Saccharomyces cerevisiae galactose inducible weak promoter vector as well as construction method and application thereof

Abstract

The invention discloses a saccharomyces cerevisiae galactose inducible weak promoter vector as well as a construction method and application thereof, and relates to the field of genetic engineering and synthetic biology. The construction method comprises the following steps: carrying out site-directed mutagenesis on a GAL1 promoter to obtain promoters GAL1mu1 and GAL1mu2; the pAG416-GAL1mu1-ccdB and the pAG416-GAL1mu2-ccdB are obtained by using pAG416-GAL1mu1-ccdB as a template and integrating a mutant sequence into a vector through site-specific mutagenesis and homologous recombination, the correctness of the vector is verified through EcoRV enzyme digestion and Sanger sequencing, a target gene can be subjected to specific low-level expression in a saccharomyces cerevisiae cell under the condition of galactose induction, and the expression quantity of the target gene in the saccharomyces cerevisiae cell is greatly reduced. An effective molecular tool is provided for reducing the cytotoxicity of the heterologous protein to the saccharomyces cerevisiae and accurately regulating the expression and metabolic pathway of the gene.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and synthetic biology, and in particular to a galactose-inducible weak promoter vector of Saccharomyces cerevisiae and a construction method and application thereof. Background Art

[0002] As a eukaryotic model organism, Saccharomyces cerevisiae has the characteristics of clear genetic background, rapid reproduction, simple molecular manipulation, and high safety. It is widely used in basic research and synthetic biology as a chassis cell to produce target compounds. The promoter is a key regulatory element for initiating gene transcription, and regulates the gene pathways and metabolic pathways of Saccharomyces cerevisiae by affecting the expression level of the gene. Selecting a suitable promoter is crucial for finely controlling the intensity of gene expression and coordinating yeast metabolic pathways to efficiently obtain the target product.

[0003] Commonly used promoters for exogenous gene expression in Saccharomyces cerevisiae research include constitutive promoters and inducible promoters, such as pTEF1, pTDH3, pGK1, etc. are constitutive promoters, and pGAL1, pGAL7, pGAL10, etc. are inducible promoters. Constitutive promoters can continuously and stably express the target protein, while inducible promoters need to be stimulated by specific physical and chemical signals to induce transcription of the target gene. The GAL1 promoter is a typical inducible promoter, and its transcription is strictly regulated by galactose. It is not expressed when there is no galactose or glucose in the environment, but when galactose is present in the environment, galactose can bind to the GAL80 protein to release the GAL4 transcription factor, further activating the transcription of the GAL1 promoter and driving the expression of downstream genes. It is worth noting that the commonly used constitutive promoters and inducible promoters are mostly strong promoters, which have certain limitations in application. For example, the excessive expression of some exogenous genes in yeast may be cytotoxic or cause a metabolic burden on the host due to the redistribution of metabolic flux, ATP and other factors, thereby negatively affecting cell growth and ultimately affecting the synthesis yield of the target product. Therefore, the development of promoters with reduced inducible activity to achieve fine regulation of target gene expression is very important for expressing heterologous toxic proteins and effectively synthesizing target products in Saccharomyces cerevisiae. The optimization of Saccharomyces cerevisiae promoters will provide a powerful research tool for coordinating gene expression in metabolic engineering.

[0004] Saccharomyces cerevisiae is widely used in synthetic biology as a chassis cell. Rational use of yeast metabolic pathways can produce high value-added products such as biopharmaceuticals, food and health care. How to accurately regulate gene expression and metabolic flow in Saccharomyces cerevisiae cells is a key issue in achieving efficient production of target products. Promoters are basic functional elements for regulating gene transcription, and they regulate gene pathways and metabolic pathways in Saccharomyces cerevisiae by affecting gene expression levels. Promoter optimization is an effective strategy to meet the needs of different exogenous gene expression in Saccharomyces cerevisiae, coordinate metabolic pathways, and thus efficiently obtain target products. At present, in the study of Saccharomyces cerevisiae, exogenous gene expression usually depends on constitutive promoters and inducible promoters. Constitutive promoters can continuously and stably express target proteins, while inducible promoters can only activate the transcription of target genes under specific signal stimulation. However, many commonly used constitutive and inducible promoters are strong promoters, which brings certain limitations in application. Overexpression of some exogenous genes in yeast may cause cytotoxicity, or increase the burden on the host due to metabolic disorders, thereby affecting cell growth and ultimately reducing the synthetic yield of target products. Therefore, developing promoters with reduced inducible strength to achieve fine regulation of target gene expression is critical for effectively expressing exogenous toxic proteins and synthesizing target products in Saccharomyces cerevisiae. Optimizing promoters will provide important tools and resources for the coordinated gene expression of Saccharomyces cerevisiae in metabolic engineering. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a galactose-inducible weak promoter vector of Saccharomyces cerevisiae and a construction method and application thereof, and to provide an effective molecular tool for fine regulation of gene expression and metabolic pathways in Saccharomyces cerevisiae by developing a galactose-inducible low-expression promoter with attenuated activity, thereby achieving the synthesis and efficient accumulation of target products. The present invention provides a galactose-inducible promoter with attenuated activity of Saccharomyces cerevisiae, so that the target gene is specifically low-expressed under induction conditions, reduces the negative impact of heterologous genes on the growth of Saccharomyces cerevisiae cells, and finely regulates metabolic pathways to effectively synthesize target products, which has important value in basic research and metabolic engineering of Saccharomyces cerevisiae.

[0006] To achieve the above object, the present invention provides the following technical solutions: In the first aspect, the present invention provides a galactose-inducible weak promoter vector of Saccharomyces cerevisiae, wherein the galactose-inducible weak promoter vector of Saccharomyces cerevisiae is obtained by performing site-directed mutagenesis on the GAL1 promoter to obtain promoters GAL1mu1 and GAL1mu2; wherein, GAL1mu1 is obtained by inserting a negative regulatory sequence after the TATA element in the GAL1 promoter; GAL1mu2 is obtained by mutating the CAAT element and inserting the negative regulatory sequence; using pAG416-GAL1-ccdB as a template, the mutant sequence is integrated into the vector by site-directed mutagenesis and homologous recombination to obtain pAG416-GAL1mu1-ccdB and pAG416-GAL1mu2-ccdB, and the correctness of the vector is verified by EcoRV restriction digestion and Sanger sequencing.

[0007] As a further embodiment of the present invention, the negative regulatory sequence inserted after the TATA element in the GAL1 promoter is TTGCCAGGGCAA, which is used to reduce the activity of the promoter to form a modified GAL1mu1 promoter, and the nucleotide sequence is defined as SEQ ID NO.1.

[0008] As a further embodiment of the present invention, when obtaining GAL1mu2, the CAAT element in the GAL1 promoter is mutated to TGCG, and a negative regulatory sequence is inserted downstream to weaken the promoter activity, thereby forming a modified GAL1mu2 promoter.

[0009] As a further embodiment of the present invention, the negative regulatory sequence inserted downstream is TTGCCAGGGCAA, and the nucleotide sequence of the GAL1mu2 promoter is defined as SEQ ID NO.2.

[0010] As a further solution of the present invention, pAG416-GAL1-ccdB was used as a template, and the GAL1mu1 and GAL1mu2 sequences were used to replace the natural GAL1 sequence respectively by overlap extension PCR and homologous recombination to construct two weak promoter expression vectors pAG416-GAL1mu1-ccdB and pAG416-GAL1mu2-ccdB.

[0011] As a further embodiment of the present invention, the weak promoter expression vector pAG416-GAL1mu1-ccdB is SEQ ID NO.3, and the weak promoter expression vector pAG416-GAL1mu2-ccdB is SEQ ID NO.4.

[0012] As a further scheme of the present invention, when the vector is constructed and verified, the correctness of the mutant sequence is confirmed by EcoRV digestion and Sanger sequencing. When applied for verification, green fluorescent protein (GFP) is used as a reporter gene, integrated into the GAL1mu1 and GAL1mu2 promoter vectors, and transformed into Saccharomyces cerevisiae BY4741. The fluorescence intensity of GFP is detected after culturing in an induction medium containing galactose for 24 hours.

[0013] As a further embodiment of the present invention, when verifying the expression of the green fluorescent protein (GFP) reporter gene, pFA6a-GFP(S65T)-kanMX6 was used as a template to construct reporter vectors pAG416-GAL1mu1-GFP and pAG416-GAL1mu2-GFP expressing GFP.

[0014] As a further embodiment of the present invention, when transformed into Saccharomyces cerevisiae BY4741, the recombinant vector was transformed into Saccharomyces cerevisiae BY4741 strain by chemical transformation, and fluorescence detection showed that compared with the natural GAL1 promoter, the GFP expression driven by the GAL1mu1 and GAL1mu2 promoters was reduced to 35.8% and 17.8% of the natural promoter, respectively.

[0015] In a second aspect, the present invention also provides a method for constructing a galactose-inducible weak promoter vector based on Saccharomyces cerevisiae, the steps of which are as follows: a) mutating the natural GAL1 promoter or inserting a negative regulatory element to construct the weak promoter GAL1mu1 or GAL1mu2; b) Using the vector backbone pAG416-GAL1-ccdB, the weak promoter GAL1mu1 or GAL1mu2 was integrated into the vector to construct the pAG416-GAL1mu1-ccdB or pAG416-GAL1mu2-ccdB weak promoter vector.

[0016] As a further scheme of the present invention, when constructing the weak promoter GAL1mu1 or GAL1mu2 in step a), the negative regulatory sequence TTGCCAGGGCAA is inserted downstream of the TATA element of the natural GAL1 promoter to construct the weak promoter GAL1mu1; the CAAT element in the GAL1 promoter is mutated to TGCG, and the negative regulatory sequence TTGCCAGGGCAA is inserted downstream to construct the weak promoter GAL1mu2.

[0017] As a further embodiment of the present invention, the vector used in step b) is pAG416-GAL1-ccdB, and the GAL1mu1 or GAL1mu2 sequence is inserted into the vector by PCR amplification, restriction endonuclease ligation or homologous recombination.

[0018] In a third aspect, the present invention further provides an application of a galactose-inducible weak promoter vector of Saccharomyces cerevisiae to achieve low-level induced expression of a target gene in Saccharomyces cerevisiae, comprising: The weak promoter vector was transformed into Saccharomyces cerevisiae cells; The yeast cells are cultured under galactose induction conditions to induce the expression of the target gene at a low level.

[0019] As a further embodiment of the present invention, the target gene is green fluorescent protein (GFP), and the low-level expression of the gene is used to verify the transcriptional activity of the weak promoter vector.

[0020] As a further embodiment of the present invention, the galactose-inducible weak promoter vector based on Saccharomyces cerevisiae is also used to reduce the toxicity of heterologous proteins to host cells when expressed in Saccharomyces cerevisiae to control the low-level expression of heterologous proteins.

[0021] As a further embodiment of the present invention, the heterologous protein is a key enzyme in metabolic engineering, and the low-level expression achieves precise regulation of metabolic flux.

[0022] The galactose-inducible weak promoter vector of Saccharomyces cerevisiae of the present invention and its construction method and application realize the regulation of low expression level by modifying the GAL1 promoter, and are suitable for metabolic engineering applications of heterologous protein expression. This method has broad application prospects in reducing the cytotoxicity of heterologous proteins and accurately controlling gene expression.

[0023] Compared with the prior art, the galactose-inducible weak promoter vector of Saccharomyces cerevisiae of the present invention and its construction method and application have the following beneficial effects: 1. The present invention constructs GAL1mu1 and GAL1mu2 weak promoters by mutation modification of the GAL1 promoter in Saccharomyces cerevisiae, significantly reduces the transcription intensity under galactose induction conditions, and achieves precise control of heterologous protein expression levels. Compared with the natural promoter, the expression intensity of GAL1mu1 and GAL1mu2 is 35.8% and 17.8% of the natural promoter, respectively, effectively achieving low-level expression of heterologous proteins, and is suitable for research and application scenarios that require precise control of expression levels.

[0024] 2. The weak promoter vector of the present invention reduces the toxic burden of heterologous proteins on Saccharomyces cerevisiae cells by reducing the expression intensity, effectively protects the health of host cells, and helps to improve the stability and production efficiency of heterologous protein expression. The low-level expression of the weak promoter vector of the present invention in Saccharomyces cerevisiae can be better applied to the expression of key enzymes in metabolic engineering. By appropriately expressing these key enzymes, metabolic flux can be accurately regulated, excessive accumulation of metabolites or waste of resources can be avoided, and overall metabolic efficiency can be optimized. The design of this vector provides an effective tool for metabolic network optimization and synthetic biology research.

[0025] 3. The vector construction method of the present invention has simple steps and is suitable for the expression regulation of various genes. The vector skeleton pAG416-GAL1-ccdB and its mutant weak promoters GAL1mu1 and GAL1mu2 are easy to construct and operate in the laboratory, and are suitable for a variety of target genes. They have high versatility and can be widely used in basic biological research and industrial production. The present invention provides two promoters with different expression strengths, GAL1mu1 and GAL1mu2, which correspond to 35.8% and 17.8% of the expression strength of the natural promoter, respectively. Researchers can select suitable promoters to achieve the target gene according to experimental requirements, which can be used for different levels of induced expression requirements.

[0026] 4. The present invention improves the stability of the expression system of the host cell. The weak promoter in the invention can achieve stable low-level expression under galactose induction conditions. Therefore, during long-term culture or industrial fermentation, the growth state of the host Saccharomyces cerevisiae and the stability of the expression system are improved, providing a guarantee for long-term production applications.

[0027] In summary, the present invention provides a galactose-inducible weak promoter vector suitable for brewer's yeast and a construction method thereof. Through the weakening design of the promoter, the gene expression intensity is effectively controlled, the toxicity of heterologous proteins is reduced, and metabolic regulation is optimized. It is suitable for a variety of expression needs and experimental scenarios, and provides a technical means with both innovation and practicality for the optimization and application of yeast expression systems.

[0028] In order to more clearly illustrate the structural features and effects of the present invention, the present invention is described in detail below in conjunction with specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The diagrams are of the recombinant vector map of the present invention; (A) is a schematic diagram of the pAG416-GAL1mu1-ccdB vector map; (B) is a schematic diagram of the pAG416-GAL1mu2-ccdB vector map.

[0030] Figure 2The following are enzyme digestion identification diagrams of the recombinant vector of the present invention; (A) enzyme digestion identification diagram of pAG416-GAL1mu1-ccdB vector; (B) enzyme digestion identification diagram of pAG416-GAL1mu2-ccdB vector; wherein, lane 1: before enzyme digestion; lane 2: EcoR V enzyme digestion; lane 3: DL10000 marker.

[0031] Figure 3 The following are enzyme digestion identification diagrams of the recombinant vector of the present invention; (A) enzyme digestion identification diagram of pAG416-GAL1mu1-GFP vector; (B) enzyme digestion identification diagram of pAG416-GAL1mu2-GFP vector; Lane 1: before enzyme digestion; Lane 2: EcoR V / XhoI digestion; Lane 3: DL10000 marker.

[0032] Figure 4 The green fluorescent protein GFP expression level characterization promoter activity analysis diagram of the present invention; the figure uses the GAL1 promoter as a control to analyze the promoter intensity levels of GAL1mu1 and GAL1mu2. The asterisk (*) indicates a significant difference compared with the GAL1 promoter (Student's t-test: ** P<0.01). DETAILED DESCRIPTION

[0033] The technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.

[0034] See also Figures 1 to 4 As shown, the present invention provides a galactose-inducible weak promoter vector of Saccharomyces cerevisiae, wherein the galactose-inducible weak promoter vector of Saccharomyces cerevisiae is obtained by performing site-directed mutagenesis on the GAL1 promoter to obtain promoters GAL1mu1 and GAL1mu2; wherein, GAL1mu1 is obtained by inserting a negative regulatory sequence after the TATA element in the GAL1 promoter; GAL1mu2 is obtained by mutating the CAAT element and inserting the negative regulatory sequence; using pAG416-GAL1-ccdB as a template, the mutant sequence is integrated into the vector by site-directed mutagenesis and homologous recombination to obtain pAG416-GAL1mu1-ccdB and pAG416-GAL1mu2-ccdB, and the correctness of the vector is verified by EcoRV restriction digestion and Sanger sequencing.

[0035] The present invention provides galactose-inducible promoters GAL1mu1 and GAL1mu2 of Saccharomyces cerevisiae with reduced regulatory strength, and yeast expression vectors pAG416-GAL1mu1-ccdB and pAG416-GAL1mu2-ccdB in which the promoters are located, so that the target gene can be specifically expressed at a low level in Saccharomyces cerevisiae cells under galactose-inducing conditions, thereby providing an effective molecular tool for reducing the cytotoxicity of heterologous proteins to Saccharomyces cerevisiae and accurately regulating gene expression and metabolic pathways.

[0036] In this embodiment, the negative regulatory sequence inserted after the TATA element in the GAL1 promoter is TTGCCAGGGCAA, which is used to reduce the activity of the promoter to form a modified GAL1mu1 promoter, and the nucleotide sequence is defined as SEQ ID NO.1; when obtaining GAL1mu2, the CAAT element in the GAL1 promoter is mutated to TGCG, and the negative regulatory sequence is inserted downstream to weaken the promoter activity, forming a modified GAL1mu2 promoter. The negative regulatory sequence inserted downstream is TTGCCAGGGCAA, and the nucleotide sequence of the GAL1mu2 promoter is defined as SEQ ID NO.2.

[0037] In this embodiment, pAG416-GAL1-ccdB was used as a template, and the GAL1mu1 and GAL1mu2 sequences were replaced with the natural GAL1 sequence by overlap extension PCR and homologous recombination to construct two weak promoter expression vectors pAG416-GAL1mu1-ccdB and pAG416-GAL1mu2-ccdB. Among them, the weak promoter expression vector pAG416-GAL1mu1-ccdB is SEQ ID NO.3, and the weak promoter expression vector pAG416-GAL1mu2-ccdB is SEQ ID NO.4.

[0038] The present invention obtains two promoters GAL1mu1 and GAL1mu2 with weakened regulatory strength by mutating the natural sequence of the GAL1 promoter, and the promoter sequences have the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, or have nucleotide sequences complementary to the sequences shown in SEQ ID NO.1 and SEQ ID NO.2. GAL1mu1 and GAL1mu2 are integrated into pAG416-GAL1-ccdB by homologous recombination to replace the natural GAL1 sequence, and the final vectors pAG416-GAL1mu1-ccdB (SEQID NO.3) and pAG416-GAL1mu2-ccdB (SEQ ID NO.4) are obtained, which can be used to specifically low-express target genes in Saccharomyces cerevisiae. The GAL1mu1 and GAL1mu2 promoters were used to drive the expression of the green fluorescent protein reporter gene GFP and transform yeast BY4741. The results showed that compared with the GAL1 promoter, the expression level of GFP driven by the GAL1mu1 and GAL1mu2 promoters was significantly reduced, indicating the potential and value of GAL1mu1 and GAL1mu2 in inducing specific low-level expression of target genes.

[0039] In this example, when the vector is constructed and verified, the correctness of the mutant sequence is confirmed by EcoRV digestion and Sanger sequencing. When applying the verification, green fluorescent protein (GFP) is used as a reporter gene, integrated into the GAL1mu1 and GAL1mu2 promoter vectors, and transformed into Saccharomyces cerevisiae BY4741. The fluorescence intensity of GFP is detected after culturing in an induction medium containing galactose for 24 hours.

[0040] Among them, when verifying the expression of the green fluorescent protein (GFP) reporter gene, pFA6a-GFP(S65T)-kanMX6 was used as a template to construct reporter vectors pAG416-GAL1mu1-GFP and pAG416-GAL1mu2-GFP expressing GFP. When transformed into Saccharomyces cerevisiae BY4741, the recombinant vector was transformed into Saccharomyces cerevisiae BY4741 strain by chemical transformation. Fluorescence detection showed that compared with the natural GAL1 promoter, the GFP expression driven by the GAL1mu1 and GAL1mu2 promoters decreased to 35.8% and 17.8% of the natural promoter, respectively.

[0041] The embodiment of the present invention also provides a method for constructing a galactose-inducible weak promoter vector based on Saccharomyces cerevisiae. The materials prepared before implementing the construction method include: Saccharomyces cerevisiae BY4741 (MATahis3Δ1 leu2 met15Δura3-52) is a strain maintained in our laboratory.

[0042] YPD medium: peptone (20 g / L), yeast powder (10 g / L), glucose (20 g / L).

[0043] SD-Ura-nutrient deficiency medium: Yeast nitrogen base (YNB) 6.7 g / L, DOSuplement-Ura 0.78 g / L, glucose 20 g / L. If it is a solid medium, add 20 g / L agar powder.

[0044] SC-Ura- nutrient deficiency induction medium: yeast nitrogen base (YNB) 6.7 g / L, DOSuplement-Ura 0.78 g / L, galactose 20 g / L, raffinose 10 g / L.

[0045] The method for constructing a galactose-inducible weak promoter vector of Saccharomyces cerevisiae in this embodiment comprises the following steps: (1) GAL1 promoter sequence mutation: The GAL1 promoter is a strong promoter that is strictly induced by galactose. Mutating, inserting or deleting bases in the key regions of the target promoter is an effective way to change the strength of the promoter. The GAL1 promoter contains key TATA and CAAT regulatory elements. We inserted a transcriptional negative regulatory sequence (TTGCCAGGGCAA) after the TATA element to obtain the GAL1mu1 modified promoter (SEQ ID NO.1); by mutating the CAAT element to TGCG and inserting a transcriptional negative regulatory sequence (TTGCCAGGGCAA) downstream, we obtained the GAL1mu2 modified promoter (SEQ ID NO.2).

[0046] (2) Construction of pAG416-GAL1mu1-ccdB and pAG416-GAL1mu1-ccdB yeast expression vectors: Using pAG416-GAL1-ccdB as a template, GAL1mu1 and GAL1mu2 sequences were obtained by site-directed mutagenesis and overlap extension PCR amplification, and then the original GAL1 sequence in pAG416-GAL1-ccdB was replaced by homologous recombination to obtain the final vector pAG416-GAL1mu1-ccdB (SEQ ID NO. 3, Figure 1 A) and pAG416-GAL1mu2-ccdB (SEQ ID NO.4, Figure 1 B), EcoRV digestion and identification ( Figure 2 A, B), Sanger sequencing analysis was performed to verify the correctness of the sequence, and the obtained target vector can be used to induce specific low expression of the target gene in yeast.

[0047] The PCR amplification conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, 30 cycles; and finally extension at 72°C for 7 min.

[0048] (3) Construction of reporter gene GFP expression vector and transformation of Saccharomyces cerevisiae BY4741: The green fluorescent protein reporter gene GFP (SEQ ID NO. 5) was amplified by PCR using the pFA6a-GFP(S65T)-kanMX6 vector as a template and cloned into the vectors pAG416-GAL1mu1-ccdB and pAG416-GAL1mu2-ccdB using a commercial In-Fusion PCR Cloning Kit to obtain pAG416-GAL1mu1-GFP and pAG416-GAL1mu2-GFP. The residues were digested with EcoRV and XhoI for identification ( Figure 3 A, B), and Sanger sequencing analysis was performed to verify the correctness of the sequence. The recombinant vector was transformed using Saccharomyces cerevisiae BY4741 competent cells. The specific method was referred to the BY4741 Chemical Competent Cell product manual (CAT#: YC1060, Weidi), and the positive transformants were identified by colony PCR.

[0049] The PCR amplification conditions of the GFP gene were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 40 s, 28 cycles; and finally extension at 72°C for 7 min.

[0050] The amplification conditions of colony PCR were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 45 s, 34 cycles; and finally extension at 72°C for 7 min.

[0051] (4) Induced expression and GFP fluorescence detection of Saccharomyces cerevisiae transformants: The recombinant Saccharomyces cerevisiae strain to be tested was picked from the plate and cultured overnight in SD-Ura liquid selection medium at 30°C and 200rpm. When OD600 reached 1.0, the cells were collected by centrifugation at room temperature and 5000g for 5min. The bacterial solution was then resuspended in sterile water and washed and centrifuged twice, inoculated in Sc-Ura medium, and 2% galactose and 1% raffinose were added to induce expression. The initial OD600 concentration after inoculation was adjusted to 0.4, and the fluorescence intensity of GFP was detected after 24h of continuous culture.

[0052] 200 uL of bacterial suspension was added to a black ELISA plate, and the fluorescence intensity of GFP was measured using a multifunctional ELISA reader (VARIDSKAN Flash, Thermo Scientific). The parameters were: excitation wavelength 488 nm, absorption wavelength 510 nm. The intensity of the GAL1 promoter was used as a control, and the relative intensity of the GAL1mu1 and GAL1mu2 modified promoters was analyzed based on the fluorescence intensity. The results are shown in Figure 2. Figure 4 The results showed that the expression of GFP reporter gene driven by GAL1mu1 and GAL1mu2 promoters was significantly lower than that of GAL1 promoter. The promoter activity of GAL1mu1 decreased to 35.8%, while that of GAL1mu2 decreased to 17.8%, indicating that GAL1mu1 and GAL1mu2 can be effectively used in Saccharomyces cerevisiae metabolic engineering to specifically induce low-level expression of target genes.

[0053] The embodiment of the present invention also provides an application of a galactose-inducible weak promoter vector of Saccharomyces cerevisiae to achieve low-level induced expression of a target gene in Saccharomyces cerevisiae, comprising: The weak promoter vector was transformed into Saccharomyces cerevisiae cells; The yeast cells are cultured under galactose induction conditions to induce the expression of the target gene at a low level.

[0054] Among them, the target gene is green fluorescent protein (GFP), and the low-level expression of this gene is used to verify the transcriptional activity of the weak promoter vector.

[0055] The galactose-inducible weak promoter vector based on Saccharomyces cerevisiae is also used to reduce the toxicity of heterologous proteins to host cells when expressed in Saccharomyces cerevisiae to control the low-level expression of heterologous proteins. Wherein, the heterologous protein is a key enzyme in metabolic engineering, and the low-level expression achieves precise regulation of metabolic flux. The galactose-inducible weak promoter vector of Saccharomyces cerevisiae of the present invention and its construction method and application achieve low-level regulation of expression through the transformation of the GAL1 promoter, and are suitable for metabolic engineering applications of heterologous protein expression. This method has broad application prospects in reducing the cytotoxicity of heterologous proteins and precisely controlling gene expression.

[0056] In summary, the galactose-inducible weak promoter vector of Saccharomyces cerevisiae of the present invention and its construction method and application, by mutating the GAL1 promoter in Saccharomyces cerevisiae, constructing GAL1mu1 and GAL1mu2 weak promoters, significantly reducing the transcription intensity under galactose induction conditions, and realizing precise control of heterologous protein expression levels. Compared with the natural promoter, the expression intensity of GAL1mu1 and GAL1mu2 is 35.8% and 17.8% of the natural promoter, respectively, effectively realizing low-level expression of heterologous proteins, and is suitable for research and application scenarios with precise control requirements for expression amount. The weak promoter vector of the present invention reduces the toxic burden of heterologous proteins on Saccharomyces cerevisiae cells by reducing the expression intensity, effectively protects the health of host cells, and helps to improve the stability and production efficiency of heterologous protein expression. The low-level expression of the weak promoter vector of the present invention in Saccharomyces cerevisiae can be better applied to the expression of key enzymes in metabolic engineering. By appropriately expressing these key enzymes, metabolic flux can be precisely regulated, excessive accumulation of metabolites or waste of resources can be avoided, and overall metabolic efficiency can be optimized. The design of this vector provides an effective tool for metabolic network optimization and synthetic biology research.

[0057] The vector construction method of the present invention has simple steps and is suitable for the expression regulation of various genes. The vector skeleton pAG416-GAL1-ccdB and its mutant weak promoters GAL1mu1 and GAL1mu2 are easy to construct and operate in the laboratory, and are suitable for a variety of target genes, have high versatility, and can be widely used in basic biological research and industrial production. The present invention provides two promoters with different expression strengths, GAL1mu1 and GAL1mu2, corresponding to 35.8% and 17.8% of the expression strength of the natural promoter, respectively. Researchers can select suitable promoters to achieve the target gene according to experimental requirements, which can be used for different levels of induced expression requirements. The present invention improves the stability of the expression system of the host cell, and the weak promoter in the invention can achieve stable low-level expression under galactose induction conditions. Therefore, in long-term culture or industrial fermentation, the growth state of the host Saccharomyces cerevisiae and the stability of the expression system are improved, which provides a guarantee for long-term production applications.

[0058] In summary, the present invention provides a galactose-inducible weak promoter vector suitable for brewer's yeast and a construction method thereof. Through the weakening design of the promoter, the gene expression intensity is effectively controlled, the toxicity of heterologous proteins is reduced, and metabolic regulation is optimized. It is suitable for a variety of expression needs and experimental scenarios, and provides a technical means with both innovation and practicality for the optimization and application of yeast expression systems.

[0059] It should be noted that, in the present invention, SEQ ID NO: (1) GAL1Mu1 promoter sequence is: cggattagaagccgccgagcgggtgacagccctccgaaggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaacctggccccacaaaccttcaaatgaacgaatcaaattaacaaccataggatgataatgcgattagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatgTTGCCAGGGCAAcaaaaactgcataaccactttaactaatactttcaacattttcggtttgtattacttcttattcaaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggag。

[0060] Note: Among them, TTGCCAGGGCAA is the inserted transcriptional negative regulatory sequence.

[0061] SEQ ID NO: (2) The GAL1Mu2 promoter sequence is: cggattagaagccgccgagcgggtgacagccctccgaaggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactg ctccgaatgcgaaagattctacaatTTGCCAGGGCAAactagcttttatggttatgaagaggaaaaattggcagtaacctggccccacaaaccttcaaatgaacgaatcaaatt aacaaccataggatgataatgcgattagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatgcaaaaactgcata accactttaactaatactttcaacattttcggtttgtattacttcttattcaaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggag.

[0062] Among them, tgcg is the mutant base; TTGCCAGGGCAA is the inserted transcriptional negative regulatory sequence.

[0063] SEQ ID NO: (3) The pAG416-GAL1mul-ccdB vector sequence is:

[0064] SEQ ID NO: (4) The sequence of pAG416-GAL1mu2-ccdB vector is:

[0065] SEQ ID NO: (5) The GFP sequence is: .

[0066] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge scope of ordinary technicians in this field without departing from the purpose of the present invention.

Claims

1. A galactose-inducible weak promoter vector of Saccharomyces cerevisiae, characterized in that: The galactose-inducible weak promoter vector of Saccharomyces cerevisiae obtains promoters GAL1mu1 and GAL1mu2 by performing site-directed mutagenesis on the GAL1 promoter; wherein, GAL1mu1 is obtained by inserting a negative regulatory sequence after a TATA element in the GAL1 promoter; GAL1mu2 is obtained by mutating a CAAT element and inserting the negative regulatory sequence; using pAG416-GAL1-ccdB as a template, the mutant sequence is integrated into the vector by site-directed mutagenesis and homologous recombination to obtain pAG416-GAL1mu1-ccdB and pAG416-GAL1mu2-ccdB, and the correctness of the vector is verified by EcoRV restriction digestion and Sanger sequencing.

2. The galactose-inducible weak promoter vector of Saccharomyces cerevisiae according to claim 1, characterized in that: The negative regulatory sequence inserted after the TATA element in the GAL1 promoter is TTGCCAGGGCAA, which is used to reduce the activity of the promoter to form a modified GAL1mu1 promoter, and the nucleotide sequence is defined as SEQ ID NO.

1.

3. The galactose-inducible weak promoter vector of Saccharomyces cerevisiae according to claim 2, characterized in that: When GAL1mu2 was obtained, the CAAT element in the GAL1 promoter was mutated to TGCG, and a negative regulatory sequence was inserted downstream to weaken the promoter activity, thereby forming a modified GAL1mu2 promoter.

4. The galactose-inducible weak promoter vector of Saccharomyces cerevisiae according to claim 3, characterized in that: The negative regulatory sequence inserted downstream is TTGCCAGGGCAA, and the nucleotide sequence of the GAL1mu2 promoter is defined as SEQ ID NO.

2.

5. The galactose-inducible weak promoter vector of Saccharomyces cerevisiae according to claim 4, characterized in that: Using pAG416-GAL1-ccdB as a template, the GAL1mu1 and GAL1mu2 sequences replaced the natural GAL1 sequence respectively through overlap extension PCR and homologous recombination, and two weak promoter expression vectors pAG416-GAL1mu1-ccdB and pAG416-GAL1mu2-ccdB were constructed, among which the weak promoter expression vector pAG416-GAL1mu1-ccdB is SEQ ID NO.3, and the weak promoter expression vector pAG416-GAL1mu2-ccdB is SEQ ID NO.

4.

6. The galactose-inducible weak promoter vector of Saccharomyces cerevisiae according to claim 5, characterized in that: When the vector was constructed and verified, the correctness of the mutant sequence was confirmed by EcoRV digestion and Sanger sequencing. When applied, green fluorescent protein was used as a reporter gene, integrated into the GAL1mu1 and GAL1mu2 promoter vectors, and transformed into Saccharomyces cerevisiae BY4741. The fluorescence intensity of GFP was detected after culturing in an induction medium containing galactose for 24 hours. When the expression of the green fluorescent protein reporter gene was verified, pFA6a-GFP(S65T)-kanMX6 was used as a template to construct GFP-expressing reporter vectors pAG416-GAL1mu1-GFP and pAG416-GAL1mu2-GFP.

7. A method for constructing a galactose-inducible weak promoter vector of Saccharomyces cerevisiae according to any one of claims 1 to 6, characterized in that: Here are the steps: a) mutating the natural GAL1 promoter or inserting a negative regulatory element to construct the weak promoter GAL1mu1 or GAL1mu2; b) Using the vector backbone pAG416-GAL1-ccdB, the weak promoter GAL1mu1 or GAL1mu2 was integrated into the vector to construct the pAG416-GAL1mu1-ccdB or pAG416-GAL1mu2-ccdB weak promoter vector.

8. The method for constructing the galactose-inducible weak promoter vector of Saccharomyces cerevisiae according to claim 7, characterized in that: When constructing the weak promoter GAL1mu1 or GAL1mu2 in step a), the negative regulatory sequence TTGCCAGGGCAA is inserted downstream of the TATA element of the natural GAL1 promoter to construct the weak promoter GAL1mu1; the CAAT element in the GAL1 promoter is mutated to TGCG, and the negative regulatory sequence TTGCCAGGGCAA is inserted downstream to construct the weak promoter GAL1mu2.

9. The method for constructing a galactose-inducible weak promoter vector of Saccharomyces cerevisiae according to claim 7, characterized in that: The vector used in step b) is pAG416-GAL1-ccdB, and the GAL1mu1 or GAL1mu2 sequence is inserted into the vector by PCR amplification, restriction endonuclease ligation or homologous recombination.

10. A use of the galactose-inducible weak promoter vector of Saccharomyces cerevisiae as claimed in any one of claims 1 to 6 for achieving low-level induced expression of a target gene in Saccharomyces cerevisiae, characterized in that: include: The weak promoter vector was transformed into Saccharomyces cerevisiae cells; Cultivating the yeast cells under galactose induction conditions to induce expression of the target gene at a low level; Among them, the target gene is green fluorescent protein, and the low-level expression of this gene is used to verify the transcriptional activity of the weak promoter vector.

Images