Chlorpyrifos pesticide detection method and kit based on high-affinity tailoring aptamer

Abstract

The invention provides a chlorpyrifos pesticide detection method based on a high-affinity tailoring aptamer and a kit, and belongs to the field of food safety and rapid detection.Key binding sites of the CPF aptamer and CPF are accurately recognized by adopting a molecular simulation technology, molecular docking is performed, verification is performed by adopting a graphene oxide fluorescence quenching method after optimization tailoring, and the detection result is accurate. And the cutting aptamer with higher affinity is obtained. The cutting aptamer is used as a recognition element, the existence and concentration level of the chlorpyrifos are rapidly judged by observing the color change of a reagent mixture through naked eyes by utilizing the characteristic that the nanogold gathers and changes color in a high-salt environment and the anti-aggregation effect of the aptamer for protecting the nanogold, and a nanogold colorimetric method is established for rapid quantitative detection of the chlorpyrifos. The invention further discloses a special colorimetric card kit based on the colorimetric card. The detection method is simple and easy to implement, wide in application range, economical, efficient and the like, can improve the field detection efficiency, and has a reference value for the colorimetric detection research of the aptamer of the organophosphorus pesticide residue.

Description

Technical Field

[0001] The invention provides a chlorpyrifos pesticide detection method and a kit based on high-affinity tailored aptamers, belonging to the technical field of rapid food safety detection. Background Art

[0002] Chlorpyrifos (CPF) is a heterocyclic organophosphorus pesticide in the form of white crystals or powdered solids. It is widely used in the prevention and control of pests in economic crops such as cereals due to its low toxicity and significant insecticidal effect. However, the abuse of CPF will accumulate in large quantities in soil, water, food chains and air, posing a potential threat to human health. Since CPF kills pests by inhibiting the activity of acetylcholinesterase, when the human body is exposed to excessive amounts of CPF, this inhibition will have a negative impact on the nervous system, leading to neurological disorders, manifested as poisoning symptoms such as headaches, dizziness, nausea, vomiting, muscle cramps, etc., in addition to adverse effects on the immune system, respiratory system and digestive system.

[0003] At present, the detection methods for chlorpyrifos pesticide residues in fruits and vegetables in my country mainly include instrumental detection methods that rely on large analytical instruments, such as gas chromatography, high-performance liquid chromatography, chromatography-mass spectrometry, and immunoassay technology. Chromatography has the advantages of high accuracy, but its disadvantages include cumbersome pre-treatment time, complex operation steps, expensive chromatographic instruments, and high detection costs, making it difficult to achieve real-time rapid detection of chlorpyrifos pesticide residues in fresh fruits and vegetables and other agricultural products. Therefore, there is an urgent need for a detection method with high sensitivity, strong specificity, low cost and rapidity to complement the large-scale instrument detection method and meet the requirements of efficient screening of chlorpyrifos pesticide residues in large quantities of agricultural products. Summary of the invention

[0004] In view of the above problems, the purpose of the present invention is to provide a visual detection method and kit for chlorpyrifos based on high-affinity tailored aptamers. Molecular docking and molecular dynamics simulation methods are used to explore the interaction mode and specific binding conformation of aptamers and CPF, molecular simulation tailoring technology is used to obtain 1 and 2 aptamers, and graphene oxide fluorescence quenching method is used to obtain high-affinity FAM-1 aptamer, which is used as a specific recognition element to utilize the characteristics of gold nanoparticles (AuNPs) aggregation in a high-salt environment to cause color change, and is used for rapid quantitative detection of chlorpyrifos in agricultural products and kit design, with good specificity and sensitivity.

[0005] In order to achieve the above object, the specific scheme adopted by the present invention is: In a first aspect, an aptamer for detecting chlorpyrifos pesticide residues, wherein the aptamer sequence is shown in SEQ ID NO: 1 or SEQ ID NO: 2. Preferably, the aptamer 1 has a sequence of SEQ ID NO: 1.

[0006] In a second aspect, the aptamer is used in the detection of chlorpyrifos pesticide residues. The detection is qualitative detection and / or quantitative detection.

[0007] In the third aspect, a method for detecting chlorpyrifos pesticide based on high-affinity tailored aptamers is provided. The above aptamers are used as specific recognition elements, and the color change caused by the aggregation of AuNPs in a high-salt environment is utilized. The color change of the AuNPs solution and the A 760 nm / A 520 nm The ratio of 2.0 to 2.5 is used to realize the qualitative and quantitative detection of chlorpyrifos.

[0008] Furthermore, the quantitative detection method comprises the following steps: Step 1: Construction of aptamer sensor: Add AuNPs solution and aptamer solution to the ELISA plate and incubate at room temperature for 15 min; then add CPF standard solution of different mass concentrations and incubate for 20 min, and finally add NaCl solution and incubate at room temperature for 20 min to observe the color change of the solution; measure the absorbance of the solution at 520 nm and 760 nm, and use A 760 nm / A 520 nm The ratio is taken as the ordinate, and the CPF mass concentration is taken as the abscissa to draw the standard curve; Step 2: Determine the A of the sample solution using the method of step 1. 760 nm / A 520 nm The mass concentration of CPF was obtained by comparing the ratio with the standard curve.

[0009] Furthermore, in step 1, 75 μL of AuNPs solution and 15 μL of 5000 nmol / mL aptamer solution were added to the ELISA plate and incubated at room temperature for 15 min; then 15 μL of CPF standard solutions with mass concentrations of 10, 50, 100, 150, 350, 900, and 1000 ng / mL were added and incubated for 20 min; finally, 15 μL of 200 mmol / L NaCl solution was added and incubated at room temperature for 20 min, and the color change of the solution was observed and the A 760 nm / A 520 nm ratio.

[0010] In a fourth aspect, a visualization detection kit for chlorpyrifos based on high-affinity tailored aptamers is provided, comprising an ELISA plate, an AuNPs solution, an aptamer solution, a NaCl solution, a CPF standard solution, a colorimetric card, and a white background plate for observing the results.

[0011] Beneficial effects: The present invention predicts the optimal three-dimensional configuration and key binding sites of the CPF aptamer binding to the target, and obtains two truncated aptamers with a length of 60-mer and 49-mer for molecular docking through reasonable truncation, and verifies them by using the graphene oxide fluorescence quenching method. After cutting, the affinity is improved, and the aptamer 1 with higher affinity is obtained. Then, based on the aptamer 1 as the recognition element, based on the aggregation and color change characteristics of nanogold in a high-salt environment and the anti-aggregation effect of the aptamer protecting nanogold, the color change of the reagent mixture is observed by the naked eye to quickly judge the presence and concentration level of chlorpyrifos, and a nanogold colorimetric method is established for the rapid quantitative detection of chlorpyrifos. At the same time, the present invention also provides a special colorimetric card kit, which is specially designed to include a white background plate and three transparent sides, and the container is transparent to accommodate the reagent mixture so as to observe the color change. The kit is equipped with a gradient standard colorimetric card, which provides a series of standard colors with known concentrations for comparing and analyzing the color changes of the reagent mixture. The invention has the advantages of being simple, easy to operate, having a wide range of applications, and being economical and efficient. It can improve the efficiency of on-site detection and has reference value for the research on aptamer colorimetric detection methods for organophosphorus pesticide residues. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 It is the secondary structure diagram of CPF aptamer 1 and aptamer 2.

[0013] Figure 2 This is the detailed binding pattern diagram of aptamer 1 and aptamer 2 with CPF after HDOCK docking.

[0014] Figure 3 Related structural diagrams of aptamers 1 and 2; (A) 2D and 3D structures of CPF aptamers (B) 2D and 3D structures of CPF; (C) Binding mode of aptamer and CPF after HDOCK docking; (D) 3D structure of the complex (aptamer electrostatic surface and detailed 2D and 3D binding modes); (E) Binding mode of aptamer and CPF after GROMACS molecular dynamics; (F) 3D structure of the complex (detailed 2D and 3D binding modes of aptamer and CPF).

[0015] Figure 4 These are the characterization results of AuNPs; (A) AuNPs UV-visible absorption spectrum; (B) AuNPs particle size distribution.

[0016] Figure 5 is a transmission electron microscopy image of AuNPs.

[0017] Figure 6The following are the detection principles and results of AuNPs colorimetric method based on aptamers; (A) the principle diagram of AuNPs colorimetric method for detecting CPF; (B) the UV-visible absorption spectra of AuNPs in different systems.

[0018] Figure 7 This is a diagram showing the specific identification results of different organophosphorus pesticides using the method of the present invention.

[0019] Figure 8 It is a schematic diagram of the special detection kit of the present invention. DETAILED DESCRIPTION

[0020] The present invention utilizes the specific recognition function of aptamers for Chlorpyrifos (CPF) and the aggregation characteristics of nano-gold particles in a high-salt environment to construct a visual detection method and kit for Chlorpyrifos based on high-affinity tailored aptamers. Molecular simulation technology is used to accurately identify the key binding sites of the CPF aptamer and CPF and perform molecular docking. Based on an aptamer with a length of 91-mer, the aptamer is structurally optimized, the key stem-loop structure is retained, and it is reasonably truncated to obtain two truncated aptamers with lengths of 60-mer and 49-mer. The graphene oxide fluorescence quenching method is used for verification. After tailoring, the affinity is improved to obtain a tailored aptamer with higher affinity. Then, based on the tailored aptamer as a recognition element, the aggregation and color change characteristics of nano-gold in a high-salt environment and the anti-aggregation effect of the aptamer protecting nano-gold are utilized. The color change of the reagent mixture is observed by naked eyes to quickly judge the presence and concentration level of Chlorpyrifos, and a nano-gold colorimetric method is established for rapid quantitative detection of Chlorpyrifos.

[0021] To support the rapid quantification of the above method, a special colorimetric card kit was invented. Its special design includes a white background plate and three transparent sides. The container is transparent to hold the reagent mixture so that the color change can be observed. The kit is equipped with a gradient standard colorimetric card, which provides a series of standard colors of known concentrations for comparing and analyzing the color changes of the reagent mixture. This invention has the advantages of simplicity, wide application range, and economic efficiency. It can improve the efficiency of on-site detection and has reference value for the study of aptamer colorimetric detection methods for organophosphorus pesticide residues.

[0022] The 91-mer aptamer sequence before trimming was CPF-N23-Squence (5'-3')-CCTGCCACGCTCCGCAAGCTTAGGGTTACGCCTGCAGCGATTCTTGATCGCGCTGCTGGTAATCCTTCTTTAAGCTGGCACCCGCATCGT.

[0023] The new sequences (5'-3') obtained after the aptamer sequences were trimmed are aptamer 1 (nucleotide sequence such as SEQ ID NO: 1) and aptamer 2 (nucleotide sequence such as SEQ ID NO: 2). The length of aptamer 1 is 60-mer, and the length of aptamer 2 is 49-mer.

[0024] The specific sequence of aptamer 1 is: AGCTTAGGGTTACGCCTGCAGCGATTCTTGATCGCGCTGCTGGTAATCCTTCTTTAAGCT.

[0025] The specific sequence of aptamer 2 is: AGCTTAGGGTTACGCCTGCAGCGATTCTTTGGTAATCCTTCTTTAAGCT.

[0026] Fluorescent groups, such as FAM, are connected to the 5' ends of the aptamer 1 and the aptamer 2, respectively.

[0027] The present invention is based on the secondary structure of the aptamer and the molecular simulation docking results to perform reasonable cutting, retaining the stem-loop part that binds to CPF. Then, the graphene oxide fluorescence quenching method is used to compare the binding affinity of the aptamer to CPF before and after cutting, and the aptamer sequence with the best affinity to CPF is selected as the recognition element of the sensor according to the dissociation constant (kd).

[0028] The present invention provides a visual detection method and kit for chlorpyrifos based on high-affinity tailored aptamers, and the basic principle is that the surface of the prepared AuNPs is kept in a dispersed state in the solution and is wine red in color due to the mutual repulsion between charges. The aptamer is adsorbed on the surface of the nanogold particles by electrostatic interaction or covalent bond to form an aptamer-nanogold complex, so that the nanogold particles are dispersed in the solution and present a wine red color. The ions in the high-salt solution will compete with the electrostatic adsorption sites of the aptamer on the surface of the nanogold particles, thereby inhibiting the formation of the aptamer-nanogold complex, and the electrostatic repulsion between the nanogold particles is enhanced, resulting in the aggregation of the nanogold particles to form clusters, and the color of the solution changes from wine red to blue purple or gray blue. When chlorpyrifos is present, chlorpyrifos specifically binds to the aptamer, and this binding force is much greater than the adsorption force between the aptamer and the nanogold particles. This causes the aptamer to dissociate from the surface of the nanogold particles, and the electrostatic repulsion between the nanogold particles is increased, further promoting the aggregation of the nanogold particles. During the detection process, this color change can be observed by naked eyes to achieve semi-quantitative detection, that is, the content of chlorpyrifos can be preliminarily judged by comparing the depth of color or obvious color changes. Organophosphorus pesticides usually have specific absorption peaks in the ultraviolet region, and the content of chlorpyrifos can be accurately determined by measuring the absorbance. In order to achieve accurate quantitative detection, an ultraviolet spectrophotometer can be used to measure the absorbance of the color-developing compound produced in the solution.

[0029] The above detection method combines the advantages of naked eye observation and instrumental measurement in achieving semi-quantitative and accurate quantitative detection, has certain practicality and popularization, and can be used in the field of detection of organophosphorus pesticides.

[0030] Aptamer sensor construction: 75 μL of AuNPs solution and 15 μL of 5000 nmol / mL aptamer solution were added to the ELISA plate and incubated at room temperature for 15 min. Then, 15 μL of CPF standard solution with different mass concentrations (10, 50, 100, 150, 350, 900, 1000 ng / mL) was added and incubated for 20 min. Finally, 15 μL of 200 mmol / L NaCl solution was added and incubated at room temperature for 20 min. The color change of the solution was observed. All tests were performed at room temperature. The UV-visible absorption spectrum of the solution in the range of 400-800 nm and the absorbance at 520 nm and 760 nm were measured with A 760 nm / A 520 nm The ratio of is taken as the ordinate, and the CPF mass concentration is taken as the abscissa. The standard curve is drawn and the limit of detection (LOD) is calculated. The calculation formula is LOD=3S0 (standard deviation) / S (slope).

[0031] The specific preparation method of AuNPs solution is as follows: first, 1 mL, 1% chloroauric acid is diluted to 1 to 100 mL with ultrapure water, and placed on a heated magnetic stirrer at 250°C and 1500 r / min for 15 min until the solution boils. Quickly add 3 mL of 1% trisodium citrate to the boiling and continuously stirred solution, continue stirring and heating until the solution is a transparent wine red color, and wait to cool to 4°C. The AuNPs solution is scanned by ultraviolet light in the wavelength range of 400-800 nm to determine the maximum absorption peak, and the appearance and particle size of the prepared AuNPs are characterized by a nanoparticle size analyzer and a transmission electron microscope.

[0032] This method was used to detect common organophosphorus pesticides such as omethoate, malathion, dichlorvos, glyphosate, and fenthion at a mass concentration of 500 ng / mL, and ultrapure water was taken as a negative control. According to the UV-visible absorption spectrum of the solution in the range of 400-800 nm, A 760 nm / A 520 nm The specificity of this method was compared and analyzed.

[0033] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0034] When the aptamer interacts with the target, only some nucleotides participate in the binding. The excess nucleotides will interfere with the tertiary structural stability of the aptamer-target complex, thereby affecting its binding force in the buffer solution. Therefore, the present invention predicts the optimal three-dimensional configuration and key binding sites for the binding of the CPF aptamer to the target, and reasonably truncates the 91-mer aptamer to obtain two truncated aptamers 1 and aptamer 2 with lengths of 60-mer and 49-mer ( Figure 1 ), and molecular docking was performed ( Figure 2 ), verified by graphene oxide fluorescence quenching method, the affinity was improved after cutting, and the aptamer 1 with higher affinity was obtained. Then, based on aptamer 1 as the recognition element, based on the aggregation and color change characteristics of nanogold in a high-salt environment and the anti-aggregation effect of the aptamer protecting nanogold, the color change of the reagent mixture was observed by naked eyes to quickly judge the presence and concentration level of chlorpyrifos, and the nanogold colorimetric method was established for the rapid quantitative detection of chlorpyrifos.

[0035] (1) Molecular docking and dynamics simulation Mfold website predicts the secondary structures of different aptamers. The larger negative Gibbs free energy indicates that the binding between the aptamer and the target is more spontaneous and stable, and it also depends on the relationship between the change of enthalpy and entropy (ΔS and ΔH, respectively) at a given temperature (ΔG=ΔH-T ΔS). The thermodynamic parameters (ΔG) value of -15.47 kcal / mol, enthalpy and entropy values ​​of -182.3 kcal / mol and -537.9 kcal / mol, respectively, were selected as the optimal secondary structure. The secondary structure of CPF aptamer is shown in Figure 3 As shown in A, the number of guanine (G) accounts for 24% of the total base number, which helps the aptamer form a stable GC base pair and maintain the stability of the overall structure. The secondary structure contains hairpins, stem loops and protrusions, which undergo conformational changes through stacking forces and electrostatic interactions, thereby forming a specific binding area of ​​the aptamer and becoming a potential binding site for the target. Figure 3 As shown in B, it contains phosphoryl, chlorine atoms and heterocyclic structures. The HDOCK docking tool was used to predict the binding sites of CPF and the aptamer for molecular docking and evaluation. Since the lower the calculated binding free energy result, the higher the affinity between the aptamer and CPF, the conformation with the lowest binding energy of -4.81 kcal / mol was selected for analysis. Figure 3As shown in C and D, the key bases for the binding of the aptamer to CPF are A-17, A-18, C-19, A-22, A-72, A-73, A-73, G-74, C-75, and G-21, which form hydrogen bonds with the phosphoryl group, with a hydrogen bond length of 2.1Å (1Å=10 nm). This indicates that the stem-loop of the aptamer plays an important role in the formation of a stable complex structure of the nucleic acid aptamer. In order to further explore the interaction, binding process and kinetic properties between the aptamer and CPF, the molecular dynamics simulation of the docked ligand complex was performed for 100ns using the GROMACS software. The simulation results are shown in Figure 2. Figure 3 As shown in E and F, during the simulation, the binding pocket of CPF and aptamer moved, and the key bases for the binding of aptamer and CPF were A-16, A-17, G-18, C-19, T-20, T-21, A-22, T-71, A-72, A-73, G-74, C-75, and T-76. The aptamer formed a regular curved helical conformation in the three-dimensional conformation. The results showed that the interaction between CPF and aptamer was mainly through hydrogen bonding, which kept the formed conformation stable. In addition, during the entire simulation process, CPF never left the binding cavity formed by the aptamer, indicating that there was a stable interaction force between CPF and aptamer.

[0036] (2) Affinity identification by graphene oxide fluorescence quenching method To verify the performance of the two tailored aptamers, affinity experiments were performed. 120 μL of 0.5 mg / mL graphene oxide solution was added to the system, and 10 μL of aptamer solutions with concentrations of 0, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, and 2000 nmol / mL were added. The system was incubated at room temperature for 30 min, and then 10 μL of 500 ng / mL CPF solution was added. The system was incubated at room temperature in the dark for 30 min. Finally, ultrapure water was added to each tube to a total volume of 300 μL. After mixing, the emission wavelength was measured at 520 nm. Three parallel experiments were repeated for each sample. The collected data were nonlinearly fitted using GraphPad Prism analysis software to obtain the saturation curve and dissociation constant Kd value of the aptamer to determine the aptamer sequence with the best affinity.

[0037] (3) Preparation of gold nanoparticles AuNPs were prepared by sodium citrate reduction method. 1 mL, 1% HAuCl4 was diluted to 100 mL with ultrapure water, placed on a heated magnetic stirrer, and heated at 1500 r / min and 250℃ for 15 min until the solution boiled. 3 mL of 1% sodium citrate was quickly added to the boiling and continuously stirred solution, and the solution was stirred and heated until the color of the solution was transparent red and cooled to 4℃. The UV-visible absorption spectrum of the AuNPs solution in the range of 400-800 nm was scanned by a UV-visible spectrophotometer to determine its maximum absorption peak wavelength. At the same time, the particle size and appearance morphology of the prepared AuNPs were characterized by a nanoparticle size analyzer and a transmission electron microscope.

[0038] UV-Vis spectrophotometer analysis results are as follows Figure 4 As shown in A, the AuNPs solution has a unique characteristic absorption peak at 520 nm, and the solution is a transparent red-orange liquid. The prepared AuNPs were characterized by a nanoparticle size analyzer, and the results are shown in Figure 4 As shown in Figure B, the prepared AuNPs have a uniform particle size (17.2 nm) and a PDI of 0.062. The prepared AuNPs were characterized by transmission electron microscopy ( Figure 5 ), AuNPs are uniformly spherical. AuNPs particles are normally dispersed in the solution ( Figure 5 A), after adding NaCL, it induced aggregation ( Figure 5 B). In summary, the prepared AuNPs are evenly distributed in the solution and have good quality.

[0039] (4) AuNPs colorimetric method for quantitative detection of CPF The principle of AuNPs colorimetric detection of CPF based on aptamers is as follows Figure 6 As shown in A, the results are Figure 6 As shown in B. The AuNPs solution is red in a dispersed state, with a unique characteristic absorption peak at 520 nm, and the solution is red. Aptamers are added to the AuNPs solution, and then high concentrations of NaCl are added. Due to electrostatic effects, the aptamers are adsorbed on the surface of the AuNPs particles to form a protective layer to prevent charge shielding and particle aggregation caused by high concentrations of NaCl. This allows the gold nanoparticles to remain dispersed even at high NaCl concentrations, and the absorbance at 520 nm does not change significantly, and the solution remains red. When aptamers and CPF are added to the AuNPs solution, and high concentrations of NaCl are added, the aptamers preferentially form a stable complex with CPF. Due to the presence of high concentrations of NaCl, the AuNPs previously stabilized by the aptamer will aggregate due to the weakening of electrostatic repulsion. At this time, the absorbance value at 520 nm decreases, and the absorbance value at 760 nm increases significantly, indicating that the A of the solution 760 nm / A 520 nmThe value is positively correlated with the CPF concentration. Based on the change of solution color caused by NaCl-induced AuNPs aggregation and A 760 nm / A 520 nm The change of the value can realize the quantitative detection of CPF.

[0040] (5) Optimization of experimental conditions AuNPs act as color indicators in the entire detection system. By optimizing the volume of AuNPs solution, ideal color changes can be observed in the detection system. In order to facilitate the observation of the color recognition between solutions, the color change effect of different volumes of AuNPs solution was analyzed. The reaction system was set up with different volumes (15 μL, 45 μL, 60 μL, 75 μL, 90 μL, 105 μL) of AuNPs solution, ultrapure water was used instead of CPF aptamer solution and CPF standard solution, and 15 μL of 200mmol / L NaCl solution was added and incubated at room temperature.

[0041] The concentration of NaCl has a direct impact on the sensitivity of the detection system. In a volume of 75 μL AuNPs solution, ultrapure water was used to replace the CPF aptamer solution and the CPF standard solution, and then 15 μL of NaCl solutions of different concentrations (0, 10, 20, 50, 100, 150, 200, 250, 300, 350, 400, 450 mmol / L) were added in sequence, incubated at room temperature for 20 min, and the color change of the solution was observed.

[0042] Too high aptamer concentration will affect the sensitivity of the detection system, while too low aptamer concentration cannot completely protect AuNPs. Based on the optimized NaCl optimum concentration, 15 μL of aptamers of different concentrations (0, 200, 400, 600, 800, 1000, 2000, 3000, 4000, 5000, 6000, 7000 nmol / L) were added to 75 μL of AuNPs solution, incubated at room temperature for 20 min, and then 15 μL of 200 mmol / L NaCl solution was added and incubated at room temperature for 20 min.

[0043] The incubation time of AuNPs and NaCl has a significant effect on the aggregation state of AuNPs and the color change of the detection system, so the incubation time of AuNPs and NaCl is optimized. In order to ensure that the aptamer is fully adsorbed on the surface of AuNPs particles and maintain the dispersed state of AuNPs particles to play its protective role, the incubation time of AuNPs and NaCl is optimized. In order to maximize the specific recognition and effective binding of the aptamer and CPF, the incubation time of CPF and aptamer is optimized.

[0044] (6) Aptamer-based AuNPs colorimetric detection of CPF Under the optimal incubation conditions, different concentrations of CPF standard solutions were measured to observe the color change of AuNPs and measure their absorbance. With CPF mass concentration (10, 50, 100, 150, 350, 900, 1000 ng / mL) as the horizontal axis, A 760 nm / A 520 nm The value is the vertical axis and the standard curve is drawn.

[0045] (7) Specific identification CPF, omethoate, malathion, dichlorvos, glyphosate, and fenthion were tested. The results are as follows: Figure 7 As shown in A, the significance analysis of CPF specificity at different concentrations was performed. The same lowercase letters between columns of different colors indicate that the data difference is not significant. When the detection concentration is 0, the A of CPF and the five pesticides is 760 nm / A 520 nm There was no significant difference (P>0.05). When the concentration was 250 ng / mL and 500 ng / mL, A 760 nm / A 520 nm The value was significantly higher than that of other organophosphorus pesticides, with significant difference (P<0.05). Figure 7 B is the chemical structure of each organophosphorus pesticide. Although they all have similar P=S (phosphorothioate) and P=O (phosphate) structures, this method still has obvious specificity in detecting CPF. This shows that the detection of CPF by this method will not be affected by other pesticides and has good specificity.

[0046] (8) Actual sample testing The spiked samples were tested in accordance with the national standard "National Food Safety Standard Method for Determination of Pesticide Residues in Plant-derived Foods Liquid Chromatography-Mass Spectrometry" (GB 23200.121-2021), and the results were compared with the AuNPs colorimetric method. The detection conditions of the liquid chromatography-mass spectrometry method are as follows: chromatographic column C18, 2.1 mm (inner diameter) × 100 mm, particle size 1.8 μm, mobile phase: phase A is ammonium formate-formic acid solution, phase B is ammonium formate-potassium formate alcohol solution, flow rate is 0.3 mL / min, column temperature is 40°C, and injection volume is 2 μL. Mass spectrometry conditions: electrospray ion source; positive and negative ion scanning simultaneously; cone voltage 30V; ion source temperature 350°C. The detection results of CPF in actual samples were compared using this method and the national standard method.

[0047] (9) Kit design: Contains a red-blue gradient concentration colorimetric card and a white background for observing the results; one side of the colorimetric card kit is white, and the other sides are transparent. Figure 8 shown.

[0048] It should be noted that the above-described embodiments should be understood as illustrative rather than limiting the scope of protection of the present invention, and the scope of protection of the present invention shall be subject to the claims. For those skilled in the art, some non-essential improvements and adjustments made to the present invention still fall within the scope of protection of the present invention without departing from the essence and scope of the present invention.

Claims

1. An aptamer for detecting chlorpyrifos pesticide residues, characterized in that: The aptamer sequence is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. The aptamer according to claim 1, characterized in that: The aptamer is aptamer 1 whose sequence is shown in SEQ ID NO:

1.

3. Use of the aptamer according to claim 1 or 2 in the detection of chlorpyrifos pesticide residues.

4. The use according to claim 3, characterized in that: The detection is qualitative detection and / or quantitative detection.

5. A method for detecting chlorpyrifos pesticide based on high-affinity tailored aptamers, characterized in that: The aptamer described in claim 2 is used as a specific recognition element, and the characteristic of AuNPs aggregation causing color change in a high-salt environment is utilized, and the color change of the AuNPs solution and the A 760 nm / A 520 nm The ratio of 2.0 to 2.5 is used to realize the qualitative and quantitative detection of chlorpyrifos.

6. The method for detecting chlorpyrifos pesticide according to claim 5, characterized in that: The quantitative detection method comprises the following steps: Step 1: Construction of aptamer sensor: Add AuNPs solution and aptamer solution to the ELISA plate and incubate at room temperature for 15 min; then add CPF standard solution of different mass concentrations and incubate for 20 min, and finally add NaCl solution and incubate at room temperature for 20 min, and observe the color change of the solution; measure the absorbance of the solution at 520 nm and 760 nm, and use A 760 nm / A 520 nm The ratio is taken as the ordinate, and the CPF mass concentration is taken as the abscissa to draw the standard curve; Step 2: Determine the A of the sample solution using the method of step 1. 760 nm / A 520 nm The mass concentration of CPF was obtained by comparing the ratio with the standard curve.

7. The method for detecting chlorpyrifos pesticide according to claim 6, characterized in that: In step 1, 75 μL of AuNPs solution and 15 μL of 5000 nmol / mL aptamer solution were added to the ELISA plate and incubated at room temperature for 15 min. Then, 15 μL of CPF standard solution with mass concentrations of 10, 50, 100, 150, 350, 900, and 1000 ng / mL were added and incubated for 20 min. Finally, 15 μL of 200 mmol / L NaCl solution was added and incubated at room temperature for 20 min. The color change of the solution was observed and the A 760 nm / A 520 nm ratio.

8. A chlorpyrifos visualization detection kit based on high-affinity tailored aptamers, characterized in that: It comprises an ELISA plate, an AuNPs solution, an aptamer solution, a NaCl solution, a CPF standard solution, a colorimetric card and a white background plate for observing the results; the aptamer solution is prepared from the aptamer described in claim 3.

Images