detecting human collagen and its analogs that are not colorable with Coomassie Brilliant Blue. (The reference is Walker JM. The Protein Protocols Handbook, second edition. Humana Press. 43-45). After the protein concentration is detected, the concentration of all proteins to be tested is adjusted to 0.5 mg / mL with PBS.

[0112] (2) Add 100 μL of various protein solutions (bovine type I collagen or recombinant humanized collagen C17T15) or D-PBS solution (blank control group) to a 96-well plate.

[0113] (3) Add 10 5 3T3 cells in good culture state were incubated at 37℃ for 60min.

[0114] (4) Wash each well four times with PBS.

[0115] (5) Use LDH detection kit (Roche, 04744926001) to detect the absorbance at OD492nm. According to the value of blank control, the cell adhesion rate can be calculated. The calculation formula is as follows:

[0116]

[0117] Where:

[0118] P: relative cell adhesion ratio;

[0119] OD1: average absorbance value of each replicate well of the test collagen sample at OD492nm;

[0120] OD2: average absorbance of each duplicate well of the control collagen sample at OD492nm;

[0121] OD0: The average absorbance of each replicate well in the blank control group at OD492nm.

[0122] The cell adhesion rate can reflect the adhesion activity of each protein. The higher the activity of the protein, the better the external environment it can provide to the cells in a short time, helping the cells to adhere to the wall.

[0123] Figure 2 The experimental results show that compared with bovine type I collagen (PC group, 0.5 mg / ml), the recombinant collagen C6A1 of the present invention has better bioadhesion activity. Similarly, it can be expected that C6A2-C6A5 also have bioadhesion activity.

[0124] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Collagen, comprising a plurality of repeating units, wherein the repeating units comprise the amino acid sequence shown in SEQ ID NO: 1, or an amino acid sequence in which one or more amino acid residues are mutated in the amino acid sequence shown in SEQ ID NO: 1, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1; the number of repeating units is 10-20, 12-18 or 13-16; and the repeating units are directly connected or connected by a linker of one or more amino acids; Preferably, the mutation is a substitution, insertion, deletion or addition; preferably, the substitution is a conservative amino acid substitution; Preferably, the collagen is derived from humans; Preferably, the collagen has a triple helix structure or is collagen in the form of a triple helix structure; Preferably, the collagen has cell adhesion function Preferably, the collagen is recombinant collagen, recombinant humanized collagen or recombinant humanized type VI collagen.

2. The collagen according to claim 1, comprising the following amino acid sequence: (1) the amino acid sequence shown in any one of SEQ ID NOs: 2 and 4-7; (2) an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 2 and 4-7; or (3) An amino acid sequence in which one or more amino acid residues are mutated in the amino acid sequence shown in any one of SEQ ID NOs: 2 and 4-7; preferably, the mutation is a substitution, insertion, deletion or addition; preferably, the substitution is a conservative amino acid substitution.

3. A nucleic acid encoding the collagen according to claim 1 or 2; preferably, the nucleic acid has a nucleotide sequence shown in SEQ ID NO:

3.

4. A vector comprising the nucleic acid according to claim 3, optionally comprising nucleotides encoding a purification tag, nucleotides encoding a leader and / or a regulatory element; Preferably, the purification tag is selected from a His tag, a GST tag, an MBP tag, a SUMO tag or a NusA tag; Preferably, the regulatory element is selected from a promoter, a terminator and / or an enhancer.

5. A host cell comprising a nucleic acid according to claim 3 or a vector according to claim 4; wherein preferably, the host cell is a eukaryotic cell or a prokaryotic cell; wherein preferably, the eukaryotic cell is a yeast cell, an animal cell and / or an insect cell, and / or the prokaryotic cell is an Escherichia coli cell, such as Escherichia coli BL21.

6. A method for producing collagen, comprising: (1) culturing the host cell according to claim 5 under suitable culture conditions; (2) harvesting host cells and / or culture medium containing collagen; and (3) Purifying collagen, for example, including (1) purifying collagen on a Ni affinity chromatography column; (2) adding collagen tools for enzymatic cleavage; and / or (3) purifying collagen on an ion exchange column.

7. A composition comprising the collagen according to claim 1 or 2, the nucleic acid according to claim 3, the vector according to claim 4 and / or the host cell according to claim 5; Preferably, the composition is a pharmaceutical composition, a food composition or a cosmetic composition, Preferably, the composition is one or more of biological dressings, human bionic materials, plastic surgery materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetrics and gynecology biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printing artificial organ biomaterials, cosmetic raw materials, pharmaceutical excipients and food additives; Preferably, the composition comprises a pharmaceutically and / or cosmetically acceptable carrier; Preferably, the composition is a solid, liquid or gel composition; Preferably, the composition is an oral and / or topical composition, preferably an applicatable composition; Preferably, the composition is a kit; Preferably, the composition is a liquid formulation, which comprises the collagen according to claim 1 or 2 and a pharmaceutically and / or cosmetically acceptable carrier; preferably, the carrier is a buffer, such as D-PBS buffer or PBS buffer.

8. A method for promoting cell adhesion or cell attachment, the method comprising contacting cells with the collagen according to claim 1 or 2 and / or the composition according to claim 7.

9. Use of the collagen according to claim 1 or 2, the nucleic acid according to claim 3, the vector according to claim 4, the host cell according to claim 5 and / or the composition according to claim 7 in biological dressings, human bionic materials, coating materials, organoid culture materials or 3D printed artificial organ biomaterials, or in plastic surgery materials, organoid culture materials, cardiovascular stent materials, tissue injection filling materials, ophthalmic materials, obstetrics and gynecology biomaterials, nerve repair and regeneration materials, liver tissue materials or vascular repair and regeneration materials.

10. Use of the collagen according to claim 1 or 2 and / or the composition according to claim 7 in the preparation of a drug or kit for promoting cell adhesion or cell wall adhesion.

Images