Primer group for detecting seven pet enteropathogenic bacteria and application thereof

Abstract

The invention discloses a primer group for simultaneously detecting seven pet enteropathogenic bacteria and application thereof, the primer group comprises primer sequences as shown in SEQ ID NO: 1-14, and the seven pet enteropathogenic bacteria are hemorrhagic escherichia coli, salmonella enteritidis, campylobacter jejuni, clostridium difficile, clostridium perfringens, yersinia enteritidis and staphylococcus aureus. Extracting DNA (Deoxyribonucleic Acid) of a sample to be detected by using the excrement sample nucleic acid extraction kit; taking the sample DNA as a template, carrying out multiple PCR reaction by using the primer group to obtain an amplification curve, and if the Ct value of the amplification curve of the sample to be detected is 0 amp, detecting the Ct value of the sample to be detected; lt; c < tamp >; lt; 30, and the Ct value of the IPC is amp; lt; and 40, determining that the interpretation result is positive, and indicating that the sample to be detected contains the one or more enteropathogenic bacteria. According to the invention, a primer sequence with high sensitivity and specificity is adopted, so that the quality of a detection result is ensured; the detection method is simple to operate, time-saving and labor-saving; the detection flux is high, and the reagent consumable cost is low.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a multiplex qPCR primer set for simultaneously detecting seven kinds of pet intestinal pathogens and an application thereof. Background Art

[0002] Intestinal infection in pets is a common and serious problem in the field of pet health. The main source of infection is various intestinal pathogens, which can enter the pet's intestines through contaminated food, water, living environment, etc. Intestinal infection can have a variety of effects on pet health, such as diarrhea, vomiting, loss of appetite and weight loss. If severe intestinal infection is not treated in time, it may also cause systemic infection, damage the pet's internal organs, and pose a serious threat to its life safety. Especially for puppies, kittens and pets with low immunity, intestinal infection may develop rapidly, causing great distress and worry to pet owners. Mixed infection with multiple intestinal pathogens is not uncommon in clinical practice, which further increases the complexity of diagnosis and treatment. This method has the advantages of simultaneous detection of multiple pathogens, high accuracy, rapidity and simple operation, which helps to identify pathogens in the early stages of disease infection.

[0003] Hemorrhagic Escherichia coli is a highly pathogenic intestinal bacterium. It can produce Shiga-like toxins, which can cause serious damage to the intestinal mucosa of pets, causing intestinal bleeding and inflammation. After pets are infected, they often show severe diarrhea, and the feces may contain blood and mucus, which may be accompanied by abdominal pain. In some severe cases, it may cause systemic infection, affecting the function of important organs such as the kidneys, posing a serious threat to the health of pets.

[0004] Salmonella enteritidis is one of the more common pathogens in pet intestinal infections. It can invade the intestinal epithelial cells of pets and induce inflammatory responses. Infected pets usually experience symptoms such as fever, vomiting, and diarrhea, and the diarrhea is mostly watery or mucous. Long-term or severe infection may cause dehydration and electrolyte disorders in pets, especially young pets. Due to their weak resistance, they may suffer from growth retardation and other problems after being infected with Salmonella enteritidis.

[0005] Campylobacter jejuni mainly parasitizes the intestines of pets, especially the jejunum. It can colonize and reproduce in the intestines through its special spiral structure and motility. The bacteria can cause damage and inflammation of the intestinal mucosa of pets, leading to abdominal pain, diarrhea, fever and other symptoms. Diarrhea is often characterized by watery stools or mucus and blood in the stools, and Campylobacter jejuni infection may cause chronic intestinal diseases in pets, repeatedly affecting the intestinal health of pets.

[0006] Clostridium difficile is an anaerobic Gram-positive bacillus. It can produce a variety of toxins that can disrupt the normal balance of intestinal flora in pets and cause inflammation and necrosis of the intestinal mucosa. After pets are infected with Clostridium difficile, the main symptom is diarrhea, which varies in severity from mild diarrhea to severe pseudomembranous enteritis. Clostridium difficile infection has a high recurrence rate in pets, which makes it very difficult for pets to recover health.

[0007] Clostridium perfringens is an anaerobic bacterium that is widely present in the environment. It can multiply rapidly in the pet's intestines and produce a variety of toxins, such as alpha toxins. These toxins can cause edema, bleeding and necrosis of the pet's intestinal mucosa, causing severe abdominal pain, diarrhea and bloating. Clostridium perfringens infection often occurs acutely, and in severe cases can cause shock, causing great harm to the life safety of pets, especially when the pet's intestinal mucosal barrier is damaged, which makes it more susceptible to infection.

[0008] Yersinia enteritidis is invasive and can invade the pet's intestinal lymphoid tissue, causing local inflammation and immune response. It can cause pets to have diarrhea, abdominal pain, fever and other symptoms, and some cases may also be accompanied by vomiting. Yersinia enteritidis infection may affect the intestinal absorption function of pets, and long-term infection may cause malnutrition in pets. In addition, the bacteria may enter the blood through the intestines and cause systemic infection.

[0009] Staphylococcus aureus is a common pathogen that also accounts for a certain proportion of pet intestinal infections. It can produce a variety of toxins and enzymes that damage the intestinal mucosal barrier. Pets may experience vomiting, diarrhea, fever and other symptoms after infection, and the diarrhea may be watery or mucous. In addition, Staphylococcus aureus infection may also cause systemic diseases such as skin infections and sepsis, especially when the pet's immunity is low, the harm is more serious.

[0010] Traditional methods for detecting intestinal pathogens in pets mainly rely on microbial culture technology. Although this method can accurately identify bacterial species, it has obvious shortcomings such as complex operation, cumbersome steps, and long culture cycle. For sick pets that are in urgent need of diagnosis and treatment, the best time for treatment may be delayed. Secondly, the culture conditions of some intestinal pathogens are relatively harsh, requiring special culture media and environmental conditions, which are prone to false negative results, resulting in some pathogens that cannot be detected. Detection technologies based on antigen-antibody reactions, such as enzyme-linked immunosorbent assay (ELISA), have improved the detection speed to a certain extent. However, these methods have the problem of cross-reaction, that is, antibodies may react with other antigens of similar structures, thereby affecting the specificity of the detection. Moreover, the quality of detection kits produced by different manufacturers varies, and the sensitivity for detecting some low-concentration pathogens is not ideal. There are also some molecular biological detection methods, such as polymerase chain reaction (PCR) technology. For example, patent CN117604128A discloses a multiplex PCR detection primer for five common intestinal pathogens and its application, which can detect five intestinal pathogens at the same time, but requires gel electrophoresis. The operation steps are complicated based on multiplex PCR combined with gel electrophoresis, and there are obvious limitations in the actual application process. In addition, some universal primers are not specific enough and are prone to nonspecific amplification, which affects the accuracy of the test results.

[0011] Therefore, it is necessary to improve the existing intestinal pathogen detection method, which should have the characteristics of high sensitivity, strong specificity, and fast speed, as well as the advantages of low cost and convenient operation. For the detection of pet intestinal pathogens, the present invention adopts a dye method multiplex qPCR detection scheme, which can detect 7 kinds of pet intestinal pathogens at the same time. This method has the advantages of simple operation, low cost and high efficiency. Summary of the invention

[0012] The purpose of the present invention is to solve the problems of difficulty in comprehensive screening, low detection efficiency and high detection cost in existing pet intestinal pathogenic bacteria detection technology, and to provide a new pet intestinal pathogenic bacteria detection primer set and method to improve the problems of low detection efficiency and high detection cost in related detection technologies.

[0013] In order to achieve the above object, the present invention provides a multiplex PCR primer set for simultaneously detecting 7 intestinal pathogenic bacteria genes, wherein the primer set includes the primers shown in Table 2 below; the 7 intestinal pathogenic bacteria include Enterohemorrhagic Escherichia coli, Salmonella enteritidis

[0014] (Salmonella Enteritidis), Campylobacter jejuni, Clostridioides difficile, Clostridium perfringens, Yersinia enterocolitica, Staphylococcus aureus.

[0015] The present invention provides a primer set for detecting intestinal pathogenic bacteria by multiplex PCR. The target genes detected by the primer set include: the ecf1 gene of hemorrhagic Escherichia coli, the invA gene of Salmonella enteritidis, the hipO gene of Campylobacter jejuni, the tpi gene of Clostridium difficile, the cpa gene of Clostridium perfringens, the tox gene of Yersinia enteritidis, and the nuc gene of Staphylococcus aureus.

[0016] The primer set includes primer sequences shown as SEQ.ID.NO.1-14.

[0017] The primer set for detecting intestinal pathogens by multiplex PCR is used in preparing a reagent for detecting intestinal pathogens of pets.

[0018] A kit for simultaneously detecting seven kinds of pet intestinal pathogens, the kit comprising a primer set as shown in SEQ.ID.NO.1-14.

[0019] It also includes a nucleic acid extraction kit for stool samples to be tested, 2×qPCR 5G Premix, internal control primers and corresponding templates.

[0020] The internal control primers are:

[0021] IPC-F: GATACCGCCGGCGCGACGCCGTT, as shown in SEQ ID NO:15;

[0022] IPC-R: ACAATGTTGCTGTTGGTCGT, as shown in SEQ ID NO:16.

[0023] Template sequence:

[0024] GATACCGCCGGCGCGACGCCGTTTTCCATCAAGCTGCAGAACTGCCCCGAA

[0025] TCGCTGGGCAATGGCGTGAAGCTGTACTTCGAGCCCGGTCCGACCACCGA

[0026] CTACAGCACCAGGGACCTGACCGCCTACAAGCTGGCCTACACCGCCAACAGCACGACCAACAGCAACATTGT, as shown in SEQ ID NO:17.

[0027] In the reaction system, 2 μL of the internal control primer mixture (the upstream and downstream primers are mixed, and the final concentration is 0.5 μmol / L. The final concentration refers to the final concentration of the primer in the reaction system).

[0028] The present invention provides a method for detecting pathogenic bacteria in pet intestines, and the method includes the following steps:

[0029] (1) Use a fecal sample nucleic acid extraction kit to extract the DNA of the sample to be tested;

[0030] (2) Using the DNA as a template and using the primer set or kit of the present invention, perform a multiplex PCR reaction. 7 primers are mixed in equal volume (the initial concentration of a single primer is 50 μmol / L) to prepare a primer mixture solution. The reaction system includes 10 μL of 2×qPCR 5G Premix, 2 μL of the above-mentioned 7 intestinal pathogenic bacteria primer mixture solution, and 8 μL of the DNA template of the sample to be detected.

[0031] (3) The reaction amplification conditions are pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing / extension (collecting fluorescence signals) at 60°C for 30 s, and reacting for 45 cycles to obtain an amplification curve after multiplex PCR amplification;

[0032] If the Ct value of the internal positive control (IPC, Internal Positive Control) > 40, re-detection is required;

[0033] If the Ct value of the amplification curve of the sample to be tested, if the Ct value > 35 or NoCt, and the Ct value of the IPC < 40, the test result is judged as negative, indicating that there is no above-mentioned intestinal pathogenic bacteria in the sample to be tested;

[0034] If the Ct value of the amplification curve of the sample to be tested is: 0 < Ct < 35, and the Ct value of the IPC < 40, the test result is judged as positive, indicating that the sample to be tested contains one or more of the above-mentioned intestinal pathogenic bacteria, and the specific pathogenic bacteria species in the sample are detected for the second time;

[0035] (4) Using the DNA of the sample to be tested with a positive result in the first detection as a template and using the primer of the present invention, perform a single qPCR reaction according to the above reaction system and reaction amplification conditions to obtain an amplification curve after qPCR amplification;

[0036] If the Ct value of the internal positive control (IPC) > 40, re-detection is required;

[0037] If the Ct value of the amplification curve of the sample to be tested > 35 or NoCt, and the Ct value of the IPC < 40, the test result is judged as negative.

[0038] If the Ct value of the amplification curve of primer pair A1 / A2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains hemorrhagic Escherichia coli;

[0039] If the Ct value of the amplification curve of primer pair B1 / B2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Salmonella enteritidis;

[0040] If the Ct value of the amplification curve of primer pair C1 / C2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Campylobacter jejuni;

[0041] If the Ct value of the amplification curve of primer pair D1 / D2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Clostridium difficile;

[0042] If the Ct value of the amplification curve of primer pair E1 / E2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Clostridium perfringens;

[0043] If the Ct value of the amplification curve of primer pair F1 / F2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Staphylococcus aureus;

[0044] If the Ct value of the amplification curve of primer pair G1 / G2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Yersinia enterocolitica;

[0045] This method uses a fecal sample nucleic acid extraction kit to extract nucleic acid from fecal samples, and the PCR inhibitors in the obtained DNA samples have been basically removed; the primer sets provided by this method have been carefully designed and tested many times, there will be no cross-amplification reaction between primer sets, and there is no dimer formation between primers. Positive and negative controls are added during detection to ensure the credibility of the detection results.

[0046] The present invention has established a detection method for simultaneously detecting 7 kinds of pet intestinal pathogenic bacteria. This method can solve the deficiencies of other detection methods. Compared with the prior art, the present invention has the following advantages and effects:

[0047] (1) Multiple detections cover comprehensively

[0048] The detection method established by the present invention can simultaneously screen 7 kinds of pet intestinal pathogens in one PCR reaction, involving 7 kinds of bacilli and cocci, including hemorrhagic Escherichia coli, Salmonella enteritidis, Campylobacter jejuni, Clostridium difficile, Clostridium perfringens, Yersinia enteritidis, and Staphylococcus aureus. At present, there are few reports on the detection of pet intestinal pathogens, and a few reports only detect one of the pathogens. The method comprehensively covers pathogens with diarrhea, vomiting, and abdominal pain as the main clinical symptoms, with large detection throughput and short time.

[0049] There is no need for bacterial culture and the test results can be obtained quickly, saving time, manpower and material costs.

[0050] (2) High accuracy

[0051] This kit has added an internal control primer IPC, which does not react during each test, effectively preventing false negative results.

[0052] (3) High sensitivity

[0053] The detection method established by the present invention can realize the simultaneous screening of nucleic acids of seven intestinal pathogens, and the detection sensitivity of each target pathogen in each reaction system is 100 copies / reaction.

[0054] (4) Lower cost

[0055] The multiplex PCR detection method established by the present invention reduces the manpower cost and time cost in terms of operability. Single-plex detection requires 7 times of manual work and 7 times of operation time; at the same time, the increase in the number of detection types means an increase in primer sets. The more primer sets there are in the multiplex PCR amplification system, the more difficult the primer design is. In order to ensure the credibility of the test results (false positives), the primers are optimized multiple times, and the amount of each primer and component added to the PCR reaction system and the reaction annealing temperature are optimized to ensure the amplification efficiency of each primer set (close to 100%). The use of the multiplex PCR method of the present invention only requires 2 times of manual work and 2 times of operation time; at the same time, the multiplex detection method saves the reagent consumption of repeated detection of the same sample, and can save up to 60% of the reagent cost.

[0056] (5) To prevent false negative and false positive results, the positive internal control primers and corresponding templates added to the system can effectively indicate false negative test results; the no-template negative control set in the system can effectively indicate false positive test results.

[0057] The present invention provides a complete solution for the rapid detection of seven common intestinal pathogens of pets, and can realize the rapid detection of the sources of intestinal pathogens of pets, saving precious time for handling the epidemic as soon as possible and establishing clinical treatment.

[0058] Beneficial effects:

[0059] The present invention provides a primer set for simultaneously detecting 7 intestinal pathogens, and establishes a multiplex PCR detection method based on a real-time fluorescence quantitative PCR platform. The present invention adopts a highly sensitive and specific primer sequence to ensure the quality of the test results; the detection method is simple to operate, time-saving and labor-saving; the detection throughput is high, and the cost of reagents and consumables is low; fecal samples can be directly tested, and compared with traditional detection methods, the test results can be obtained as quickly as 4 hours, greatly shortening the detection time limit; the requirements for the detection platform and detection personnel are low, and it can be widely promoted in pet hospitals. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 These are the experimental results of the present invention for detecting 7 intestinal pathogens, wherein 1-7 are hemorrhagic Escherichia coli, Salmonella enteritidis, Campylobacter jejuni, Clostridium difficile, Clostridium perfringens, Yersinia enteritidis, and Staphylococcus aureus, respectively; 8 is a positive internal control, and 9 is a negative control.

[0061] Figure 2 1 is the specificity detection result of the primers of the present invention, wherein 1 is a mixed sample containing target pathogenic bacteria, 2-6 are Pseudomonas aeruginosa, Vibrio alginolyticus, Bacillus cereus, Escherichia coli, and Vibrio cholerae, respectively, 7 is a mixed sample of five unrelated pathogens, 8 is a positive internal control, and 9 is a negative control.

[0062] Figure 3 is the result of the primer sensitivity experiment of the present invention, wherein 1-5 are mixed templates of 7 pathogenic bacteria with different concentrations (10 6 Copy / Reaction, 10 5 Copy / Reaction, 10 4 Copy / Reaction, 10 3 copies / reaction, 100 copies / reaction, 10 copies / reaction), and 6 was a negative control.

[0063] Figure 4 It is the real sample detection result of the present invention, wherein 1 is hemorrhagic Escherichia coli, 2 is Yersinia enteritidis, 3 is the positive internal control, 4-8 are divided into Salmonella enteritidis, Campylobacter jejuni, Clostridium difficile, Clostridium perfringens, Staphylococcus aureus, and 9 is the negative control. DETAILED DESCRIPTION

[0064] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with the embodiments, but it should not be understood as limiting the scope of protection of the present invention. Some non-essential improvements and adjustments made by those skilled in the art based on the above invention content all belong to the scope of protection of the present invention.

[0065] The specific implementation of the present invention is described in detail below. It should be understood that the specific implementation described here is only used to illustrate and explain the present invention, and is not used to limit the present invention. The following steps are included:

[0066] 1. DNA extraction of samples to be tested

[0067] Pet feces contain intestinal pathogens. This test method obtains DNA from pet feces samples. DNA extraction uses a commercial feces sample nucleic acid extraction kit and is performed according to the kit instructions. The extracted DNA of the sample to be tested can be placed in a 1.5mL centrifuge tube and stored at 4℃ for later use.

[0068] 2. Primer design and synthesis

[0069] The present invention provides a primer set for detecting intestinal pathogenic bacteria by multiplex PCR, wherein the primer set includes primers for detecting genes shown in Table 1; the intestinal pathogenic bacteria include hemorrhagic Escherichia coli, Salmonella enteritidis, Campylobacter jejuni, Clostridium difficile, Clostridium perfringens, Yersinia enteritidis, and Staphylococcus aureus.

[0070] With reference to the conserved regions of the sequences of the ecf1 gene of Escherichia coli, the invA gene of Salmonella enteritidis, the hipO gene of Campylobacter jejuni, the tpi gene of Clostridium difficile, the cpa gene of Clostridium perfringens, the tox gene of Yersinia enteritidis, and the nuc gene of Staphylococcus aureus published in GenBank, the specific primers were designed by Primer Premier 6 software and the primers were cloned and cloned by

[0071] BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and Primer-LAST

[0072] (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) was used to conduct preliminary verification of the designed primers. The primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. to meet the requirements of simultaneous detection of nucleic acids of seven pathogens in a single reaction, that is, primers for multiple PCR reactions to amplify multiple target genes. This method compares the target genes of different isolates of the target pathogens and selects conservative regions for primer design; the seven designed primer sets are used for dimer analysis and amplicon analysis to ensure that there is no cross-amplification between different primer sets to avoid false positive test results.

[0073] Table 1 Target genes for multiplex PCR detection of 17 enteric pathogens

[0074] Target pathogens Detection of target genes Hemorrhagic Escherichia coli ecf1 Salmonella Enteritidis inv Campylobacter jejuni hipO Clostridium difficile tpi Clostridium perfringens cpa Yersinia enteritidis fox Staphylococcus aureus nuc

[0075] Table 2 Primers for multiplex PCR reaction of 7 enteropathogenic bacteria

[0076]

[0077]

[0078] 3. Multiplex PCR reaction

[0079] Mix 7 primers in equal volume (the initial concentration of each primer is 50 μmol / L) to prepare a primer mixture solution. The reaction system is prepared as follows: the reaction system includes 10 μL of 2×qPCR 5G Premix, 2 μL of the above-mentioned 7 enteropathogenic bacteria primer mixture solution, and 8 μL of the DNA template of the sample to be detected.

[0080] The amplification conditions of the multiplex PCR reaction include the following steps: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing / extension (collecting fluorescence signals) at 60°C for 30 s, and reacting for 45 cycles to obtain the amplification curve after multiplex PCR amplification.

[0081] 4. Judgment of detection results

[0082] In the present invention, a method for judging the results of a detection method for detecting enteropathogenic bacteria by multiplex PCR is involved:

[0083] (1) Using the total DNA as a template and using the primer set of the present invention, perform a multiplex PCR reaction to obtain an amplification curve after multiplex PCR amplification;

[0084] If the Ct value of the no-template negative control (No Template Control, NTC) < 30, re-detection is required;

[0085] If the Ct value of the amplification curve of the sample to be detected, if the Ct value > 38 or NoCt, and the Ct value of the NTC > 30, the judgment result is negative, indicating that there are no above-mentioned enteropathogenic bacteria in the sample to be detected;

[0086] If the Ct value of the amplification curve of the sample to be detected is: 0 < Ct < 30, and the Ct value of the NTC > 30, the judgment result is positive, indicating that the sample to be detected contains one or more of the above-mentioned enteropathogenic bacteria, and it is necessary to re-detect the specific types of pathogenic bacteria;

[0087] (2) Using the DNA of the sample to be detected with a positive first detection result as a template and using the primers of the present invention, perform a single qPCR reaction to obtain an amplification curve after qPCR amplification, as Figure 1 ; the reaction system includes 10 μL of 2×qPCR 5G Premix, 2 μL of the single pathogenic bacteria primer mixture (upstream and downstream primers are mixed, final concentration 0.5 μmol / L), and 8 μL of the DNA template of the sample to be detected;

[0088] The amplification conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing / extension (fluorescence signal collection) at 60°C for 30 s, and 45 cycles of reaction to obtain the amplification curve after qPCR amplification.

[0089] If the Ct value of the internal positive control (IPC, Internal Positive Control) > 40, re-detection is required;

[0090] If the Ct value of the amplification curve of the sample to be tested > 35 or NoCt, and the Ct value of the IPC < 40, the test result is judged as negative.

[0091] If the Ct value of the amplification curve of primer pair A1 / A2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Escherichia coli O157:H7.

[0092] If the Ct value of the amplification curve of primer pair B1 / B2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Salmonella enteritidis.

[0093] If the Ct value of the amplification curve of primer pair C1 / C2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Campylobacter jejuni.

[0094] If the Ct value of the amplification curve of primer pair D1 / D2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Clostridium difficile.

[0095] If the Ct value of the amplification curve of primer pair E1 / E2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Clostridium perfringens.

[0096] If the Ct value of the amplification curve of primer pair F1 / F2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Staphylococcus aureus.

[0097] If the Ct value of the amplification curve of primer pair G1 / G2 is: 0 < Ct < 35, and the Ct value of the IPC < 40, it indicates that the sample to be tested contains Yersinia enterocolitica.

[0098] The multiplex PCR detection method of the present invention is not used for diagnosis. The test result has no one-to-one correspondence with the occurrence of the disease and does not belong to the diagnosis result. However, the test result can be used as intermediate information for clinicians' reference.

[0099] Example 1

[0100] Primer design and synthesis

[0101] With reference to the conserved regions of the gene sequences of enteropathogenic bacteria Escherichia coli, Salmonella enteritidis, Campylobacter jejuni, Clostridium difficile, Clostridium perfringens, Yersinia enteritidis, and Staphylococcus aureus published in GenBank, the specific primers were designed using Primer Premier 6 software and the BLAST

[0102] (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and Primer-LAST

[0103] (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) The designed primers were preliminarily verified and optimized after design. The primer sequences are shown in Table 2.

[0104] Example 2

[0105] Optimization of multiplex PCR reaction conditions and establishment of methods for intestinal pathogens

[0106] (1) Optimization of system annealing temperature: Three annealing temperatures were set at 58°C, 60°C, and 62°C. The results showed that the system amplification effect was best when the annealing temperature was 60°C.

[0107] (2) Optimization of multiplex PCR amplification system: The addition amount and cycle number of each component of the real-time fluorescence quantitative PCR amplification system were optimized. The results showed that the optimal PCR amplification system was as follows: the reaction system included 10 μL of 2×qPCR 5G Premix, 2 μL of primer mixture solution (7 primers were first mixed in equal volumes (single primer concentration was 50 μmol / L), and 2 μL of the mixed primers were added to each reaction system) and 8 μL of the sample DNA template to be tested. Real-time fluorescence quantitative amplification conditions: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 60°C annealing for 30 s, 72°C extension for 15 s, and 45 cycles of amplification.

[0108] Example 3

[0109] Specificity test

[0110] The sample used for the detection of the present invention is a pet feces sample. The total nucleic acid in the feces sample is extracted by a kit (the kit used in this embodiment is a "centrifugal column nucleic acid extraction kit", item number TL-NEK01, purchased from Tianshai (Shanghai) Technology Co., Ltd.), which may contain a variety of microbial nucleic acids in feces. In order to detect the specificity of the primers in the present invention, five non-target strains are selected as simulated interference samples, Pseudomonas aeruginosa, Vibrio alginolyticus, Bacillus cereus, Escherichia coli, and Vibrio cholerae. According to the amplification conditions optimized by multiple PCR, the 7 pathogenic bacteria primers obtained above are used to detect Pseudomonas aeruginosa, Vibrio alginolyticus, Bacillus cereus, Escherichia coli, and Vibrio cholerae. Five unrelated pathogen mixed samples and samples containing target pathogens are detected, and the results show that only the sample containing the target pathogen has a typical S-type amplification curve, and no amplification curve appears in the others, indicating that the established detection method has good specificity, such as Figure 2 .

[0111] Example 4

[0112] Sensitivity test

[0113] The amplicons covering all 7 target genes and the quality control sequences in the IPC were cloned into the plasmid vector to obtain a standard plasmid. As a further limitation based on Example 2, the kit of this example includes the composition shown in Table 2. The kit of the above formula is used to detect high concentration (10 6 The results showed that the primer combination can effectively detect the target gene concentration as low as 100 copies / reaction. Figure 3 .

[0114] Example 5

[0115] Real sample testing

[0116] A fecal sample of a sick cat collected from a pet hospital was used. The sick cat had persistent soft stool and bloody stool for 2 months. During this period, intestinal parasites and intestinal infectious viruses were checked, but no pathogens were detected. Then, intestinal pathogen detection was considered. After receiving the sample, the sample was immediately processed as described in Example 2. The test results on the same day showed that it was infected with hemorrhagic Escherichia coli and Yersinia enteritidis. Figure 4 The PCR products were sent to Suzhou Genewise for sequencing, and the sequencing results were consistent with the qPCR test results.

[0117] As fully illustrated by the above embodiments, the present invention is a multiplex qPCR detection method with high sensitivity, strong specificity and simple operation. It can efficiently detect hemorrhagic Escherichia coli, Salmonella enteritidis, Campylobacter jejuni, Clostridium difficile, Clostridium perfringens, Yersinia enteritidis and Staphylococcus aureus in pet fecal samples. It has certain development, utilization and promotion value, and can provide technical support for the clinical diagnosis of pet intestinal pathogens.

[0118] The above content is a further detailed description of the present invention in combination with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the scope of protection determined by the claims submitted for the present invention.

Claims

1. A primer set for simultaneously detecting 7 pet intestinal pathogens, characterized in that: The primer set includes primer sequences shown in SEQ ID NO: 1 to 14, and the seven pet intestinal pathogenic bacteria include Escherichia coli O157:H7, Salmonella enteritidis, Campylobacter jejuni, Clostridium difficile, Clostridium perfringens, Yersinia enterocolitica, and Staphylococcus aureus.

2. Use of the primer set according to claim 1 in the preparation of a reagent for simultaneously detecting seven pet intestinal pathogenic bacteria.

3. A kit for simultaneously detecting 7 kinds of pet intestinal pathogens, characterized in that: The kit contains the primer set shown in SEQ ID NO: 1 to 14.

4. The kit for simultaneously detecting seven kinds of pet intestinal pathogens according to claim 3, characterized in that: It also includes a reagent for extracting nucleic acid from a sample to be tested and 2×qPCR 5G Premix.

5. The kit for simultaneously detecting seven kinds of pet intestinal pathogens according to claim 3, characterized in that: It also includes an internal control primer and a corresponding template.

6. The kit for simultaneously detecting seven kinds of pet intestinal pathogens according to claim 5, characterized in that: The internal control primer is: IPC-F: GATACCGCCGGCGCGACGCCGTT, as shown in SEQ ID NO: 15; IPC-R: ACAATGTTGCTGTTGGTCGT as shown in SEQ ID NO:

16.

7. A method for detecting intestinal pathogens in pets for non-diagnostic purposes, characterized in that: The method includes the following steps: (1) Extract the DNA of the sample to be tested; (2) Using the sample DNA as a template and using the primer set according to claim 1 or the kit according to claim 3, perform a multiplex PCR reaction to obtain an amplification curve after multiplex PCR amplification. The pet intestinal pathogenic bacteria to be detected are Escherichia coli O157:H7, Salmonella enteritidis, Campylobacter jejuni, Clostridium difficile, Clostridium perfringens, Yersinia enterocolitica, and Staphylococcus aureus.

8. The method for detecting intestinal pathogenic bacteria of pets for non-diagnostic purposes according to claim 7, characterized in that: The reaction system includes 10 μL of 2×qPCR 5G Premix, 2 μL of a mixed solution of upstream and downstream primers for seven intestinal pathogenic bacteria, and 8 μL of a DNA template of the sample to be detected.

9. The method for detecting intestinal pathogenic bacteria of pets for non-diagnostic purposes according to claim 7, characterized in that: The reaction amplification conditions are pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing / extension at 60°C for 30 s, and 45 cycles of reaction.

10. The method for detecting intestinal pathogenic bacteria of pets for non-diagnostic purposes according to claim 7, characterized in that: Obtain an amplification curve after multiplex PCR amplification, and judge whether there are intestinal pathogenic bacteria according to the Ct value of the amplification curve. If the Ct value of the amplification curve of the sample to be tested > 35 or NoCt, and the Ct value of IPC < 40, the interpretation result is negative, indicating that there are no above-mentioned intestinal pathogenic bacteria in the sample to be tested; If the Ct value of the amplification curve of the sample to be tested is: 0 < Ct < 35, and the Ct value of IPC < 40, the interpretation result is positive, indicating that the sample to be tested contains one or more of the above-mentioned intestinal pathogenic bacteria.

Images