Gene combination, expression cassette, host and application thereof

Abstract

The invention relates to the field of bioengineering, in particular to a gene combination, an expression cassette, a host and application thereof. The invention provides a gene combination. The gene combination comprises a knockout gene and an expression gene, the knockout gene comprises a gene for coding alcohol dehydrogenase; the expression gene comprises an xylM gene from the source of Pseudomonas putida F1, an xylA gene from the source of Pseudomonas putida F1, and an xylC gene from the source of Pseudomonas putida KT2440, and the expression gene comprises an xylM gene from the source of Pseudomonas putida F1, an xylA gene from the source of Pseudomonas putida F1, an xylC gene from the source of Pseudomonas putida KT2440 and an xylC gene from the source of Pseudomonas putida KT2440. According to the invention, a p-toluic acid synthetic route is constructed by taking a p-tolualdehyde non-degradable yeast strain as a chassis and by means of synthetic biology and the like, and the p-toluic acid is optimized and synthesized by screening genome integration sites. The method is beneficial to establishment of a p-toluic acid biosynthesis scheme.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and in particular to gene combinations, expression boxes, hosts and applications thereof. Background Art

[0002] p-Toluic acid (pTA) is a widely used chemical raw material. It can be used to make hemostatic aromatic acid, chloroprene initiator, p-toluonitrile, p-toluyl chloride, bactericidal phosphoramide, and is a commonly used intermediate in the synthesis of medicines, pesticides, organic pigments and photosensitive materials. It can also be used in the synthesis of spices, resins, film and other fine chemicals. After a simple substitution reaction, p-toluic acid can obtain various downstream substituted derivatives, such as p-chlorobenzoyl chloride, p-chloro / bromomethylbenzoic acid, m-amino p-toluic acid, etc., which are also widely used as intermediates for various pharmaceutical materials. The preparation methods of p-toluic acid mainly include toluene carbonylation oxidation method, p-xylene or p-methylisopropylbenzene nitric acid oxidation method, p-xylene air oxidation method, etc. However, the above methods all require catalyst catalysis, the reagents added in the reaction are easy to corrode the container, the reaction is uncontrollable, etc. Therefore, it is necessary to develop a greener and more environmentally friendly method to synthesize p-toluic acid. Compared with chemical processes, the conditions of the biological transformation process are milder and do not require expensive and toxic catalysts. The use of microorganisms to synthesize p-toluic acid has great potential.

[0003] At present, there are not many studies on the biosynthesis of p-toluic acid. Some researchers have achieved the synthesis of p-toluic acid from p-xylene (px) in Escherichia coli and Pseudomonas putida. Saccharomyces cerevisiae is a model microorganism with clear genetic background, strong genetic operability, and good acid and alkali resistance. Summary of the invention

[0004] In view of this, the present invention provides a gene combination, an expression cassette, a host and an application thereof. The present invention uses a p-tolualdehyde non-degrading yeast strain as a chassis, uses synthetic biology and other means to construct a p-toluic acid synthesis pathway, and optimizes the synthesis by screening genomic integration sites. The present invention helps to establish a p-toluic acid biosynthesis scheme.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a gene combination, including: a knockout gene and an expressed gene;

[0007] The knockout genes include: a gene encoding alcohol dehydrogenase;

[0008] The expressed genes include: xylM gene derived from Pseudomonas putida F1, xylA gene derived from Pseudomonas putida F1 and xylC gene derived from Pseudomonas putida KT2440.

[0009] In some embodiments of the present invention, in the above gene combination, the gene encoding alcohol dehydrogenase includes: one or more of: ADH6 gene, ADH7 gene, BDH1 gene, BDH2 gene, ARI1 gene and GRE2 gene.

[0010] In some embodiments of the present invention, in the above gene combination, the xylM gene has:

[0011] (1), the nucleotide sequence shown in SEQ ID NO: 1; or

[0012] (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or

[0013] (3) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2); and / or

[0014] The xylA gene has:

[0015] (4) the nucleotide sequence shown in SEQ ID NO: 2; or

[0016] (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or

[0017] (6) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5); and / or

[0018] The xylC gene has:

[0019] (7), the nucleotide sequence shown in SEQ ID NO: 3; or

[0020] (8) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as the nucleotide sequence shown in (7); or

[0021] (9) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (7) or (8).

[0022] In some embodiments of the present invention, in the above gene combination, the sequence of SEQ ID NO: 1 is: ATGTGGGAATACATCAAGTACTACTTCGCTCCATTGGTTCAAGTTTTTG

[0023]

[0024] (derived from Pseudomonas putida F1)

[0025] In some embodiments of the present invention, in the above gene combination, the sequence of SEQ ID NO: 2 is:

[0026]

[0027] (derived from Pseudomonas putida F1)

[0028] In some embodiments of the present invention, in the above gene combination, the sequence of SEQ ID NO: 3 is:

[0029]

[0030]

[0031] (derived from Pseudomonas putida KT2440)

[0032] The present invention also provides an expression cassette, comprising: the above gene combination.

[0033] In some embodiments of the present invention, in the above expression cassette, the expression gene is expressed at any one of the delta22 site, the delta15 site, the delta9 site and the HO site.

[0034] The present invention also provides an expression vector, comprising: the above expression cassette.

[0035] The present invention also provides a host for transforming and / or transfecting the above expression vector.

[0036] In some embodiments of the present invention, the above-mentioned host, transformed and / or transfected chassis strain includes: yeast.

[0037] In some embodiments of the present invention, in the above-mentioned host, the chassis strain includes: Saccharomyces cerevisiae.

[0038] In some embodiments of the present invention, in the above-mentioned host, the chassis strain includes: Saccharomyces cerevisiae BY4742.

[0039] In some embodiments of the present invention, in the above-mentioned host, the Saccharomyces cerevisiae BY4742 is derived from patent CN113201465 A.

[0040] The present invention also provides the use of the above gene combination, the above expression cassette, the above expression vector and / or the above host in the preparation of p-toluic acid.

[0041] The present invention also provides a method for preparing p-toluic acid, which comprises mixing the above host with p-xylene and fermenting the mixture to obtain the p-toluic acid.

[0042] The beneficial effects of the present invention include:

[0043] (1) Compared with the existing synthesis method of p-toluic acid, the treatment method in this study is mild, less polluting, low-cost, and does not require special equipment;

[0044] (2) As a recognized safe strain, Saccharomyces cerevisiae has better biosafety than other chassis strains, mature regulation strategies, and is easier to implement subsequent optimization processes;

[0045] (3) Compared with chassis bacteria such as Pseudomonas putida, Saccharomyces cerevisiae has biosafety and good robustness, a clear genetic background, and mature molecular manipulation technology, which facilitates the introduction of exogenous pathways and metabolic regulation; Saccharomyces cerevisiae is easy to culture at high density and can effectively alleviate the problem of substrate and product inhibition;

[0046] (4) Compared with the published methods for p-toluic acid biosynthesis, this study reconstructed chassis cells and compared the efficiency of different genomic integration sites, providing more reference significance and research targets for p-toluic acid biosynthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0048] Figure 1 The synthesis pathway of p-toluic acid is shown;

[0049] Figure 2 The reduction and oxidation process of p-tolualdehyde is shown;

[0050] Figure 3 The BY4742-p-methylbenzaldehyde fermentation results are shown;

[0051] Figure 4Shown is the fermentation result of ySc01-p-methylbenzaldehyde;

[0052] Figure 5 Shown are the fermentation results of ySc02, ySc03, ySc04, and ySc05-paraxylene. DETAILED DESCRIPTION

[0053] The invention discloses a gene combination, an expression box, a host and applications thereof.

[0054] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0055] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0056] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0057] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0058] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0059] In Examples 1 to 3 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0060] The present invention will be further described below in conjunction with embodiments:

[0061] Example 1 Obtaining a Saccharomyces cerevisiae strain that blocks the main reduction pathway of p-tolualdehyde (p-TALD)

[0062] The starting strain is Saccharomyces cerevisiae BY4742, which is one of the most widely studied microbial chassis cells. However, Saccharomyces cerevisiae chassis cells contain more than 30 endogenous oxidoreductases, and aldehyde compounds are easily reduced or oxidized. The present invention relates to the oxidation of p-methylbenzyl alcohol (p-TALC) by p-xylene (px), which is then oxidized to p-methylbenzaldehyde (p-TALD) (such as Figure 1 In order to block the reduction process of the intermediate product p-tolualdehyde (as shown in Figure 2 As shown in the figure, this study knocked out 6 alcohol dehydrogenases, which were encoded by the following genes: ADH6 (SGD: S000004937), ADH7 (SGD: S000000702), BDH1 (SGD: S000000056), BDH2 (SGD: S000000057), ARI1 (SGD: S000003125), and GRE2 (SGD: S000005511), blocking the p-tolualdehyde reduction pathway.

[0063] Using CRISPR-Cas9 technology, six alcohol dehydrogenases were knocked out on the basis of strain BYB4742. Taking ADH6 knockout as an example, the specific method is as follows: query the base sequence of about 500bp above and below the ADH6 gene through the SGD website, and use the website to design the sgRNA targeting the ADH6 gene as CTATTCA ATCACACGAAGAT (as shown in SEQ ID NO: 4). Linearize the CRISPR-Cas9 plasmid with BsmBI restriction endonuclease, connect the obtained vector fragment with sgRNA, heat shock transform into Escherichia coli DH5α competent cells, screen for Kana resistance, pick transformants for preliminary verification by colony PCR, activate the correct strains in the initial test by inoculating LB liquid culture medium, extract plasmid sequencing verification, and verify the correct transformants for bacterial preservation. The verified correct plasmid is named CRISPR-ADH6-HIS.

[0064] The sgRNA genes of the remaining 5 genes are as follows: ADH7 (sgRNA: CCAGAAAAATTTCA GGGCAT) (as shown in SEQ ID NO: 5); BDH1 (sgRNA: CGGTTTGGATTTCTG GCCTA) (as shown in SEQ ID NO: 6); BDH2 (sgRNA: ACCTTTACCGAAATAC GCTA) (as shown in SEQ ID NO: 7); ARI1 (sgRNA: ATGAACGATCTGTTGAAA GC) (as shown in SEQ ID NO: 8); GRE2 (sgRNA: ACAGGAGATCGACAATGTG T) (as shown in SEQ ID NO: 9).

[0065] PCR amplification obtained 400 bp fragments of the upstream and downstream of the ADH6 gene, named ADH6-HA-up and ADH6-HA-dn, respectively. ADH6-HA-up and ADH6-HA-dn were connected by overlap extension PCR, and the obtained fragment was named overlap-ADH6-HA.

[0066] The plasmids and fragments were transformed into BY4742 strain by lithium acetate transformation method, and the same method was used to knock out the remaining 5 alcohol dehydrogenases for the verified correct strain. The final strain with 6 alcohol dehydrogenases knocked out was named ySc01.

[0067] Table 1 BY4742-p-methylbenzaldehyde fermentation results

[0068] Time (h) p-TALC(mg / L) pTA(mg / L) p-TALD (mg / L) 0 0 0 428 24 146 27 0 48 197.5 103 0 72 226.5 197.5 0 96 236 231 0

[0069] Table 2ySc01-p-methylbenzaldehyde fermentation results

[0070] Time (h) p-TALC(mg / L) pTA(mg / L) p-TALD (mg / L) 0 0 0 342 24 94.5 56 0 48 120.3 161.5 0 72 150.5 192.5 0 96 160 201.5 0

[0071] The ability of strains BY4742 and ySc01 to convert p-tolualdehyde was verified by fermentation with p-tolualdehyde as substrate. The results showed that after 96 hours, strain BY4742 reduced about 54.2% of p-TALD to p-TALC. At the same time, the reduction rate of strain ySc01 was 46% (the p-TALD reduction rate of BY4742 was (236÷122.16)÷(428÷120.15)=54.2%, and the oxidation rate was (231÷136.15)÷(428÷120.15)=47.6%. The reduction rate of ySc01 was (160÷122.16)÷(342÷120.15)=46.0%, and the oxidation rate was (201÷136.15)÷(342÷120.15)=51.9%. The oxidation rate + reduction rate ≠ 1 may be due to errors in the sample measurement process and the volatilization of solvents during the fermentation process.). Compared with the control strain, the ySc01 strain weakened the reduction of p-tolualdehyde and promoted its oxidation to p-toluic acid.

[0072] Example 2 Obtaining a plasmid for fusion expression of gene xylM and gene xylA

[0073] The xylM and xylA genes can jointly catalyze the conversion of p-xylene into p-methylbenzyl alcohol and then into p-methylbenzaldehyde. Therefore, based on strain ySc01, (GGGGS) 3 A flexible linker fuses the two genes for expression.

[0074] (GGGGS) 3 The DNA sequence is ggtggtggtggttctggtggtggtggttctggtggtggtggttct (as shown in SEQ ID NO: 10).

[0075] Using flexible linker (GGGGS) 3 The N-terminus of xylM was connected to the C-terminus of xylA, and the yeast endogenous promoter P was amplified by PCR. FBA1 and terminator T PGI1 , with xylM-(GGGGS) 3 -xylA overlaps to obtain module P FBA1 -xylM-(GGGGS) 3 -xylA-T PGI1 The pRS415 plasmid was digested with XhoI and BamHI restriction endonucleases to linearize the vector pRS415 and the module P FBA1 -xylM-(GGGGS) 3 -xylA-T PGI1The cells were connected, heat-shocked and transformed into competent E. coli DH5α cells, Amp resistance screening was performed, and transformants were picked for preliminary verification by colony PCR. The correct strains were inoculated into LB liquid medium for activation, and plasmids were extracted and sequenced for verification. The correct transformants were then maintained. The verified plasmid was named pRS415-P FBA1 -xylM-(GGGGS) 3 -xylA-T PGI1 .

[0076] Example 3 Construction and verification of a strain capable of converting p-xylene into p-toluic acid

[0077] The synthetic pathway of p-toluic acid is Figure 1 shown.

[0078] This pathway involves three genes, xylM, xylA, and xylC. The genes xylM and xylA are obtained by the method of Example 2 to obtain a fused expression plasmid, and the correct plasmid is verified by linearization to obtain fragment P FBA1 -xylM-(GGGGS) 3 -xylA-T PGI1 .

[0079] The method for obtaining the xylC expression module is as follows.

[0080] PCR amplification of the yeast endogenous promoter P PGK1 and terminator T HXT7 , overlap with xylC to obtain module P PGK1 -xylC-T HXT7 The pRS415 plasmid was digested with XhoI and BamHI restriction endonucleases to linearize the vector pRS415 and the module P PGK1 -xylC-T HXT7 The cells were connected, heat-shocked and transformed into competent E. coli DH5α cells, Amp resistance screening was performed, and transformants were picked for preliminary verification by colony PCR. The correct strains were inoculated into LB liquid medium for activation, and plasmids were extracted and sequenced for verification. The correct transformants were then maintained. The verified plasmid was named pRS415-P PGK1 -xylC-T HXT7 . Linearization verifies the correct plasmid and obtains fragment P PGK1 -xylC-T HXT7 .

[0081] The two fragments obtained above were integrated into the genome of strain ySc01 delta22 (SGD: S000007175), delta15 (SGD: S000007201), delta9 (SGD: S000007145), and HO site (SGD: S000002386) to explore the effect of the integration site on the level of gene expression. The sgRNA targeting the HO site designed by the website was ACGACTATTCTGATGGCTAA (as shown in SEQ ID NO: 11), the sgRNA targeting delta22 was TTTGTTAATTCCTACATACT (as shown in SEQ ID NO: 12), the sgRNA targeting delta15 was TATACCAAAAATTCTCTC TG (as shown in SEQ ID NO: 13), and the sgRNA targeting delta9 was TGTACCAAAAGTTATCCTGT (as shown in SEQ ID NO: 14).

[0082] Taking integration into the HO site as an example, the original CRISPR plasmid was digested with BsmBI, the linearized plasmid was connected with s gRNA, and heat-shocked into E. coli DH5α competent cells. Kana resistance screening was performed, and transformants were picked for preliminary verification by colony PCR. The initially correct strain was inoculated into LB liquid culture medium for activation, and the plasmid was extracted and sequenced for verification. The verified correct transformant was maintained. The verified correct plasmid was named CRISPR-HO-HIS. Primers were designed, and PCR was used to obtain fragments of about 500 bp above and below the HO site, named HO-HA-up and HO-HA-dn; PCR amplification obtained the promoter fragment P FBA1 and terminator fragment T HXT7 . Overlap with HO-HA-up and HO-HA-dn to get the fragment overlap-HO-HA-up-F BA1P ,overlap-HXT7T-HO-HA-dn. Fragment T was obtained by overlapping extension PCR PGI1 -P PGK1 -xylC-T HXT7 .

[0083] The P HXT7FBA1 -xylM-(GGGGS HXT7 ) 3 -xylA-T PGI1 、T PGI1 -P PGK 1 -xylC-T HXT7 、overlap-HO-HA-up-F BA1P, overlap-HXT7T-HO-HA-dn was transformed into the ySc01 strain to obtain strain ySc05.

[0084] The same method was used to obtain strains integrated into the delta22, delta15, and delta9 sites, which were named ySc02, ySc03, and ySc04, respectively. In order to reduce the volatility and toxicity of p-xylene, a two-phase fermentation strategy was adopted, with 50 mL of YPD medium plus 5 mL of isopropyl myristate and 50 μL of p-xylene. Fermentation was performed at 30 ° C and 220 rpm to verify the ability of strains ySc02, ySc03, ySc04, and ySc05 to convert p-xylene into p-toluic acid. The results showed that after 96 h, strain ySc05 integrated into the HO site synthesized 43.5 mg / L of p-toluic acid, which was 1.6 times that of strain ySc02 (27 mg / L) integrated into the delta22 site.

[0085] Table 3 ySc02, ySc03, ySc04, ySc05-paraxylene fermentation results

[0086] ySc02(mg / L) ySc03(mg / L) ySc04(mg / L) ySc05(mg / L) 24 0 6 5 7 48 0 15.5 23.5 24.5 72 19 28 31 35 96 27 42 39 43.5

[0087] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Genetic combination , characterized in that, include: knocking out genes and expressing genes; The knockout genes include: a gene encoding alcohol dehydrogenase; The expressed genes include: the xylM gene derived from Pseudomonas putida F1, the xylA gene derived from Pseudomonas putida F1 and the xylC gene derived from Pseudomonas putida KT2440.

2. The gene combination according to claim 1, characterized in that: The gene encoding alcohol dehydrogenase includes one or more of ADH6 gene, ADH7 gene, BDH1 gene, BDH2 gene, ARI1 gene and GRE2 gene.

3. The gene combination according to claim 1 or 2, characterized in that: The xylM gene has: (1), the nucleotide sequence shown in SEQ ID NO: 1; or (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or (3) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2); and / or The xylA gene has: (4) the nucleotide sequence shown in SEQ ID NO: 2; or (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or (6) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5); and / or The xylC gene has: (7), the nucleotide sequence shown in SEQ ID NO: 3; or (8) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as the nucleotide sequence shown in (7); or (9) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (7) or (8).

4. An expression cassette, characterized in that include: The gene combination according to any one of claims 1 to 3.

5. The expression cassette according to claim 4, characterized in that The expressed gene is expressed at any one of the delta22 site, the delta15 site, the delta9 site and the HO site.

6. An expression vector, characterized in that include: The expression cassette of claim 4 or 5.

7. A host, characterized in that Transformation and / or transfection with the expression vector according to claim 6.

8. The host according to claim 7, characterized in that Strains for transformation and / or transfection include: Yeast.

9. Use of the gene combination according to any one of claims 1 to 3, the expression cassette according to claim 4 or 5, the expression vector according to claim 6 and / or the host according to claim 7 or 8 in the preparation of p-toluic acid.

10. A method for preparing p-toluic acid, characterized in that: The host as claimed in claim 7 or 8 is mixed with p-xylene and fermented to obtain the p-toluic acid.

Images