Escherichia coli genetically engineered bacterium for recombinant expression of inositol-3-phosphate synthase and application of escherichia coli genetically engineered bacterium

Abstract

The invention discloses an escherichia coli genetically engineered bacterium for recombinant expression of inositol-3-phosphate synthase and application of the escherichia coli genetically engineered bacterium. According to the invention, an inositol-3-phosphate synthase gene INO1 from saccharomyces cerevisiae is connected to a multiple cloning site MCS-1 of a plasmid pETDuet-1, and meanwhile, a multiple cloning site MCS-2 is knocked out through enzyme digestion, so that engineering escherichia coli containing the pETDuet-1-INO1 is subjected to culture medium screening. Glucose-6-phosphoric acid is used as a substrate through enzymatic reaction, inositol-3-phosphate synthase is used for catalysis, the product is inositol-3-phosphoric acid, and inositol can be obtained from the inositol-3-phosphoric acid through a chemical method or a biological catalysis method. According to the method disclosed by the invention, the recombinant escherichia coli is subjected to high-density culture, the process stability is high, the activity of the inositol-3-phosphate synthase is remarkably improved, and the inositol-3-phosphate synthase purified by the nickel column is subjected to catalytic conversion into the product inositol-3-phosphate by taking glucose-6-phosphoric acid with the concentration of 3mM and glucose-6-phosphoric acid with the concentration of 5mM as substrates respectively; and the conversion rates of the substrates can respectively reach 95.69 + / -1.48% and 94.38 + / -0.42%.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, relates to protein bioengineering and fermentation engineering technology, and specifically relates to a genetically engineered Escherichia coli bacterium that recombinantly expresses inositol-3-phosphate synthase and an application thereof. Background Art

[0002] Inositol, also known as cyclohexanehexol, fiber alcohol, inositol, etc., is mainly found in animals and plants. It is a growth factor for animals and microorganisms, and is also a water-soluble vitamin B family. Inositol is widely used, mainly in feed, food, medicine, cosmetics and other industries. In order to deal with the adverse effects of traditional inositol production methods, one of the current research directions is to produce inositol by microbial fermentation, which involves the study of the rate-limiting enzyme inositol-3-phosphate synthase.

[0003] Inositol-3-phosphate synthase is widely present in eukaryotic cells and various plant and animal microorganisms. Inositol-3-phosphate is the direct precursor of free inositol and is synthesized by the internal cyclization of glucose-6-phosphate catalyzed by inositol-3-phosphate synthase (encoding EC 5.5.1.4). Inositol-3-phosphate has a wide range of values ​​and is used in various fields. Therefore, the high-yield and high-purity production process of inositol-3-phosphate has attracted attention at home and abroad. At present, the main common methods for producing inositol are chemical hydrolysis, enzymatic hydrolysis, chemical synthesis, and microbial methods with broad application prospects.

[0004] The production of inositol-3-phosphate by microbial fermentation is mainly through using sugar as substrate, using Saccharomyces cerevisiae or Escherichia coli as production strains to secrete inositol-3-phosphate into the fermentation liquid under appropriate culture conditions, and then purifying and concentrating the fermentation liquid to obtain inositol-3-phosphate. Recently, some scholars have also transformed microorganisms such as Saccharomyces cerevisiae and Escherichia coli through genetic engineering. This method is highly safe, easy to operate, and economical. It is currently the most promising method with no pollution to the environment. Summary of the invention

[0005] The object of the present invention is to provide a genetically engineered Escherichia coli bacteria that recombinantly expresses inositol-3-phosphate synthase and its application. The present invention can realize high-density culture of Escherichia coli cells that recombinantly express inositol-3-phosphate synthase, and the process stability is high, so that inositol-3-phosphate synthase with high enzyme activity can be obtained. Specifically, the present invention adopts the following technical scheme:

[0006] On the one hand, the present invention provides a genetically engineered Escherichia coli bacterium that recombinantly expresses inositol 3-phosphate synthase, which is obtained by using pETDuet-1 as a vector, connecting the inositol 3-phosphate synthase gene INO1 to the vector multiple cloning site MCS-1, and knocking out the multiple cloning site MCS-2 through homologous recombination to obtain the recombinant plasmid pETDuet-1-INO1, which is then transformed into Escherichia coli BL21 (DE3).

[0007] Preferably, the engineered Escherichia coli can stably transform the recombinant plasmid pETDuet-1-INO1 to induce the expression of inositol-3-phosphate synthase, wherein the inositol-3-phosphate synthase gene is derived from Saccharomyces cerevisiae, and the nucleotide sequence SEQ ID NO.1 is as follows:

[0008] ATGACAGAAGATAATATTGCTCCAATCACCTCCGTTAAAGTAGTTACCGACAAGTGCACGTACAAGGACA

[0009] ACGAGCTGCTCACCAAGTACAGCTACGAAAATGCTGTAGTTACGAAGACAGCTAGTGGCCGCTTCGATGT

[0010] AACGCCCACTGTTCAAGACTACGTGTTCAAACTTGACTTGAAAAAGCCGGAAAAACTAGGAATTATGCTC

[0011] ATTGGGTAGGTGGCAACAATGGGCTCCACTTTAGTGGCCTCGGTATTGGCGAATAAGCACAATGTGGAGT

[0012] TTCAAACTAAGGAAGGCGTTAAGCAACCAAACTACTTCGGCTCCATGACTCAATGTTCTACCTTGAAACT

[0013] GGGTATCGATGCGGAGGGGAATGACGTTTATGCTCCTTTTAACTCTCTGTTGCCCATGGTTAGCCCAAAC

[0014] GACTTTGTCGTCTCTGGTTGGGACATCAATAACGCAGATCTATACGAAGCTATGCAGAGAAGTCAAGTTC

[0015] TCGAATATGATCTGCAACAACGCTTGAAGGCGAAGATGTCCTTGGTGAAGCCTCTTCCTTCCATTTACTA

[0016] CCCTGATTTCATTGCAGCTAATCAAGATGAGAGAGCCAATAACTGCATCAATTTGGATGAAAAAGGCAAC

[0017] GTAACCACGAGGGGTAAGTGGACCCATCTGCAACGCATCAGACGCGATATCCAGAATTTCAAAGAAGAAA

[0018] ACGCCCTTGATAAAGTAATCGTTCTTTGGACTGCAAATACTGAGAGGTACGTAGAAGTATCTCCTGGTGT

[0019] TAATGACACCATGGAAAACCTCTTGCAGTCTATTAAGAATGACCATGAAGAGATTGCTCCTTCCACGATC

[0020] TTTGCAGCAGCATCTATCTTGGAAGGTGTCCCCTATATTAATGGTTCACCGCAGAATACTTTTGTTCCCG

[0021] GCTTGGTTCAGCTGGCTGAGCATGAGGGTACATTCATTGCGGGAGACGATCTCAAGTCGGGACAAACCAA

[0022] GTTGAAGTCTGTTCTGGCCCAGTTCTTAGTGGATGCAGGTATTAAACCGGTCTCCATTGCATCCTATAAC

[0023] CATTTAGGCAATAATGACGGTTATAACTTATCTGCTCCAAAACAATTTAGGTCTAAGGAGATTTCCAAAA

[0024] GTTCTGTCATAGATGACATCATCGCGTCTAATGATATCTTGTACAATGATAAACTGGGTAAAAAAGTTGA

[0025] CCACTGCATTGTCATCAAATATATGAAGCCCGTCGGGGACTCAAAAGTGGCAATGGACGAGTATTACAGT

[0026] GAGTTGATGTTAGGTGGCCATAACCGGATTTCCATTCACAATGTTTGCGAAGATTCTTTACTGGCTACGC

[0027] CCTTGATCATCGATCTTTTAGTCATGACTGAGTTTTGTACAAGAGTGTCCTATAAGAAGGTGGACCCAGT

[0028] TAAAGAAGATGCTGGCAAATTCGAGAACTTTTATCCAGTTTTAACCTTCTTGAGTTACTGGTTAAAAGCT

[0029] CCATTAACAAGACCAGGATTTCACCCGGTGAATGGCTTAAACAAGCAAAGAACCGCCTTAGAAAATTTTT

[0030] TAAGATTGTTGATTGGATTGCCTTCTCAAAACGAACTAAGATTCGAAGAGAGATTGTTGTAA

[0031] Preferably, the inositol-3-phosphate synthase gene is connected to the vector multiple cloning site MCS-1, using pETDuet-1 as the vector, linearizing the vector pETDuet-1 by double restriction digestion at the cloning sites EcoRI and PacI, and homologously recombining the Ino1 fragment with homology arms amplified by PCR with the linearized vector, and the resulting recombinant plasmid is named pETDuet-1- INO1. After the homologous recombination reaction between the linearized vector pETDuet-1 and the target gene INO1 fragment with homology arms, the multiple cloning site MCS-2 is knocked out.

[0032] Preferably, the recombinantly expressed inositol-3-phosphate synthase Escherichia coli genetically engineered bacteria is obtained by transforming the recombinant plasmid pETDuet-1-INO1 into Escherichia coli BL21 (DE3), and transforming it into competent cells BL21 (DE3) by heat shock method, and the transformed products are evenly spread on LB plate culture medium containing ampicillin resistance, and the plate is inverted in an incubator at 37°C and cultured overnight, and suitable single colonies on the LB plate are selected for colony PCR verification, and the single colonies after colony PCR verification are cultured overnight, and the bacteria are collected by centrifugation, and the plasmid is extracted, and the sequencing and enzyme digestion verification are obtained to obtain Escherichia coli engineered bacteria E.lico BL21 (DE3) / pETDuet-1-INO1 stably transformed with the recombinant plasmid pETDuet-1-INO1.

[0033] On the other hand, the genetically engineered Escherichia coli bacteria expressing recombinant inositol-3-phosphate synthase of the present invention can be used in inducing the expression of inositol-3-phosphate synthase.

[0034] The above-mentioned application may adopt a method comprising the following steps:

[0035] (1) Inoculate the engineered E. coli strain E. lico BL21 (DE3) / pETDuet-1- INO1 in LB medium containing 100 μg / ml ampicillin and culture at 37°C, 200 rpm for 12-16 hours for activation;

[0036] (2) The activated E. coli suspension in step (1) was inoculated into a modified GT medium containing 100 μg / ml ampicillin and 50-100 mM 3-morpholinepropanesulfonic acid at a ratio of 1:50, cultured at 37°C and 220 rpm, and the OD of the E. coli suspension was measured. 600 When the bacterial solution OD 600 When the expression reaches about 1.0, add 0.2 mM IPTG (isopropyl-β-D-thiogalactoside) to induce expression, the induction temperature is 30°C, and the samples are collected after 4 hours of induction;

[0037] (3) The E. coli fermentation broth obtained in step (2) was centrifuged at 4°C and 13,000 rpm for 15 min, and the fermentation broth supernatant was discarded. The cell pellet was resuspended in 10 mM Tris-HCl (pH 8.0) lysis buffer containing 1 mg / ml lysozyme, and incubated on ice for 30 min to prepare a crude lysate; the cell solution was lysed by freezing in liquid nitrogen and thawing in 30-40°C water for five cycles; super nuclease was added at a final concentration of 2.5 U / ml, and incubated on ice for 30 min. The resulting solution was centrifuged at 4°C and 14,000 rpm for 15 min to remove insoluble matter, thereby obtaining a crude inositol 3-phosphate synthase enzyme solution, which was separated and purified using a Ni Tanrose 6FF (NTA) affinity chromatography column.

[0038] Generally, the composition of GT culture medium commonly used in laboratories is: 10 g / L Glc, 5 g / L glycerol, 8 g / L tryptone, 5 g / L ammonium sulfate, 0.2 g / L magnesium sulfate heptahydrate, 3 mM ferrous sulfate heptahydrate, 1 g / L potassium dihydrogen phosphate, 2 g / L sodium chloride, and 0.015 g / L calcium chloride.

[0039] Preferably, the concentrations of the components of the modified GT medium are: 3 g / l Glc, 7 g / l glycerol, 6 g / l tryptone, 5 g / l ammonium sulfate, 1.5 g / l magnesium sulfate heptahydrate, 0.5 mM ferrous sulfate heptahydrate, 1 g / l potassium dihydrogen phosphate, 2 g / l sodium chloride, 0.015 g / l anhydrous calcium chloride, and 50-100 mM 3-morpholinepropanesulfonic acid.

[0040] For the above-mentioned application, it is preferred that the separation and purification method is: equilibrate the chromatographic column with an equilibrium buffer, dilute the crude enzyme solution 10-15 times with an equilibrium buffer, filter it through a 0.22μm microporous filter membrane, load it, use an elution buffer stage elution collection, concentrate, and then replace it twice with 10ml of equilibrium buffer to obtain a pure enzyme solution; the equilibrium buffer contains 50mM Tris, 0.25-0.5M NaCl, 20mM imidazole, pH=8.0; the elution buffer is 50mM Tris, 0.25-0.5M NaCl, 0.5M imidazole, pH=8.0, and the stage elution is first eluted with 10% elution buffer to remove impurities, then eluted with 60% elution buffer, and then regenerated with 100% elution buffer nickel column. The protein concentration of the pure enzyme solution is determined by the Bradford method, and it is divided into multiple low adsorption tubes according to the protein concentration, and then placed in a -80℃ refrigerator, and taken out as needed to avoid repeated freezing and thawing of the pure enzyme solution.

[0041] The present invention discloses a fermentation process optimization and application of recombinantly expressed inositol-3-phosphate synthase, wherein the enzymatic reaction is to use glucose-6-phosphate as a substrate, catalyzed by inositol-3-phosphate synthase, and the product is inositol-3-phosphate, and inositol-3-phosphate can be obtained by chemical method or biocatalysis. After further process optimization of the expression conditions of the enzyme, a better culture process is determined. After obtaining the pure enzyme through fermentation culture, lysis of Escherichia coli and nickel column purification according to the above conditions, the enzymatic property study and conversion rate application are carried out. The present invention has the characteristics of high-density bacterial culture, high process stability, significantly improved specific activity of the enzyme under the optimum temperature and pH conditions, and high substrate conversion rate through optimization of culture medium and culture process.

[0042] The invention enables high-density culture of recombinant Escherichia coli, has high process stability, and significantly improves the activity of inositol-3-phosphate synthase. When glucose-6-phosphate with a concentration of 3 mM and 5 mM is used as a substrate, the inositol-3-phosphate synthase purified by the nickel column of the invention is used to catalyze the conversion into the product inositol-3-phosphate, and the substrate conversion rates can reach 95.69±1.48% and 94.38±0.42%, respectively. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 is the recombinant plasmid map constructed in Example 1 of the present invention;

[0044] Figure 2 The growth curves of the recombinant Escherichia coli engineering bacteria in Example 2 of the present invention in LB, TB and GT medium;

[0045] Figure 3 The results of 10% SDS-PAGE gel analysis of the pure enzyme solution after purification, concentration and substitution in Example 3 of the present invention;

[0046] Figure 4 The single factor experimental results of optimizing the concentration of GT medium components in Example 4 of the present invention are as follows;

[0047] Figure 5 It is the conversion rate of glucose-6-phosphate to inositol-3-phosphate catalyzed by inositol-3-phosphate synthase in Example 5 of the present invention. DETAILED DESCRIPTION

[0048] The following embodiments are further descriptions of the content of the present invention as an explanation of the technical content of the present invention, but the essential content of the present invention is not limited to the following embodiments. Ordinary technicians in this field can and should know that any simple changes or replacements based on the essential spirit of the present invention should fall within the scope of protection required by the present invention.

[0049] Example 1

[0050] The construction method of the E. coli engineering bacteria E.lico BL21 (DE3) / pETDuet-1 for recombinant expression of inositol-3-phosphate synthase is as follows:

[0051] The CDS sequence of the inositol-3-phosphate synthase gene (Saccharomyces cerevisiae S288C) from Saccharomyces cerevisiae (GenBank: NM_001181586.1) was searched in the NCBI database. The sequence is shown in SEQ ID NO.1 and was commissioned to Nanjing GenScript Biotechnology Co., Ltd. for synthesis. Figure 1 As shown, pETDuet-1 was used as a vector, and the vector pETDuet-1 was linearized by double restriction digestion at the cloning sites EcoRI and PacI, and the Ino1 fragment with homology arms amplified by PCR and the linearized vector were homologously recombined. The resulting recombinant plasmid was named pETDuet-1- Ino1. It was transformed into competent cells TOP10 by heat shock method for plasmid cloning, and was screened for ampicillin resistance, colony PCR, plasmid extraction and plasmid sequencing verification. The cloned recombinant plasmid pETDuet-1- Ino1 was transformed into competent cells BL21 (DE3) by heat shock method, and was screened for ampicillin resistance, colony PCR, plasmid extraction and plasmid sequencing verification again, and the recombinant Escherichia coli engineering bacteria E.lico BL21 (DE3) / pETDuet-1 expressing inositol-3-phosphate synthase was obtained.

[0052] Example 2

[0053] Detection of the growth curve of the recombinant Escherichia coli engineered bacteria E.lico BL21 (DE3) / pETDuet-1-INO1 expressing inositol 3-phosphate synthase.

[0054] The recombinant E. coli engineering bacteria E.lico BL21 (DE3) / pETDuet-1- INO1 stably transformed with the inositol-3-phosphate synthase gene was revived and screened by plate streaking, and then inoculated into LB medium containing 100 μg / ml ampicillin and cultured at 37°C and 200 rpm for 12-16 hours for activation. The above activated E. coli suspension was inoculated into LB medium, TB medium and improved GT medium containing 100 μg / ml ampicillin at a ratio of 1:50, cultured at 37°C and 220 rpm for 24 hours, and samples were taken at 0, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 14.0, 15.0, 16.0 and 24.0 hours to detect the concentration OD of the E. coli engineering bacteria. 600 , draw the growth curve of E. coli engineering bacteria as Figure 2 As shown, from the growth curve of E. coli engineered bacteria, TB medium and improved GT medium performed similarly, both were significantly better than LB medium, while in terms of final enzyme activity, improved GT medium was significantly better than TB medium.

[0055] Example 3

[0056] Inducible expression of recombinant inositol 3-phosphate synthase in Escherichia coli BL21 (DE3) and purification of the target protein.

[0057] The recombinant E. coli engineered bacteria E. lico BL21 (DE3) / pETDuet-1- INO1 stably transformed with the inositol-3-phosphate synthase gene were revived and screened by plate streaking, and then inoculated into LB medium containing 100 μg / ml ampicillin and cultured at 37°C and 200 rpm for 12-16 hours for activation. The above activated E. coli suspension was inoculated into the modified GT medium containing 100 μg / ml ampicillin at a ratio of 1:50, cultured at 37°C and 220 rpm, and the E. coli culture liquid was sampled and tested for OD after about 2 hours and 40 minutes of culture. 600 When the bacterial solution OD 600When the expression reaches about 1.0, 0.2mM IPTG is added to induce expression, the induction temperature is 30℃, and the sample is collected after 4 hours of induction. The corresponding E. coli fermentation broth is centrifuged (13000rpm, 4℃, 15min), the fermentation broth supernatant is discarded, and the cell pellet is resuspended in 10 mM Tris-HCl (pH 8.0) lysis solution containing 1 mg / ml lysozyme at 1 / 10 of the fermentation broth volume, and incubated on ice for 30min to prepare a crude lysate. The cell solution is lysed by freezing in liquid nitrogen and thawing in 30-40℃ water for five cycles. Super nuclease is added at a final concentration of 2.5U / ml, incubated on ice for 30min, and the resulting solution is centrifuged at 14,000 rpm for 15 minutes at 4°C to remove insoluble matter. The crude enzyme solution of inositol-3-phosphate synthase obtained by lysis is separated and purified using a Ni Tanrose6FF (NTA) affinity chromatography column. The purification process is as follows: use the equilibration buffer (50mM Tris, 0.25-0.5M NaCl, 20mM imidazole, pH8.0) to equilibrate the chromatographic column, dilute the crude enzyme solution 10-15 times with the equilibration buffer, filter it through a 0.22μm microporous filter membrane, and then load it. The target protein is collected by stage elution with the elution buffer (50mM Tris, 0.25-0.5M NaCl, 0.5M imidazole, pH8.0) (10% elution buffer to remove impurities, 60% elution buffer to elute, and 100% elution buffer to regenerate the nickel column). Use a concentrator to concentrate to a certain volume, and then replace it twice with 10ml of equilibration buffer to obtain pure enzyme solution. The protein concentration of the pure enzyme is determined by the Bradford method, and it is divided into multiple low-adsorption tubes according to the protein concentration, and then placed in a -80℃ refrigerator. Take it as needed to avoid repeated freezing and thawing of the pure enzyme solution. At the same time, take 40μl of the concentrated pure enzyme solution for SDS-PAGE electrophoresis analysis, such as Figure 3 As shown, the loading amount is 5 μg, the loading volume is 20 μl, M is the protein marker, S1-S9 are 9 samples after purification, concentration and substitution, and the protein molecular weight is 60 KDa.

[0058] Example 4

[0059] Optimization of the fermentation process of E. coli BL21 (DE3) / pETDuet-1-INO1 expressing recombinant inositol 3-phosphate synthase: After screening LB medium, TB medium, and GT medium to determine the most suitable GT medium, single-factor and orthogonal experiments were performed on the GT medium to determine the optimal medium components, so that the recombinant E. coli can be cultured at a high density, the process stability is high, and the enzyme activity is significantly improved, which includes the following steps:

[0060] (1) The optimal culture time and basal culture medium were determined by inducing culture in three basal culture media (LB, TB, GT) for 4 h, 8 h, 16 h, and 24 h. Based on the comprehensive enzyme activity, the growth curve of E. coli, and the pH value of the fermentation broth at different time points, it was determined that the optimal induction time was 4 h and the optimal culture medium was GT medium.

[0061] (2) Add 50 mM MOPS (3-morpholinepropanesulfonic acid) to the GT medium determined in step (1) as a pH buffer system to ensure that the pH of the fermentation broth during the induced expression process is within a reasonable pH range.

[0062] (3) Single-factor experiments were conducted on each component of the GT medium supplemented with 50 mM MOPS: ① The glucose concentration was optimized to determine the optimal glucose concentration of 5.0 g / l, ② The ferrous sulfate heptahydrate concentration was optimized to determine the optimal ferrous sulfate heptahydrate concentration of 1.0 mM, ③ The magnesium sulfate heptahydrate concentration was optimized to determine the optimal magnesium sulfate heptahydrate concentration of 1.0 g / l, ④ The inorganic nitrogen source was optimized to determine the optimal inorganic nitrogen source to be 5 g / l NH4SO4 or NH4OOCCH3, ⑤ The organic nitrogen source trypsin and yeast extract concentrations were optimized to determine the optimal organic nitrogen source to be 8.0 g / l trypsin, and ⑥ The glycerol concentration was optimized to determine the optimal glycerol concentration to be 5.0 g / l. The results of the single-factor experiments are as follows: Figure 4 shown.

[0063] (4) A seven-factor three-level orthogonal test was conducted on the single-factor components of step (3), with the glucose (Glc) concentration level being 3.0 g / l-7.0 g / l, the glycerol concentration level being 3.0 g / l-7.0 g / l, the trypsin concentration level being 6.0 g / l-10.0 g / l, the ammonium sulfate concentration level being 3.0 g / l-7.0 g / l, the ammonium acetate concentration level being 0.0 g / l-1.5 g / l, the magnesium sulfate heptahydrate concentration level being 0.5 g / l-1.5 g / l and the ferrous sulfate heptahydrate concentration level being 0.5 g / l-1.5 g / l.

[0064] (5) According to the results of orthogonal test range analysis and verification experiments, the final concentrations of the components of the improved GT medium were 3 g / l Glc, 7 g / l glycerol, 6 g / l trypsin, 5 g / l ammonium sulfate, 0 g / l ammonium acetate, 1.5 g / l magnesium sulfate heptahydrate, 0.5 mM ferrous sulfate heptahydrate, 1 g / l potassium dihydrogen phosphate, 2 g / l sodium chloride, 0.015 g / l anhydrous calcium chloride, and 50 mM 3-morpholinepropanesulfonic acid.

[0065] The use of the improved GT medium can significantly improve the activity of inositol-3-phosphate synthase compared to the commonly used GT medium, with the increase reaching 30-40%.

[0066] Example 5

[0067] Substrate conversion: The recombinant expressed enzyme obtained in Example 3 of the present invention was used to catalyze the substrate glucose-6-phosphate to obtain the product inositol-3-phosphate. The enzymatic reaction system was: 50 mM Tris-acetate (pH 7.0), 0.8 mM NAD + , 14mMNH4Cl, 5mM beta-ME, 3mM and 5mM glucose-6-phosphate, 221μg inositol-3-phosphate synthase, react at 52℃ for 4 hours. After the enzymatic reaction, the concentration of the product inositol-3-phosphate was detected by colorimetric method, and the substrate conversion rate was calculated. Figure 5 As shown, the conversion rates reached 95.69±1.48% and 94.38±0.42% when the substrate concentrations were 3mM and 5mM, respectively.

[0068] It should be noted that the above-mentioned technical contents of the present invention are only for explanation and clarification to enable those skilled in the art to understand the technical essence of the present invention, so the technical contents are not used to limit the substantial protection scope of the present invention. The substantial protection scope of the present invention shall be subject to the claims. Those skilled in the art should know that any modification, equivalent substitution and improvement based on the substantial spirit of the present invention shall be within the substantial protection scope of the present invention.

Claims

1. A genetically engineered Escherichia coli bacterium that recombinantly expresses inositol 3-phosphate synthase, which is obtained by using pETDuet-1 as a vector, connecting the inositol 3-phosphate synthase gene INO1 to the vector multiple cloning site MCS-1, and knocking out the multiple cloning site MCS-2 through homologous recombination to obtain a recombinant plasmid pETDuet-1-INO1, which is then transformed into Escherichia coli BL21 (DE3).

2. The genetically engineered Escherichia coli bacteria expressing recombinant inositol-3-phosphate synthase according to claim 1, characterized in that: The inositol-3-phosphate synthase gene is derived from Saccharomyces cerevisiae, and the nucleotide sequence is shown in SEQ ID NO.

1.

3. The genetically engineered Escherichia coli bacteria expressing recombinant inositol-3-phosphate synthase according to claim 1, characterized in that: The inositol-3-phosphate synthase gene is connected to the vector multiple cloning site MCS-1, using pETDuet-1 as the vector, linearizing the vector pETDuet-1 by double restriction digestion at the cloning sites EcoRI and PacI, and homologously recombining the INO1 fragment with homology arms amplified by PCR with the linearized vector to obtain the recombinant plasmid pETDuet-1-INO1.

4. The genetically engineered Escherichia coli bacteria expressing recombinant inositol-3-phosphate synthase according to claim 3, characterized in that: After the homologous recombination reaction between the linearized vector pETDuet-1 and the target gene INO1 fragment with homology arms, the multi-cloning site MCS-2 is knocked out.

5. The genetically engineered Escherichia coli bacteria expressing recombinant inositol-3-phosphate synthase according to claim 1, characterized in that: The recombinant plasmid pETDuet-1-INO1 was transformed into Escherichia coli BL21 (DE3) by heat shock method. The transformed products were evenly spread on LB plate culture medium containing ampicillin resistance, and the plate was inverted in a 37°C incubator for overnight culture. Suitable single colonies on the LB plate were selected for colony PCR verification. The single colonies after colony PCR verification were cultured overnight, the bacteria were collected by centrifugation, the plasmid was extracted, and the sequencing and enzyme digestion verification were performed to obtain Escherichia coli genetically engineered bacteria that stably transformed with the recombinant plasmid pETDuet-1-INO1.

6. Use of the genetically engineered Escherichia coli bacteria expressing recombinant inositol-3-phosphate synthase according to claim 1 in inducing expression of inositol-3-phosphate synthase.

7. The use according to claim 6, characterized in that A method comprising the following steps is employed: (1) Inoculate the engineered E. coli strain E. lico BL21 (DE3) / pETDuet-1- INO1 in LB medium containing 100 μg / ml ampicillin and culture at 37°C, 200 rpm for 12-16 hours for activation; (2) The activated E. coli suspension in step (1) was inoculated into a modified GT medium containing 100 μg / ml ampicillin and 50-100 mM 3-morpholinepropanesulfonic acid at a ratio of 1:50, cultured at 37°C and 220 rpm, and the OD of the E. coli suspension was measured. 600 When the bacterial solution OD 600 When the concentration reaches about 1.0, 0.2 mM IPTG is added to induce expression at 30°C, and samples are collected after 4 hours of induction; (3) The E. coli fermentation broth obtained in step (2) was centrifuged at 4°C and 13,000 rpm for 15 min, the fermentation broth supernatant was discarded, the cell pellet was resuspended in 10 mM Tris-HCl lysis buffer, pH = 8.0, containing 1 mg / ml lysozyme, and incubated on ice for 30 min to prepare a crude lysate; the cell solution was lysed by freezing in liquid nitrogen and thawing in 30-40°C water for five cycles; Super nuclease was added at a final concentration of 2.5 U / ml, incubated on ice for 30 min, and the resulting solution was centrifuged at 14,000 rpm for 15 min at 4°C to remove insoluble matter to obtain crude inositol-3-phosphate synthase enzyme solution, which was separated and purified using a Ni Tanrose 6FF (NTA) affinity chromatography column.

8. The use according to claim 7, characterized in that The separation and purification method comprises the following steps: balancing a chromatographic column with an equilibrium buffer, diluting a crude enzyme solution by 10-15 times with the equilibrium buffer, filtering the crude enzyme solution through a 0.22 μm microporous filter membrane, loading the sample, collecting the solution by stage elution with an elution buffer, concentrating the solution, and replacing the solution twice with 10 ml of the equilibrium buffer to obtain a pure enzyme solution; the equilibrium buffer comprises 50 mM Tris, 0.25-0.5 M NaCl, 20 mM imidazole, and pH=8.0; the elution buffer comprises 50 mM Tris, 0.25-0.5 M NaCl, 0.5 M imidazole, and pH=8.0; the stage elution comprises first eluting with 10% elution buffer to remove impurities, then eluting with 60% elution buffer, and then regenerating the nickel column with 100% elution buffer.

Images