Methods of treating cancer by inhibition of SETD2

Abstract

The present disclosure provides methods and pharmaceutical compositions for treating or slowing the progression of cancer, i.e. Pancreatic cancer or esophageal cancer, by administering to a human subject in need thereof a therapeutically effective amount of an inhibitor of histone methyltransferase SETD2.

Description

[0001] This application is a divisional application with an application date of August 14, 2018, application number 201880059329.1, and invention name “Method for treating cancer by inhibiting SETD2”.

[0002] Reference to electronically submitted sequence listing

[0003] The contents of the electronically submitted Sequence Listing in the ASCII text file (named 3562.012000_Sequence_listing_ST25.txt; size: 1,142 bytes; and creation date: August 14, 2017) filed with this application are incorporated herein by reference in their entirety. Technical Field

[0004] The present disclosure relates generally to the field of epigenetic-based cancer therapies. More specifically, the present disclosure relates to methods and pharmaceutical compositions for treating cancer by inhibiting human histone methyltransferase SETD2. Background Art

[0005] The selective addition of methyl groups to specific amino acid sites of histones is controlled by the action of a family of enzymes known as histone methyltransferases (HMTs). The expression level of a specific gene is affected by the presence or absence of one or more methyl groups at the associated histone sites. The specific action of the methyl group at a specific histone site persists until the methyl group is removed by a histone demethylase, or until the modified histone is replaced by nucleosome turnover. In a similar manner, other enzyme classes can modify DNA and histones with other chemical species, and other enzymes can remove these species to provide control over gene expression.

[0006] SETD2 is a human histone methyltransferase that is located at cytogenetic band p21.31 (3p21.31) of chromosome 3. The acronym "SETD2" stands for suppressor of coloration ( SSETD2 is a protein that contains a variegation uppressor, enhancer of zeste, and trithorax domains. The SETD2 protein contains three conserved functional domains: (1) a tripartite AWS-SET-PostSET domain; (2) a WW domain; and (3) a Set2-Rbp1 interaction ("SRI") domain. These three functional domains define the biological functions of SETD2. See, Li, J. et al., Oncotarget [Cancer Target] 7:50719-50734 (2016). SETD2 is considered to be a single human gene responsible for trimethylation (H3K36me3) of lysine 36 (Lys-36) of histone H3, using dimethylated Lys-36 (H3K36me2) as a substrate. Edmunds, JW et al., The EMBO Journal [European Molecular Biology Association Journal] 27:406-420 (2008).

[0007] Notably, human SETD2 has been shown to have tumor suppressor function. Li, J. et al., Oncotarget 7:50719-50734 (2016). For example, inactivation of human SETD2 has been reported in renal cell carcinoma (RCC). Larkin, J., et al., Nature Reviews 9:147-155 (2012). Moreover, it has been reported that the expression level of SETD2 in breast cancer samples is significantly lower than that in adjacent non-cancerous tissue (ANCT) samples. Newbold, RF and Mokbel, K., Anticancer Research 30:3309-3311 (2010). In addition, biallelic mutations and loss-of-function point mutations in SETD2 have been reported in patients with acute leukemia. Zhu, X. et al., Nature Genetics 46:287-293 (2014). Mutations in SETD2 have been reported in pediatric high-grade gliomas. Fontebasso, AM et al., Acta Neuropathol. 125:659-669 (2013).

[0008] Despite more than a century of dedicated scientific and clinical research, curing cancer remains one of the greatest medical challenges to date. Cancer treatment relies primarily on a combination of surgery, radiation therapy, and / or cytotoxic chemotherapy. And, despite the existence of effective cancer therapies, suboptimal response, relapsed refractory disease, and / or resistance to one or more therapeutic agents remain a challenge. Therefore, there is a medical need for more effective, safe, and durable therapies for the treatment of all types of cancer. Summary of the invention

[0009] The present disclosure relates to the surprising and unexpected discovery that inhibition of human SETD2, despite known functionality as a tumor suppressor, can be used to treat cancer, and in particular pancreatic and esophageal cancer.

[0010] In one aspect, the disclosure relates to a method of treating cancer, comprising administering to a subject in need thereof a therapeutically effective amount of a SETD2 inhibitor.

[0011] In one aspect, the disclosure relates to a method of reducing or inhibiting proliferation of a cancer cell, the method comprising: (i) contacting a cancer cell with an effective amount of a SETD2 inhibitor; and (ii) reducing or inhibiting proliferation of the cancer cell.

[0012] In certain embodiments, the SETD2 inhibitor is selected from the group consisting of a polypeptide, a DNA, and a RNA.

[0013] In certain embodiments, the SETD2 inhibitor is (i) an isolated binding molecule that specifically binds to a SETD2 polypeptide; (ii) an isolated binding molecule that specifically binds to a ligand of a SETD2 polypeptide; or (iii) an antiserum raised against a SETD2 polypeptide.

[0014] In certain embodiments, the SETD2 inhibitor is an antibody or an antigen-binding fragment of an antibody that specifically binds to a SETD2 polypeptide. In certain embodiments, the antibody is a polyclonal antibody, a monoclonal antibody, a mouse antibody, a human antibody, a humanized antibody, or a chimeric antibody. In certain embodiments, the antigen-binding fragment is a Fab, Fab', F(ab')2, Fv, scFv, sdFv fragment, VH domain, or VL domain.

[0015] In certain embodiments, the SETD2 inhibitor is an RNAi, miRNA, siRNA, shRNA, antisense RNA, antisense DNA, bait molecule, bait DNA, double-stranded DNA, single-stranded DNA, composite DNA, encapsulated DNA, viral DNA, plasmid DNA, naked RNA, encapsulated RNA, viral RNA, double-stranded RNA, a molecule capable of producing RNA interference or a combination thereof, or a gene editing system that hybridizes with a nucleotide sequence encoding a SETD2 polypeptide under strict conditions. In certain embodiments, the SETD2 inhibitor is an siRNA selected from the group consisting of SEQ ID NO: 1-4. In certain embodiments, the gene editing system is CRISPR / Cas9.

[0016] In certain embodiments, the SETD2 inhibitor is a small molecule compound. In certain embodiments, the small molecule compound is a sinefungin derivative selected from the group consisting of N-propyl sinefungin and N-benzyl sinefungin.

[0017] In certain embodiments, the cancer or cancer cell is selected from the group consisting of: adrenal cancer, acinar cell carcinoma, acoustic neuroma, acral lentiginous melanoma, acrohidrosis adenoma, adenocarcinoma, adenoid cystic carcinoma, adenoma, odontogenic adenomatous tumor, adenosquamous carcinoma, adipose tissue tumor, adrenocortical carcinoma, AIDS-related lymphoma, alveolar rhabdomyosarcoma, alveolar soft tissue sarcoma, ameloblastic fibroma, anaplastic large cell lymphoma, anaplastic thyroid cancer, angiomyolipoma, angiosarcoma, astrocytoma, atypical teratoid rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, blastoma, bone cancer, breast cancer, brain cancer, malignant epithelial tumor, carcinoma in situ, carcinosarcoma, enchondroma, cementoma, medullary sarcoma, chondroma, chordoma, choriocarcinoma, vascular plexus papilloma, renal clear cell sarcoma, craniopharyngioma, cutaneous T-cell lymphoma, cervical cancer, colorectal cancer, Degos disease, desmoplastic small round cell tumor, dysembryoplastic neuroepithelioma, dysgerminoma, embryonal carcinoma, endocrine gland tumor, endodermal sinus tumor, esophageal cancer, fibrosarcoma, follicular lymphoma, follicular thyroid cancer, ganglioneuroma, gastrointestinal cancer, germ cell tumor, gestational choriocarcinoma, giant cell fibroblastoma, giant cell tumor of bone, glial tumor, glioblastoma, glioma, glioma, glioblastoma of the brain, glucagonoma, gonadoblastoma, granulosa cell tumor, ovarian gynecoma, gallbladder cancer, gastric cancer, hemangioblastoma, head and neck cancer, hemangiopericytoma, hepatoblastoma, liver cell cell carcinoma, hepatosplenic T-cell lymphoma, invasive lobular carcinoma, intestinal cancer, kidney cancer, laryngeal cancer, malignant lentigo, fatal midline cancer, leukemia, Leydig cell tumor, liposarcoma, lung cancer, lymphangioma, lymphangiosarcoma, lymphoepithelioma, liver cancer, small cell lung cancer, non-small cell lung cancer, malignant fibrous histiocytoma, malignant peripheral nerve sheath tumor, malignant salamander tumor, mediastinal germ cell tumor, medullary breast cancer, medullary thyroid cancer, medulloblastoma, melanoma, meningioma, Merkel cell carcinoma, mesothelioma, metastatic urothelial carcinoma, mixed mullerian tumor, myxoma, muscle tissue tumor, mycosis fungoides, myxoid liposarcoma, myxoma, myxosarcoma, nasopharyngeal carcinoma, schwannoma, neuroblastoma, neurofibroma, neuroma, nodular melanoma , Eye cancer, Oligoastrocytoma, Oligodendroglioma, Oncocytoma, Optic nerve sheath meningioma, Optic neuroma, Oral cancer, Osteosarcoma, Ovarian cancer, Papillary thyroid cancer, Paraganglioma, Pineoblastoma, Pineocytoma, Pituitary cell tumor, Pituitary adenoma, Pituitary tumor, Plasma cell tumor, Polyembryonic tumor, Primary central nervous system lymphoma, Primary effusion lymphoma, Primary peritoneal cancer, Prostate cancer, Pancreatic cancer, Pharyngeal cancer, Pseudomyxoma peritonei, Renal cell carcinoma, Renal medullary carcinoma, Retinoblastoma, Rhabdomyoma, Rhabdomyosarcoma, Rectal cancer, Sarcoma, Schwannoma, Seminoma, Sertoli cell tumor, Sex cord-gonadal stromal tumor, Skin cancer, Small cell carcinoma, Soft tissue sarcoma, Somatostatinoma, Spinal tumor, Squamous cell carcinoma,Synovial sarcoma, small intestinal cancer, squamous cell carcinoma, gastric cancer, testicular cancer, thyroid cancer, transitional cell carcinoma, laryngeal cancer, urachal carcinoma, genitourinary system cancer, urothelial carcinoma, uveal melanoma, uterine cancer, verrucous carcinoma, optic glioma, vulvar cancer, vaginal cancer, Warthin tumor, Wilms tumor, head and neck squamous cell carcinoma, esophageal adenocarcinoma, gastric adenocarcinoma, colon adenocarcinoma, hepatocellular carcinoma, bile duct system bile duct carcinoma, gallbladder adenocarcinoma, pancreatic adenocarcinoma, breast ductal carcinoma in situ, breast adenocarcinoma, lung adenocarcinoma, lung squamous cell carcinoma, bladder transitional cell carcinoma, bladder squamous cell carcinoma, cervical squamous cell carcinoma, cervical adenocarcinoma, endometrial cancer, penis squamous cell carcinoma and skin squamous cell carcinoma.

[0018] In certain embodiments, the cancer is pancreatic cancer or the cancer cells are derived from pancreatic cancer, or the cancer is esophageal cancer or the cancer cells are derived from esophageal cancer.

[0019] In certain embodiments, the cancer or the cancer cell is selected from the group consisting of esophageal cancer, kidney cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder cancer / urinary tract cancer, head and neck cancer, prostate cancer, blood cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer and colorectal cancer.

[0020] In certain embodiments, the cancer or the cancer cell is a hematological cancer, or the cancer cell is derived from a hematological cancer.

[0021] In certain embodiments, the blood cancer is selected from the group consisting of acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse B large cell lymphoma (DLBCL), marginal zone lymphoma (M ZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter's transformation, acute eosinophilic leukemia, acute erythroid leukemia, acute lymphoblastic leukemia, acute megakaryocytic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-cell lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma.

[0022] In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a human.

[0023] In certain embodiments, the SETD2 inhibitor is formulated for systemic or topical administration. In certain embodiments, the SETD2 inhibitor is formulated for oral, nasal, intraperitoneal or intratumoral administration. In certain embodiments, the SETD2 inhibitor is formulated for intravenous administration, intramuscular administration or subcutaneous administration.

[0024] In certain embodiments, the method further comprises the step of administering one or more additional therapeutic agents.

[0025] In certain embodiments, the SETD2 inhibitor inhibits trimethylation of lysine 36 on histone H3 (H3K36me3).

[0026] In one aspect, the disclosure relates to a SETD2 inhibitor for use in a method of treating cancer.

[0027] In one aspect, the disclosure relates to a method of treating cancer, the method comprising inhibiting the activity of SETD2 in a subject in need thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1A-1B is a bar graph showing the results of CRISPR pooled library screening targeting various genes (including SETD2). Figure 1A and Figure 1B The cell lines on the x-axis of the graph are infected with a pooled lentiviral library, where each lentiviral plasmid contains a polynucleotide encoding a CRISPR-associated Cas9 polypeptide and a polypeptide encoding a single guide RNA (sgRNA). Each bar on the graph represents a human cancer cell line (except for one control cell line, MCF10A, Figure 1A ), and the LogP score on the Y axis represents the depletion of a specific target in the population. Therefore, the LogP score refers to the dependence of each cell line on a specific gene. In this case, the survival of each cell line with a LogP score below 2.5 depends on SETD2. Table 1 lists the data for all 250 cell lines tested and is plotted on Figure 1A Sensitivity to SETD2 depletion was shown by cell lines derived from breast, esophageal, renal, lung, gastric, bladder / urinary tract, endometrial, skin, hematopoietic (i.e., DLBCL and AML), soft tissue, CNS, pancreatic, and ovarian cancers. Figure 1B Cell lines derived from pancreatic ductal adenocarcinoma (PDAC) are shown, demonstrating that PDAC appears to show a marked sensitivity to SETD2 depletion.

[0029] Figures 2A-2DAn example of CRISPR pooled screening validation is provided, showing that the PDAC-derived cell line SU8686 is dependent on human SETD2 based on a dual sgRNA assay. The SMARCA2 gene was also targeted as a negative control. Figure 2A Schematic diagram of human SETD2 protein (with 2564 amino acids), indicating functional domains (AWS, SET, PS, LCR, WW, SRI). The relative positions of target sites within the SETD2 gene are indicated by sgRNAs targeting these sites (sg_7, sg_9, sg_241, and sg_242). Three sites of the SETD2 gene are targeted, including the active site in the SET domain (targeted by sg_241 or and / or sg_242). Figure 2B is a graph showing the effect of dual sgRNA targeting of SETD2 or SMARCA2 in the SU8686 cell line. The y-axis represents the fold change in the number of cells (log10 scale), and the x-axis represents the number of days after infection. It was found that the combination of sgRNAs (including at least one of the two sgRNAs (i.e., sg_241 or sg_242) targeting the active site of SETD2) had a significant effect on the proliferation of this cell line. In contrast, sgRNAs (sg_7 and sg_9) that only target regions outside the SETD2 active site do not affect cell proliferation. Similarly, sgRNAs that inactivate the negative control SMARCA2 have no effect on proliferation. Figure 2C is a bar graph showing the genotype of cells surviving over time after infection with sgRNAs targeting SETD2 (sg_7 and sg_241). Next generation sequencing (NGS) of sgRNA cleavage sites was used to genotype surviving cells as wild type or with in-frame or out-of-frame insertions or deletions ("indels"). This bar graph shows that in cells infected with SETD2 sgRNA, the wild type (uncut) population of the allele increases over time, indicating that cells with functional SETD2 have a survival advantage over cells with non-functional SETD2. Figure 2D is a bar graph showing the genotype of cells surviving infection with SMARCA2 sgRNA (negative control) over time. This bar graph shows that the genotype associated with SMARCA2 sgRNA remains unchanged over time, indicating that SMARCA2 activity is not essential for the activity and growth of SU8686.

[0030] Figure 3A-3B We show that a CRISPR domain pool screen of the OE21 esophageal cancer cell line identified the SET domain as being important for SETD2 sensitivity. Figure 3A is a schematic diagram of the human SETD2 protein (with 2564 amino acids) indicating the functional domains (AWS, SET, PS, LCR, WW, SRI). Figure 3Bis a bar graph showing the percent depletion from screening using sgRNA targeting the full length of the SETD2 gene. The data show that the SET domain and other domains important for the function of the encoded protein, including the "SET-associated" (AWS) domain, are depleted at a higher rate than other regions of the protein. This is due to the fact that functional domains are less tolerant to mutations than other regions. These data strongly support the hypothesis that targeting the SET domain / active site of SETD2 with a small molecule inhibitor will result in a growth phenotype (i.e., decreased proliferation) in this esophageal cancer cell line.

[0031] Figure 4 is a table summarizing the target validation work for the CRISPR screening assay. Representative cell lines are indicated in the first column. The results indicate that the cell line is sensitive or insensitive to SETD2 depletion. The results of the CRISPR pooling screen for the selected cell lines are shown in the "Epipool column". The domain-specific CRISPR pooling screen results are shown in the "Epidomain pool column". These results indicate that the SET domain of SETD2 is required for this effect. Validation of the CRISPR pooling screen results in cell lines using dual sgRNA CRISPR assays targeting SETD2 and NGS confirmation (as shown in Figure 2) are shown in the "Proliferation" and "NGS" columns. Cell lines labeled The boxes marked with are sensitive; the gray boxes are insensitive; Boxes in red indicate inconclusive results; white boxes indicate data are unavailable. DETAILED DESCRIPTION

[0032] definition

[0033] To facilitate understanding of the present invention, a number of terms and phrases are defined below.

[0034] Open terms such as "include," "including," "contain," "containing," and the like mean "comprising." These open transitional phrases are used to introduce an open list of elements, method steps, and the like, without excluding additional, unrecited elements or method steps. Wherever aspects are described herein with the language "comprising," additional similar aspects are also provided that are described with the terms "consisting of" and / or "consisting essentially of."

[0035] As used in this disclosure and claims, the singular forms "a", "an", and "the" include plural forms unless the context clearly dictates otherwise. For example, "a cell" includes a single cell as well as a plurality of cells, including mixtures thereof.

[0036] Unless otherwise indicated, the term "SETD2" (also known as protein containing SET domain 2, Huntington interacting protein B, lysine N-methyltransferase 3A, Huntington yeast chaperone B, EC 2.1.1.43, P231HBP, HIP-1, HIF-1, KMT3A, HYPB, SET2, histone-lysine N-methyltransferase SETD2, Huntington interacting protein 1, Huntington interacting protein 1, protein containing SET domain 2, KIAA1732, HSPC069, HBP231, HSET2, HIF1 and LLS) refers to the natural histone methyltransferase SETD2. "Human SETD2" refers to the natural human histone methyltransferase SETD2. "SETD2" encompasses full-length unprocessed SETD2, as well as any form of SETD2 produced by processing in cells. The term also encompasses naturally occurring variants of SETD2, such as splice variants, allelic variants and isoforms. SETD2 can be isolated from a variety of sources, such as from human tissue types or other animal tissue types, or prepared by recombinant or synthetic methods. Examples of human gene sequences encoding SETD2 or SETD2 polypeptide sequences include, but are not limited to, NCBI gene ID 29072, HGNC: 18420, and SETD2 transcript variant 1, mRNA-NCBI reference sequence: NM_014159.6. The human gene encoding SETD2 is located on the short arm of chromosome 3. As used herein, although the term "SETD2" generally refers to the gene encoding human SETD2, other mammalian forms of SETD2 are also considered.

[0037] As used herein, "functional domain of SETD2" refers to one of the three conserved functional domains of SETD2 that are believed to define the biological function of SETD2. These functional domains are (1) the tripartite AWS-SET-PostSET domain; (2) the WW domain; and (3) the Set2-Rbp1 interaction ("SRI") domain (Li, J. et al., Oncotarget 7:50719-50734 (2016)), which can be as follows:

[0038] AWS-SET-PostSET domain. Without wishing to be bound by any theory, it is believed that the human SET domain is a 130 amino acid motif that is evolutionarily conserved from yeast to mammals and is also found in some bacteria and viruses. The SET domain is usually present as part of a multidomain, flanked by AWS (associated with SET) and PostSET domains. Typically, proteins containing the SET domain transfer one or several methyl groups from S-adenosyl-L-methionine to the amino groups of lysine or arginine residues of histones or other proteins. This transfer is believed to be dependent on the flanking AWS and PostSET regions, which contain several conserved cysteine ​​residues. In contrast to other methyltransferases, methyltransferases containing the SET domain have an α-folded structure that facilitates multiple rounds of methylation without substrate dissociation.

[0039] WW domain. "WW domain" refers to the presence of two conserved tryptophan (W) residues spaced 20-22 amino acids apart. Binding assays show that the WW domain preferentially binds to the proline-rich segment, thereby mediating protein-protein interactions to participate in a variety of molecular processes. Without wishing to be bound by any theory, it is believed that the WW domain recognizes motifs like proline-proline-x-tyrosine (PPxY), phosphorylated serine-proline (p-SP) or phosphorylated threonine-proline (p-ST), and mediates protein binding. Abnormal expression of genes containing WW domains is associated with diseases (e.g., HD, Alzheimer's disease, and various cancer subtypes). Without wishing to be bound by any theory, it is believed that regardless of the length of the HD-related polyglutamine footprint, the WW domain in the C-terminal region of SETD2 interacts with the Huntington protein via its proline-rich segment, and may also interact with TP53. SETD2 contains a proline-rich extension before the WW domain. This proline-rich stretch acts as an intramolecular WW interaction domain that may prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and most likely other proteins.

[0040] SRI domain. Without wishing to be bound by any theory, it is believed that the Set2 Rpb1 interacting ("SRI") domain interacts with the hyperphosphorylated C-terminal domain (CTD) of Rpb1, the largest subunit of RNA Pol II. Also without wishing to be bound by any theory, it is believed that in humans, the major C-terminal domain docking sites of RNA Pol II are located at the first and second helices of SETD2. This domain is believed to direct the activity of SETD2 towards transcriptionally active genes.

[0041] As used herein, the term "substantially similar" or "substantially the same" means that the similarity between two values ​​is high enough so that a person skilled in the art would consider the difference between the two values ​​to be due to the difference between the two values ​​(e.g., K d The results suggest that the effect of a factor-dependent change on the biological characteristic measured by the assay may have little or no biological and / or statistical significance in the context of a biological characteristic measured by the assay (value).

[0042] An "isolated" polypeptide, antibody, polynucleotide, vector, cell, or composition is a polypeptide, antibody, polynucleotide, vector, cell, or composition in a form that is not naturally present. Isolated polypeptides, antibodies, polynucleotides, vectors, cells, or compositions include those that have been purified to the extent that they are no longer in a naturally occurring form. In some embodiments, the isolated antibody, polynucleotide, vector, cell, or composition is substantially pure.

[0043] As used herein, "substantially pure" refers to a material that is at least 50% pure (ie, free of contaminants), at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure.

[0044] "Polynucleotide" or "nucleic acid" as used interchangeably herein refers to nucleotide polymers of any length, and includes DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. Polynucleotides can contain modified nucleotides, such as methylated nucleotides and their analogs. Modifications to the nucleotide structure (if any) can be imparted before or after polymer assembly. The sequence of nucleotides can be interrupted by non-nucleotide components.

[0045] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein and refer to amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and may be interrupted by non-amino acids. The term also encompasses amino acid polymers modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included in the definition are, for example, polypeptides containing one or more analogs of amino acids (including, for example, non-natural amino acids, etc.) and other modifications known in the art. It should be understood that because the polypeptides disclosed herein are based on antibodies, in certain embodiments, the polypeptides may exist as single chains or related chains.

[0046] In the context of two or more nucleic acids or polypeptides, the term "identical" or "percent identity" refers to two or more sequences or subsequences that are identical or have a specified percentage of identical nucleotides or amino acid residues when compared and aligned for maximum correspondence (introducing gaps if necessary), without considering any conservative amino acid substitutions as part of the sequence identity. Percent identity can be measured using sequence comparison software or algorithms or by visual inspection.

[0047] Various algorithms and software that can be used to obtain the alignment of amino acid or nucleotide sequences are known in the art. One such non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al., Proc. Natl. Acad. Sci. [Proceedings of the National Academy of Sciences of the United States of America] 87: 2264-2268 (1990), which was modified in Karlin et al., Proc. Natl. Acad. Sci. [Proceedings of the National Academy of Sciences of the United States of America] 90: 5873-5877 (1993) and incorporated into the NBLAST and XBLAST programs (Altschul et al., Nucleic Acids Res. [Nucleic Acids Research] 25: 3389-3402 (1991)). In certain embodiments, gapped BLAST can be used as described in Altschul et al., Nucleic Acids Res. [Nucleic Acids Research] 25: 3389-3402 (1997). BLAST-2, WU-BLAST-2 (Altschul et al., Methods in Enzymology 266:460-480 (1996)), ALIGN, ALIGN-2 (Genentech, South San Francisco, CA) or Megalign (DNASTAR) are other publicly available software programs that can be used to align sequences. In certain embodiments, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software (e.g., using the NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 90 and a length weight of 1, 2, 3, 4, 5, or 6). In certain alternative embodiments, the GAP program in the GCG software package (which incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. [Journal of Molecular Biology] 48: 444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4, and a length weight of 1, 2, 3, 4, 5). Alternatively, in certain embodiments, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4: 11-17 (1989)). For example, the ALIGN program (version 2.0) can be used and the percent identity is determined using PAM120 with a residue table, a gap length penalty of 12, and a gap penalty of 4. Appropriate parameters for maximum alignment can be determined by a skilled person in the art using a specific alignment software. In certain embodiments, the default parameters of the alignment software are used.In certain embodiments, the percent identity "X" of a first amino acid sequence to a second amino acid sequence is calculated as 100 x (Y / Z), where Y is the number of amino acid residues scored as identical matches in an alignment of the first and second sequences (aligned by visual inspection or by a specific sequence alignment program), and Z is the total number of residues in the second sequence. If the length of the first sequence is longer than the length of the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.

[0048] As a non-limiting example, in certain embodiments, whether any particular polynucleotide has a certain percentage of sequence identity (e.g., at least 80% identical, at least 85% identical, at least 90% identical, and in some embodiments, at least 95%, 96%, 97%, 98% or 99% identical) to a reference sequence can be determined using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wisconsin 53711). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482 489 (1981) to find the best segment of homology between two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the present disclosure, the parameters are set so that the percent identity is calculated over the entire length of the reference nucleotide sequence and so that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.

[0049] In some embodiments, two nucleic acids or polypeptides described herein are substantially identical, meaning that when compared and aligned for maximum correspondence (e.g., using a sequence comparison algorithm or measured by visual inspection), they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity. In certain embodiments, the identity exists over a region of the sequence that is at least about 10, about 20, about 40-60 residues in length, or any integer value therebetween, or over a region that is longer than 60-80 residues (at least about 90-100 residues), or the sequences are substantially identical over the full length of the compared sequences (e.g., such as the coding region of a nucleotide sequence).

[0050] As used herein, the term "subject" refers to any animal (e.g., mammal), including but not limited to humans, non-human primates, rodents, etc., that is to be the recipient of a particular treatment. Generally, the terms "subject" and "patient" are used interchangeably herein to refer to a human subject.

[0051] "Tumor" and "neoplasm" refer to any mass of tissue resulting from excessive cell growth or proliferation, including precancerous lesions and in situ lesions, benign (noncancerous) or malignant (cancerous).

[0052] The terms "cancer," "cancerous" or "malignancy" are used interchangeably and refer to the following physiological condition in mammals (i.e., humans) in which a cell population is characterized by uncontrolled or unregulated cell growth or proliferation. Examples of cancer include, for example, carcinomas, lymphomas, blastomas, sarcomas, myelomas, and leukemias. Non-limiting examples of cancer types that can be treated with the methods and pharmaceutical compositions of the present disclosure include esophageal cancer, kidney cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder cancer / urinary tract cancer, head and neck cancer, prostate cancer, blood cancer, pancreatic cancer, colorectal cancer, skin cancer, endometrial cancer, ovarian cancer, and colorectal cancer.

[0053] The term "relapsed" cancer in a patient refers to a patient who had previously achieved a complete or partial remission but, after a period of 6 months or longer, exhibits signs of disease progression.

[0054] The term "refractory" cancer in patients refers to patients who experience treatment failure or disease progression within 6 months from the last anticancer therapy.

[0055] Tumors that are "unresponsive" or "poorly responsive" to a treatment (e.g., treatment with a particular chemotherapeutic regimen) either do not show a statistically significant improvement in response to such treatment when compared to no treatment or treatment with a placebo in cognitive animal models or human clinical trials, or respond to initial treatment but grow with continued treatment.

[0056] The term "pharmaceutical formulation" refers to a preparation that is in such form that the biological activity of one or more active ingredients is effective, and does not contain additional components that are unacceptably toxic to a subject to which the formulation is administered. Such formulations may be sterile.

[0057] The term "therapeutically effective amount" refers to the amount of a therapeutic agent (e.g., a small molecule inhibitor of SETD2) that is effective to "treat" a disease or disorder in a subject or mammal. In the case of cancer, a therapeutically effective amount of an agent can reduce the number of cancer cells, reduce the proliferation of cancer cells, reduce the size of a tumor, inhibit (i.e., slow down to some extent and stop in some embodiments) cancer cell infiltration into peripheral organs, inhibit (i.e., slow down to some extent and stop in some embodiments) tumor metastasis, inhibit tumor growth to some extent, and / or alleviate one or more symptoms associated with cancer to some extent. See the definition of "treatment" herein. To the extent that an agent can prevent the growth of existing cancer cells and / or kill existing cancer cells, it can be cytostatic and / or cytotoxic.

[0058] The term "prophylactically effective amount" refers to an amount effective to achieve the desired prophylactic result at the necessary dosage and for the necessary period of time. Usually, but not necessarily, because the prophylactic dose is used in the subject before or at an early stage of the disease, the prophylactic effective amount may be less than the therapeutic effective amount.

[0059] Terms such as "treating," "treatment," "to treat," "therapeutic," "alleviating," "to alleviate," or "slow progression" refer to both: 1) therapeutic measures to cure, eradicate, slow, alleviate symptoms, and / or halt the progression of a diagnosed pathological disorder (e.g., cancer); and 2) prophylactic and / or preventative measures to prevent and / or slow the development of cancer. Thus, patients in need of treatment include those already suffering from the disorder; those susceptible to the disorder; and those in whom the disorder is to be prevented. In certain embodiments, if the patient shows one or more of the following, then according to the methods of the present disclosure, the subject's cancer is successfully "treated": reduced cachexia, increased survival time, prolonged tumor progression time, reduced tumor mass, reduced tumor burden and / or prolonged tumor metastasis time, prolonged tumor recurrence or progressive disease time, prolonged tumor response, prolonged complete response (CR), prolonged partial response (PR), prolonged stable disease, prolonged progression-free survival (PFS), prolonged overall survival (OS), each of which is measured by the standards established by the National Cancer Institute and the U.S. Food and Drug Administration (FDA) for the approval of new drugs. See, Johnson et al., J. Clin. Oncol. [Journal of Clinical Oncology] 21: 1404-1411 (2003). In some embodiments, as defined above, "therapeutic effect" also encompasses the reduction of toxicity or adverse side effects and / or the improvement of tolerance.

[0060] "Administering" refers to the use of any of a variety of methods and delivery systems known to those skilled in the art to physically introduce the SETD2 inhibitors described herein (and / or one or more additional therapeutic agents) into a subject. Routes of administration include oral, mucosal, topical, intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration (e.g., by injection or infusion). As used herein, the phrase "parenteral administration" means the following modes of administration, including but not limited to intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcutaneous, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion and in vivo electroporation. It can be administered, for example, once, multiple times and / or over one or more extended time periods.

[0061] The term "combination of agents", e.g., a combination of a SETD2 inhibitor and one or more other therapeutic agents, refers to the simultaneous, sequential, or simultaneous and sequential administration of these agents to the same subject. For example, administration of a SETD2 inhibitor before or after (e.g., by one or more hours, one or more days, one or more weeks, or one or more months) administration of another therapeutic agent constitutes combined administration of the agents, whether the agents are administered together in a single pharmaceutical formulation or in separate pharmaceutical formulations by the same or different routes of administration.

[0062] As used herein, the term "reducing or inhibiting the proliferation of cancer cells" refers to a reduction in the in vitro, ex vivo, or in vivo growth of one or more cells derived from a mammalian (eg, human) cancer as described herein.

[0063] Unless otherwise indicated, all numbers in this disclosure indicating amounts of materials, ratios, physical properties and / or uses are to be understood as modified by the word "about." When referring to a number or a numerical range, the term "about" means that the number or range referred to is approximate, e.g., within experimental variability (or within statistical experimental error), and thus, the number or numerical range may vary, e.g., from 1% to 15% of the stated number or numerical range.

[0064] SETD2 inhibitors

[0065] The present disclosure provides innovative treatments for subjects with cancer.The present disclosure relates to the surprising and unexpected discovery that inhibition of the histone methyltransferase SETD2 (despite known functionality as a tumor suppressor) can be used to treat cancer, and in particular pancreatic and esophageal cancer.

[0066] The treatment particularly comprises administering to a subject in need thereof a therapeutically effective amount of a histone methyltransferase SETD2 inhibitor, and treating the cancer.

[0067] As used herein, the term "an inhibitor of SETD2" or "SETD2 inhibitor" refers to any molecule or compound that modulates (e.g., downregulates) human SETD2 activity. For example, a SETD2 inhibitor can inhibit the histone methyltransferase activity of SETD2. For example, a SETD2 inhibitor can be a compound that exhibits a biochemical 50% inhibitory concentration (IC 50%) for SETD2 in a purified enzyme assay. 50 ) of a compound having a biochemical 50% inhibitory concentration of between about 1 nM and about 10,000 nM, between about 1 nM and about 1,000 nM, between about 1 nM and about 500 nM, between about 1 nM and about 100 nM, between about 1 nM and about 50 nM, or between about 1 nM and about 10 nM.

[0068] In some embodiments, “downregulating (or inhibiting) the activity of human SETD2” refers to inhibiting the trimethylation of lysine 36 of histone 3.

[0069] In some embodiments, the SETD2 inhibitor can be, for example, a polypeptide, DNA or RNA. The inhibitor of SETD2 can also be, for example, a molecule that specifically binds to a SETD2 polypeptide, a molecule that specifically binds to a ligand of a SETD2 polypeptide, an antiserum generated against a SETD2 polypeptide, a soluble SETD2 polypeptide, or a soluble SETD2 polypeptide that comprises, consists essentially of, or consists of an extracellular domain of a SETD2 polypeptide.

[0070] In some embodiments, the SETD2 inhibitor may also be, for example, an antibody that specifically binds to a SETD2 polypeptide or an antigen-binding fragment of an antibody that specifically binds to a SETD2 polypeptide. In some embodiments, the antibody is a polyclonal antibody, a monoclonal antibody, a mouse antibody, a human antibody, a humanized antibody, or a chimeric antibody. Monoclonal and polyclonal anti-SETD2 antibodies are commercially available and may be purchased, for example, from Thermo Fisher Scientific and Millipore Sigma. In some embodiments, the antigen-binding fragment is a Fab, Fab', F(ab')2, Fv, scFv, sdFv fragment, VH domain, or VL domain.

[0071] In some embodiments, the SETD2 inhibitor can also be, for example, RNAi, miRNA, siRNA, shRNA, antisense RNA, antisense DNA, bait molecule, bait DNA, double-stranded DNA, single-stranded DNA, complexed DNA, encapsulated DNA, viral DNA, plasmid DNA, naked RNA, encapsulated RNA, viral RNA, double-stranded RNA, a molecule capable of producing RNA interference, or a combination thereof, which hybridizes to a nucleotide sequence encoding a SETD2 polypeptide.

[0072] Downregulation of SETD2 can also be achieved by gene editing technology. In some embodiments, the SETD2 inhibitor can be, for example, a clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9 system. The CRISPR-Cas9 system has been described in the literature on applications in cancer biology, and can include, for example, a Cas9 nuclease and a single guide RNA (sgRNA). See, Sanchez-Rivera, FJ and Jacks, T., "Applications of the CRISPR-Cas9 System in Cancer Biology," Nat Rev Cancer [Cancer Nature Review] 15: 387-395 (2015); Chen, S. et al., "CRISPR-Cas9: from Genome Editing to Cancer Research [CRISPR-Cas9: from genome editing to cancer research]," Int. J. Biol. Sci. [International Journal of Biological Sciences] 12: 1427-1436 (2016). For example, sgRNA targeting the SETD2 gene can be administered to a subject together with the Cas9 nuclease, resulting in ablation of a specific sequence of the SETD2 gene, resulting in downregulation of SETD2 activity (ie, trimethylation of lysine 36 of histone H3 is inhibited). In particular, CRISPR-Cas9 can be used to target SET, AWS, PS, SRI or WW domains for ablation. Non-limiting examples of CRISPR-Cas9 systems include sgRNA target sequence #1 with sequence AGCACCAGTAACAGAGCCAG (SEQ ID NO: 5), sgRNA target sequence #2 with sequence GACTGTGAACGGACAACTGA (SEQ ID NO: 6), and Cas9 mRNA. In some embodiments, sgRNA and Cas9 mRNA can each be contained in a separate vector. In some embodiments, sgRNA can be contained in a first vector, and Cas9 mRNA can be contained in a second vector. In some embodiments, sgRNA and Cas9 mRNA can both be contained in a single vector. Those skilled in the art know the reagents and methods for preparing CRISPR-Cas9 systems for administration to subjects in need.

[0073] In addition to the CRISPR-Cas9-based system, other alternative CRISPR-based systems can also be used to inhibit SETD2, such as, for example, the CRISPR / Cpf1 system of the bacterium Francisella novicida. See, Zetsche, B. et al., Cell [Cell] 163: 759-771 (2015); Fonfara, I et al., Nature [Nature] 532: 517-521 (2016).

[0074] In addition to CRISPR-based systems, other gene editing technologies such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and engineered homing meganucleases can also be used to inhibit SETD2. See, e.g., Maeder, ML and Gersbach, CA, “Genome-editing Technologies for Gene and Cell Therapy,” Mol. Ther. 24:430-446 (2016); Gaj, T. et al., “ZFN, TALEN, and CRISPR / Cas-based methods for genome engineering,” Trends Biotechnol 31:397-405 (2013); Perez-Pinera, P. et al., “Advances in targeted genome editing,” Curr Opin Chem Biol 16:268-277 (2012).

[0075] In some embodiments, the SETD2 inhibitor used in the methods of the present disclosure is a small molecule (i.e., a molecule with a molecular weight of less than about 1,500 g / mol, such as a molecule between about 100 g / mol and about 1,500 g / mol) compound that selectively targets and downregulates one or more activities of SETD2. In some embodiments, the small molecule inhibitor of SETD2 is a sinefungin derivative. Sinefungin is an analog of S-adenosylmethionine (SAM). In some embodiments, the sinefungin analog is an N-alkyl (methyl, ethyl, propyl, benzyl) sinefungin. In some embodiments, the N-alkyl sinefungin is N-propyl sinefungin (Pr-SNF) or N-benzyl sinefungin (Bn-SNF). The synthesis of sinefungin derivatives and their properties of inhibiting human methyltransferase SETD2 are described in Zheng, W. et al., J. Am. Chem. Soc. [Journal of the American Chemical Society] 134: 18004-18014 (2012), which is incorporated by reference in its entirety.

[0076] In one embodiment, the SETD2 inhibitor is an antisense nucleic acid or oligonucleotide that is fully or partially complementary to a target nucleic acid (DNA or RNA) encoding a SETD2 polypeptide and can hybridize therewith. For example, the antisense nucleic acid or oligonucleotide can be complementary to the 5' or 3' untranslated region, or can overlap the translation start codon (5' untranslated and translated region) of at least one nucleic acid molecule encoding SETD2. As a non-limiting example, the antisense oligonucleotide can be targeted to hybridize with the following regions: mRNA cap region, translation start site; translation stop site; transcription start site; transcription stop site; polyadenylation signal 3' untranslated region; 5' untranslated region; 5' coding region, middle coding region; 3' coding region: DNA replication initiation and elongation site.

[0077] In some embodiments, oligonucleotides that will bind to duplex nucleic acids (i.e., DNA:DNA or DNA:RNA) can be constructed to form stable triple helices or triplet nucleic acids. Such triplet oligonucleotides can inhibit transcription and / or expression of nucleic acids encoding SETD2. Triplet oligonucleotides are constructed using the base pairing rules formed by triple helices.

[0078] In another embodiment, oligonucleotides containing moieties with non-naturally occurring portions can be used in the present method. Therefore, oligonucleotides can have sugar moieties or sugar-sugar connections that change. Such examples are phosphorothioates and other sulfur-containing species known in the art. In a preferred embodiment, at least one phosphodiester bond of an oligonucleotide has been replaced by a structure that enhances the ability of the composition to penetrate into a cell region that is the location of the RNA to be regulated. Preferably, such replacements include phosphorothioate bonds, methylphosphonate bonds, or short-chain alkyl or cycloalkyl structures.

[0079] In other embodiments, the phosphodiester bond is replaced by a structure that is substantially nonionic and achiral at the same time, or by a chiral and enantiomer-specific structure. One of ordinary skill in the art will be able to select other connections for the method disclosed herein, including reverse terminal nucleotides. Oligonucleotides may also include species comprising at least some modified base forms. Therefore, purines and pyrimidines other than those commonly found in nature may be used in this way. Similarly, modifications on the furanosyl portion of the nucleotide subunit may also be affected. Examples of such modifications are 2'-O-alkyl- and 2'-halogen-substituted nucleotides. Some non-limiting examples of modifications at the 2' position of the sugar moiety include OH, SH, SCH3, F, OCH3, OCN, O(CH2), NH2, and O(CH2)nCH3, wherein n is from 1 to about 10. Such oligonucleotides may be functionally interchangeable with natural oligonucleotides or synthetic oligonucleotides, which have one or more differences from the natural structure. All such analogs are included herein as long as they can effectively function to hybridize to at least one nucleic acid molecule encoding SETD2 to inhibit its function.

[0080] Alternatively, expression vectors derived from retroviruses, adenoviruses, herpes or vaccinia viruses or derived from various bacterial plasmids can be used to deliver the nucleotide sequence to a target organ, tissue or cell population. Recombinant vectors that will express a nucleic acid sequence complementary to the nucleic acid sequence encoding a human SETD2 polypeptide can be constructed using methods well known to those skilled in the art.

[0081] RNA interference (RNAi) is a post-transcriptional gene silencing process induced by miRNA or dsRNA (small interfering RNA; siRNA), and has been used to regulate gene expression. RNAi can be used in the therapeutic methods described herein to inhibit SETD2. Typically, RNAi is performed by contacting cells with double-stranded siRNA or small hairpin RNA (shRNA). However, due to the sensitivity of RNA to degradation, the manipulation of RNA outside the cell is cumbersome. Therefore, deoxyribonucleic acid (DNA) compositions encoding small interfering RNA (siRNA) molecules or intermediate siRNA molecules (e.g., shRNA) (comprising a siRNA chain to be used) are also contemplated herein. Therefore, the present application provides an isolated DNA molecule comprising an expressible template nucleotide sequence of at least about 16 nucleotides encoding an intermediate siRNA, which mediates RNA interference (RNAi) to a target RNA when used as a component of the siRNA. The present application further relates to the use of RNA interference (RNAi) in regulating the expression of a nucleic acid molecule encoding SETD2 in a target cell. Although therapeutic applications are not limited to a specific mode of action, RNAi can involve degradation of messenger RNA (e.g., mRNA of the gene for SETD2) by RNA-induced silencing complex (RISC), thereby preventing translation of transcribed target mRNA. Alternatively, RNAi can also involve methylation of genomic DNA, thereby shutting down transcription of the target gene. Inhibition of gene expression caused by RNAi may be transient, more stable, or even permanent.

[0082] In the method of the present invention, "small interfering RNA" (siRNA) can also be used as a SETD2 inhibitor. siRNA refers to any nucleic acid molecule that can mediate RNA interference (RNAi) or gene silencing. For example, siRNA can be a double-stranded RNA molecule from about 10 to about 30 nucleotides long, which is named because of its ability to specifically interfere with protein expression (e.g., SETD2 protein expression). In one embodiment, the siRNA disclosed herein is 12-28 nucleotides long, more preferably 15-25 nucleotides long, even more preferably 19-23 nucleotides long, and most preferably 21-23 nucleotides long. Therefore, preferred siRNA is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 nucleotides in length. As used herein, siRNA molecules need not be limited to those molecules containing only RNA, but further encompass chemically modified nucleotides and non-nucleotides. siRNA can be designed to reduce the expression of SETD2 in target cells by RNA interference. siRNA can comprise a sense region and an antisense region, wherein the antisense region comprises a sequence complementary to the mRNA sequence of the nucleic acid molecule encoding SETD2, and the sense region comprises a sequence complementary to the antisense sequence of the mRNA of the gene. The siRNA molecule can be assembled by two nucleic acid fragments, wherein one fragment comprises the sense region, and the second fragment comprises the antisense region of the siRNA molecule. The sense region and the antisense region can also be covalently linked via a linker molecule. The linker molecule can be a polynucleotide linker or a non-polynucleotide linker.

[0083] In one embodiment, the SETD2 inhibitor is a human SETD2 siRNA selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0084] UAAAGGAGGUAUAUCGAAU(SEQ ID NO:1)

[0085] GAGAGGUACUCGAUCAUAA(SEQ ID NO:2)

[0086] GCUCAGAGUUAACGUUUGA(SEQ ID NO:3)

[0087] CCAAAGAUUCAGACAUAUA(SEQ ID NO:4)

[0088] A ribozyme (from ribonuclease, also called RNA enzyme or catalytic RNA) is an RNA molecule that catalyzes a chemical reaction. Some ribozymes play an important role as therapeutic agents, as enzymes that target defined RNA sequences, as biosensors, and in applications in functional genomics and gene discovery. Ribozymes can be genetically engineered to specifically cleave transcripts of genes from nucleic acid molecules encoding SETD2, whose expression needs to be downregulated.

[0089] Delivery of genes or genetic material (encoding part or all of the sequence that reduces SETD2 expression) into cells is the first step in gene therapy treatment of any disorder. A large number of delivery methods are well known to those skilled in the art. Preferably, nucleic acid is administered for in vivo or ex vivo gene therapy purposes. Non-viral vector delivery systems include DNA plasmids, naked nucleic acids, and nucleic acids compounded with delivery vehicles such as liposomes. Viral vector delivery systems include DNA and RNA viruses, which have episomal genomes or integrated genomes after delivery to cells.

[0090] The use of RNA or DNA-based viral systems to deliver nucleic acids utilizes the highly evolved process of targeting specific cells in the virus body and transporting the viral payload to the nucleus. Viral vectors can be directly applied to patients (in vivo), or they can be used for in vitro treatment of cells, and then the modified cells are applied to patients (ex vivo). Conventional viral-based systems for delivering nucleic acids can include retroviruses, slow viruses, adenoviruses, adeno-associated viruses and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile gene transfer methods in target cells and tissues. When using retroviruses, slow viruses and adeno-associated virus gene transfer methods, integration in the host genome is possible, usually resulting in the long-term expression of the inserted transgene. In addition, high transduction efficiency has been observed in many different cell types and target tissues.

[0091] In the application of transient expression of preferred nucleic acid, adenovirus-based system is generally used. Adenovirus-based vectors can have very high transduction efficiency in many cell types, and do not require cell division. Using such vectors, high titer and expression level have been obtained. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus ("AAV") vectors are also used, for example, for transducing cells with target nucleic acids in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy programs.

[0092] Recombinant adeno-associated viral vectors (rAAV) are promising alternative gene delivery systems based on the defective and non-pathogenic parvovirus adeno-associated type 2 virus. All vectors are derived from plasmids that retain only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genome of the transduced cells are key features of this vector system.

[0093] Replication-deficient recombinant adenoviral vectors (Ad) are primarily used for transient expression gene therapy; because they can be produced at high titers and are easy to infect a variety of different cell types. Most adenoviral vectors are engineered so that the transgene replaces the Ad E1a, E1b, and E3 genes; the replication-deficient vectors are then propagated in human 293 cells, which trans-provide the missing gene function. Ad vectors can transduce a variety of tissue types in vivo, including non-dividing differentiated cells, such as those found in liver, kidney, and muscle tissue. Conventional Ad vectors have a large carrying capacity.

[0094] In many gene therapy applications, it is desirable to deliver gene therapy vectors to specific tissue types, such as glial cells, with a high degree of specificity. Viral vectors are often modified to have specificity for a given cell type by expressing the ligand as a fusion protein with a viral coat protein on the outer surface of the virus. The ligand is selected to have an affinity for a receptor known to be present on the cell type of interest.

[0095] Gene therapy vectors can be delivered in vivo, typically by systemic administration (e.g., intravenous, intratumoral, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion) or topical application to individual subjects. Alternatively, the vectors can be delivered to ex vivo cells, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, and tissue biopsies) or universal donor hematopoietic stem cells, which are then reimplanted into the subject, typically after selecting cells that have incorporated the vector.

[0096] In one embodiment, stem cells are used in ex vivo procedures for cell transfection and gene therapy. The advantage of using stem cells is that they can be differentiated into other cell types in vitro, or can be introduced into a mammal (e.g., a cell donor) where they will be implanted in an appropriate location (e.g., in the bone marrow). Methods of using cytokines (e.g., GM-CSF, IFN-γ, and TNF-α) to differentiate CD34+ cells in vitro into clinically important immune cell types are known.

[0097] Stem cells are isolated using known methods for transduction and differentiation. For example, stem cells can be isolated from bone marrow cells by panning the bone marrow cells with antibodies that bind to unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (all B cells), GR-1 (granulocytes), and lad (differentiated antigen presenting cells).

[0098] Administration of SETD2 inhibitors

[0099] Suitable methods for administering the SETD2 inhibitors described herein will be based on the properties of the inhibitor (i.e., small molecules, DNA, RNA, proteins, antibodies), and are well known to those skilled in the art. The SETD2 inhibitors described herein can be administered orally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, transdermally, intrathecally, intranasally, transmucosally, intratumorally, rectally, intravaginally, or buccally, or by inhalation. For example, intravenous injections such as instillations, intramuscular injections, intraperitoneal injections, subcutaneous injections, suppositories, enema, oral enteric-coated tablets, etc. can be selected, and the method of administration can be selected as appropriate according to the patient's age and condition. The SETD2 inhibitors described herein can be administered systemically (e.g., by intravenous injection) or locally (e.g., intrathecally, intratumorally, or intralymph nodeally).

[0100] The appropriate dosage of the SETD2 inhibitor disclosed herein depends on several factors, such as the type of cancer to be treated, the severity, course and stage of the cancer, the responsiveness of the cancer, previous therapy, the patient's clinical history, etc., all of which are determined by the attending physician. In some embodiments, the dosage of the SETD2 inhibitor is from about 0.01 mg / kg body weight to about 1000 mg / kg body weight. In some embodiments, the dosage of the SETD2 inhibitor is from about 1 mg / kg body weight to about 500 mg / kg body weight. In some embodiments, the dosage of the SETD2 inhibitor is from about 0.1 mg / day to about 50 g / day; about 0.1 mg / day to about 25 g / day; about 0.1 mg / day to about 10 g / day; about 0.1 mg / day to about 3 g / day; or about 0.1 mg / day to about 1 g / day. Alternatively, the dosage of the SETD2 inhibitor is in the range of 1 to 2000 mg, and preferably 100 to 1000 mg / patient.

[0101] In some embodiments, the SETD2 inhibitor may be administered once or for a series of treatments lasting from days to months, or until a cure is achieved or a reduction in the disease state (eg, reduction in tumor size) is achieved.

[0102] In some embodiments, the SETD2 inhibitors described herein may be administered once or more daily, weekly, monthly, or annually. In certain embodiments, the SETD2 inhibitor is administered once daily, once every two days, once every three days, or once every four days. In certain embodiments, the SETD2 inhibitor is administered twice daily, three times daily, or four times daily. In certain embodiments, the SETD2 inhibitor is administered once weekly. In certain embodiments, the SETD2 inhibitor is administered once every two weeks. In certain embodiments, the SETD2 inhibitor is administered once every three weeks. In certain embodiments, the SETD2 inhibitor is administered once every four weeks. In certain embodiments, the SETD2 inhibitor is administered once monthly.

[0103] In some embodiments, the SETD2 inhibitors described herein may be administered with an initial higher "loading" dose, followed by one or more lower doses. In some embodiments, the frequency of administration may also be changed. In some embodiments, the dosing regimen may include administering an initial dose, followed by administering another dose (or "maintenance" dose) twice a day, once a day, once every two days, once every three days, or once a week. For example, the dosing regimen may include administering an initial loading dose, followed by administering a daily maintenance dose of, for example, half of the initial dose. Or the dosing regimen may include administering an initial loading dose, followed by administering a maintenance dose of, for example, half of the initial dose every other day. Or the dosing regimen may include administering three initial doses for 3 days, followed by administering, for example, the same amount of maintenance doses every other day.

[0104] Those of ordinary skill in the art will appreciate that the dosage, route of administration, and frequency of administration will vary depending on the particular subject being treated and taking into account factors such as the age, sex, health, and weight of the recipient, the condition or disorder being treated, the severity of the disorder, the type of current treatment or treatments, if any, and the nature of the effect desired.

[0105] Those skilled in the art will also appreciate that the dosage and / or frequency of administration of the SETD2 inhibitor may be altered (lowered or increased) during the course of therapy depending on the patient's clinical response, side effects, etc., or during different phases of therapy (ie, treatment or maintenance).

[0106] Pharmaceutical composition

[0107] The SETD2 inhibitor used in the methods described herein can be formulated into a pharmaceutical composition suitable for administration to a subject in need thereof (i.e., a subject suffering from cancer). As used herein, a "pharmaceutical composition" refers to a preparation of one or more agents as described herein (e.g., a SETD2 inhibitor or a SETD2 inhibitor with one or more other therapeutic agents) or a physiologically acceptable salt or prodrug thereof with other chemical components (including but not limited to pharmaceutically acceptable carriers, excipients, lubricants, buffers, antibacterial agents, bulking agents (e.g., mannitol), antioxidants (e.g., ascorbic acid or sodium bisulfite), etc.). The purpose of the pharmaceutical composition is to assist in administering one or more agents to a subject.

[0108] The terms "pharmaceutically acceptable carrier", "excipient" and "adjuvant", as well as "physiologically acceptable vehicle", etc., are understood to refer to an acceptable carrier or adjuvant that can be administered to a patient with the SETD2 inhibitors described herein and that does not destroy or eliminate its pharmacological activity. As used herein, pharmaceutically acceptable excipients include, but are not limited to, any and all solvents, dispersion media or other liquid vehicles, dispersion or suspension aids, diluents, granulating and / or dispersing agents, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, binders, lubricants or oils, colorants, sweeteners or flavoring agents, stabilizers, antioxidants, antimicrobial or antifungal agents, osmotic pressure regulators, pH regulators, buffers, chelating agents, cryoprotectants and / or fillers suitable for the particular dosage form desired. Various excipients used to formulate pharmaceutical compositions and techniques for preparing such compositions are well known in the art (see, Remington: The Science and Practice of Pharmacy, 21st ed., AR Gennaro (Lippincott, Williams & Wilkins, Baltimore, Maryland, 2006; herein incorporated by reference in its entirety).

[0109] Exemplary diluents include, but are not limited to, calcium or sodium carbonate, calcium phosphate, dibasic calcium phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, the like, and / or combinations thereof.

[0110] Exemplary granulating and / or dispersing agents include, but are not limited to, starch, pregelatinized starch or microcrystalline starch, alginic acid, guar gum, agar, poly(vinyl-pyrrolidone), (providone), cross-linked poly(vinyl-pyrrolidone) (crospovidone), cellulose, methylcellulose, carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), magnesium aluminum silicate, Sodium lauryl sulfate, and the like and / or combinations thereof.

[0111] Exemplary surfactants and / or emulsifiers include, but are not limited to, natural emulsifiers (e.g., gum arabic, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan gum, pectin, gelatin, egg yolk, casein, lanolin, cholesterol, waxes, and lecithin), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monooleate [ 80], Sorbitan monopalmitate[ 40], monooleylglycerol, polyoxyethylene esters, polyethylene glycol fatty acid esters (e.g. ), polyoxyethylene ethers (e.g. polyoxyethylene lauryl ether [ 30]), F68, 188, etc. and / or combinations thereof.

[0112] Exemplary binders include, but are not limited to, starch, gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol), amino acids (e.g., glycine), natural and synthetic gums (e.g., gum arabic, sodium alginate), ethyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, and the like, and combinations thereof.

[0113] Exemplary antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, monothioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, and the like, and combinations thereof.

[0114] Exemplary chelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, trisodium edetate, and the like, and combinations thereof.

[0115] Exemplary antimicrobial or antifungal agents include, but are not limited to, benzalkonium chloride, benzethonium chloride, methylparaben, ethylparaben, propylparaben, butylparaben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, and the like, and combinations thereof.

[0116] Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, ascorbic acid, butylated hydroxyanisole, ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), and the like, and combinations thereof.

[0117] Exemplary buffers for controlling pH may include, but are not limited to, sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, the like, and / or combinations thereof.

[0118] Exemplary lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silicon dioxide, talc, malt, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium or magnesium lauryl sulfate, and the like, and combinations thereof.

[0119] The pharmaceutical compositions or formulations described herein may contain a cell protectant to stabilize the polynucleotides described herein during freezing. Exemplary cryoprotectants include, but are not limited to, mannitol, sucrose, trehalose, lactose, glycerol, dextrose, and the like, and combinations thereof.

[0120] The administration of the SETD2 inhibitors disclosed herein is by any route commonly used to introduce molecules into ultimate contact with tumor cells. Pharmaceutical compositions comprising SETD2 inhibitors can be administered by any suitable method, such as parenteral, intraventricular, oral, topical, rectal, vaginal, nasal, buccal, or via an implanted reservoir. As used herein, the term "parenteral" includes subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injection or infusion techniques.

[0121] Parenteral formulations may be a single bolus dose, an infusion or a loading bolus dose followed by a maintenance dose. These compositions may be administered at specific fixed or variable intervals (e.g., twice a week or once a week). In some embodiments, the SETD2 inhibitor is administered intravenously.

[0122] In certain embodiments, the pharmaceutical composition can be administered orally in an acceptable dosage form, including, for example, capsules, tablets, aqueous suspensions or solutions. In certain embodiments, the pharmaceutical composition can also be administered by nasal aerosol or inhalation. Such compositions can be prepared as saline solutions using benzyl alcohol or other suitable preservatives, absorption enhancers (to enhance bioavailability), and / or other conventional solubilizing or dispersing agents.

[0123] Those skilled in the art will appreciate that the specific dosage and treatment regimen for any particular patient will depend on multiple factors, including the specific therapeutic agent used, the patient's age, body weight, general health, sex and diet and application time, excretion rate, drug combination and the severity of the specific disease being treated. The judgment of the medical care staff to such factors is within the ordinary skill of the art. The amount will also depend on the individual patient to be treated, route of administration, type of preparation, characteristics of the compound used, severity of the disease and the desired effect. The use amount can be determined by pharmacology and pharmacokinetic principles well known in the art.

[0124] In some embodiments, the SETD2 inhibitor is administered in combination with one or more additional therapeutic agents and / or therapeutic procedures, as described herein. In some embodiments, the SETD2 inhibitor may be co-formulated and / or co-administered with one or more additional therapeutic agents, as described herein. In some embodiments, the methods described herein further comprise administering at least one additional therapeutic agent to the subject.

[0125] Methods for treating cancer

[0126] In one aspect, the disclosure provides a method of treating or slowing the progression of cancer in a subject by administering to a subject in need thereof a therapeutically effective amount of a SETD2 inhibitor, such as those described above.

[0127] Various types of cancer can be treated by the disclosed methods and pharmaceutical compositions. In some embodiments, the cancer is selected from the group consisting of: adrenal cancer, acinar cell carcinoma, acoustic neuroma, acral lentiginous nevus melanoma, acrohidrosis adenoma, adenocarcinoma, adenoid cystic carcinoma, adenoma, odontogenic adenomatous tumor, adenosquamous carcinoma, adipose tissue tumor, adrenocortical carcinoma, AIDS-related lymphoma, alveolar rhabdomyosarcoma, alveolar soft tissue sarcoma, ameloblastic fibroma, anaplastic large cell lymphoma, anaplastic thyroid cancer, angiomyolipoma, angiosarcoma, astrocytoma, atypical teratoid rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, blastoma, bone cancer, breast cancer, brain cancer, malignant epithelial tumor, carcinoma in situ, carcinosarcoma, chondroma, cementoma, medullary sarcoma, chondroma, chordoma, choriocarcinoma carcinoma, choroid plexus papilloma, renal clear cell sarcoma, craniopharyngioma, cutaneous T-cell lymphoma, cervical cancer, colorectal cancer, Degos disease, desmoplastic small round cell tumor, dysembryoplastic neuroepithelioma, dysgerminoma, embryonal carcinoma, endocrine gland tumor, endodermal sinus tumor, esophageal cancer, fibrosarcoma, follicular lymphoma, follicular thyroid cancer, ganglioneuroma, gastrointestinal cancer, germ cell tumor, gestational choriocarcinoma, giant cell fibroblastoma, giant cell tumor of bone, glial tumor, glioblastoma, glioma, glioma cerebri, glucagonoma, gonadoblastoma, granulosa cell tumor, ovarian gynecoblastoma, gallbladder cancer, gastric cancer, hemangioblastoma, head and neck cancer, hemangiopericytoma , hepatoblastoma, hepatocellular carcinoma, hepatosplenic T-cell lymphoma, invasive lobular carcinoma, intestinal cancer, kidney cancer, laryngeal cancer, malignant lentigo, fatal midline cancer, leukemia, Leydig cell tumor, liposarcoma, lung cancer, lymphangioma, lymphangiosarcoma, lymphoepithelioma, liver cancer, small cell lung cancer, non-small cell lung cancer, malignant fibrous histiocytoma, malignant peripheral nerve sheath tumor, malignant salamander tumor, mediastinal germ cell tumor, medullary breast cancer, medullary thyroid cancer, medulloblastoma, melanoma, meningioma, Merkel cell carcinoma, mesothelioma, metastatic urothelial carcinoma, mixed mullerian tumor, myxoma, muscle tissue tumor, mycosis fungoides, myxoid liposarcoma, myxoma, myxosarcoma, nasopharyngeal carcinoma, nerve sheath tumor, neuroblastoma, Neurofibroma, neuroma, nodular melanoma, eye cancer, oligoastrocytoma, oligodendroglioma, oncocytoma, optic nerve sheath meningioma, optic neuroma, oral cancer, osteosarcoma, ovarian cancer, papillary thyroid cancer, paraganglioma, pinealoblastoma, pineocytoma, pituitary cell tumor, pituitary adenoma, pituitary tumor, plasma cell tumor, polyembryonic tumor, primary central nervous system lymphoma, primary effusion lymphoma, primary peritoneal cancer, prostate cancer, pancreatic cancer, pharyngeal cancer, pseudomyxoma peritonei, renal cell carcinoma, renal medullary carcinoma, retinoblastoma, rhabdomyoma, rhabdomyosarcoma, rectal cancer, sarcoma, schwannoma, seminoma, Sertoli cell tumor, sex cord-gonadal stromal tumor, skin cancer, small cell carcinoma,Soft tissue sarcoma, somatostatinoma, spinal tumor, squamous cell carcinoma, synovial sarcoma, small intestine cancer, squamous cell carcinoma, gastric cancer, testicular cancer, thyroid cancer, transitional cell carcinoma, laryngeal cancer, urachal carcinoma, genitourinary system cancer, urothelial carcinoma, uveal melanoma, uterine cancer, verrucous carcinoma, optic glioma, vulvar cancer, vaginal cancer, Warthin tumor, Wilms tumor, head and neck squamous cell carcinoma, esophageal adenocarcinoma, gastric adenocarcinoma, colon adenocarcinoma, hepatocellular carcinoma, bile duct system bile duct carcinoma, gallbladder adenocarcinoma, pancreatic adenocarcinoma, breast ductal carcinoma in situ, breast adenocarcinoma, lung adenocarcinoma, lung squamous cell carcinoma, bladder transitional cell carcinoma, bladder squamous cell carcinoma, cervical squamous cell carcinoma, cervical adenocarcinoma, endometrial cancer, penis squamous cell carcinoma and skin squamous cell carcinoma.

[0128] In some embodiments, the cancer is esophageal cancer, kidney cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder cancer / urinary tract cancer, head and neck cancer, prostate cancer, blood cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, or colorectal cancer.

[0129] In some embodiments, the cancer is pancreatic cancer. In one embodiment, the cancer is esophageal cancer.

[0130] In some embodiments, the cancer is a blood cancer selected from the group consisting of acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse B large cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter's transformation, acute eosinophilic leukemia, acute erythroid leukemia, acute lymphoblastic leukemia, acute megakaryocytic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-cell lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma.

[0131] In some embodiments, the hematological cancer is selected from the group consisting of acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), follicular lymphoma (FL), Waldenstrom's macroglobulinemia (WM), diffuse B large cell lymphoma (DLBCL), marginal zone lymphoma (MZL) (including extranodal and nodal MZL), hairy cell leukemia (HCL), Burkitt's lymphoma (BL) and Richter's transformation.

[0132] In some embodiments, the cancer is refractory to traditional chemotherapy.

[0133] In some embodiments, the cancer has recurred.

[0134] The SETD2 inhibitors used in the methods described herein (alone or in combination with one or more additional therapeutic agents or therapeutic procedures) can be administered in any order or at any interval as determined by one skilled in the art.

[0135] In some embodiments, the treatment by the methods described herein can continue indefinitely (i.e., as maintenance therapy). In some embodiments, the treatment performed by the methods described herein can last up to about 18 weeks, up to about 17 weeks, up to about 16 weeks, up to about 15 weeks, up to about 14 weeks, up to about 13 weeks, or up to about 12 weeks. In some embodiments, the treatment lasts for about 12 weeks. In some embodiments, the treatment performed by the methods described herein can last between about 1 week and about 52 weeks, between about 1 week and about 26 weeks, between about 1 week and about 12 weeks, between about 1 week and about 6 weeks, between about 6 weeks and about 52 weeks, between about 6 weeks and about 26 weeks, or between about 12 weeks and about 52 weeks. In some embodiments, the treatment performed by the methods described herein can last for more than 52 weeks.

[0136] The present invention is further illustrated by the following examples, which should not be construed as further limiting.The contents of all patent and non-patent references cited throughout this application are expressly incorporated herein by reference in their entirety.

[0137] Examples

[0138] Example 1:

[0139] Pancreatic ductal adenocarcinoma (PDAC) cell lines depend on SETD2 for proliferation

[0140] CRISPR pooling screening.249 cancer cell lines and non-transformed MCF10A cell line (control) were infected with pooled lentivirus containing a CRISPR-sgRNA library targeting different genes, including human SETD2. Cell lines were obtained from ATCC, DSMZ or JCRB cell banks. Figure 1A and 1B Each bar in the graph in represents a cell line. The LogP score on the Y axis of the graph represents the depletion of a specific target in the population. Therefore, the LogP score indicates the dependence of each cell line on a specific gene. In this case, the survival of each cell line with a LogP score below -2.5 depends on SETD2. Table 1 lists all cell lines and their average LogP and median fold change values.

[0141] Figure 1A Plots for all 250 cell lines studied are shown. Figure 1B A diagram of a cell line derived from pancreatic ductal adenocarcinoma (PDAC) is shown. Of note, Figure 1B Several pancreatic cancer cell lines were shown to be remarkably sensitive to depletion of the SETD2 gene.

[0142] In addition to demonstrating that cell lines derived from pancreatic cancer are sensitive to SETD2 depletion, Figure 1A Additional cancer cell lines also shown to be sensitive to SETD2 depletion include breast, esophageal, kidney, lung, gastric, bladder / urinary tract, endometrial, skin, hematopoietic (DLBCL and AML), soft tissue, CNS, and ovarian cell lines.

[0143] Table 1

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151] Validation of CRISPR pooling screens. SU8686 is a cell line derived from pancreatic ductal adenocarcinoma. The cell line was infected with a CRISPR virus containing dual sgRNAs targeting two sites of SETD2. The proliferation of the cell line was measured by automated cell counting over time. Figure 2BAs shown, it was found that the combination of sgRNAs (including one or both of the two sgRNAs targeting the active site of SETD2) had a significant effect on the proliferation of this pancreatic cancer cell line. In contrast, sgRNA targeting the negative control SMARCA2 had no effect on proliferation.

[0152] Next-generation sequencing (NGS) of the sgRNA cutting site was then used to confirm Figure 2B The proliferation data in Figure 2C and 2D shown. Figure 2C and 2D The bar graph in shows the genotype of cells surviving infection over time. Filled bars show the percentage of wild-type (uncleaved) alleles; white bars show in-frame insertions and deletions (presumably non-inactivating); and Filled bars show out-of-frame insertions and deletions (inactive). Figure 2C As shown, in cells infected with SETD2 sgRNA, the wild-type (uncut) population of the allele increased over time, indicating that cells with functional SETD2 have a survival advantage over cells with non-functional SETD2. Figure 2D It was shown that the genotype associated with SMARCA2 sgRNA remained unchanged over time, indicating that SMARCA2 activity is not essential for the activity and growth of SU8686.

[0153] therefore, Figure 2B -D shows that the proliferation of PDAC cell line SU8686 is dependent on SETD2 based on dual sgRNA assay.

[0154] CRISPR domain pool screening identifies SET domains This screen utilized a panel targeting the full length of the SETD2 gene ( Figure 3A sgRNA). Domains important for the function of the encoded protein are depleted at a higher rate than other domains of the protein. This is due to the fact that functional domains are less tolerant to mutations than other regions. Figure 3B As shown, a CRISPR domain screen on the OE21 esophageal cell line revealed the SET domain and the "SET-associated" (AWS) domain from SETD2 ( Figure 3A ), suggesting that targeting the SET domain / active site of SETD2, for example with small molecule inhibitors, will result in a growth phenotype (ie, decreased proliferation) in this cell line.

[0155] Summary of dual assay target validation. Figure 4A summary of the target validation studies is provided in the table. Results of the CRISPR pooling screen for the selected cell lines are shown in the “Epipool” column. Results of the domain-specific CRISPR pooling screen are shown in the “Epidomain” column. These results suggest that the SET domain of SETD2 is required for this effect. Figure 2B ) and NGS confirmation (e.g. Figure 2C and Figure 2D Validation of CRISPR pooling screening results in cell lines is shown in Figure 4 The "Proliferation" and "NGS" columns are labeled The boxes marked with are sensitive; the gray boxes are insensitive; Boxes in red indicate inconclusive results; white boxes indicate data are unavailable.

[0156] in conclusion: Based on dual signal RNA (sgRNA) assays, the viability and growth of pancreatic cancer cell line SU8686 and several other cancer-derived cell lines (e.g., those derived from breast, ovary, lung, stomach, kidney, esophagus, bladder, CNS, soft tissue and skin) depend on SETD2 activity, particularly on SET domain activity. Therefore, inhibition of histone methyltransferase SETD2 (i.e., inhibition with small molecule inhibitors such as alkyl-sinefungin) has broad implications for the treatment of a variety of cancers (and especially pancreatic cancer).

[0157] The present invention has been described above with the aid of functional building blocks (showing the implementation of specific functions and their relationships). For ease of description, the boundaries of these functional building blocks have been arbitrarily defined herein. Alternative boundaries may be defined as long as the specific functions and their relationships are properly performed.

[0158] The foregoing description of specific embodiments will fully reveal the overall nature of the present invention, so that others can easily modify and / or adapt various applications of such specific embodiments without excessive experimentation and without departing from the overall concept of the present invention by applying the knowledge within the art. Therefore, based on the teaching content and guidance proposed herein, such adaptations and modifications are intended to be within the meaning and scope of the equivalents of the disclosed embodiments. It should be understood that the wording or terminology herein is for the purpose of description rather than limitation, so that the terms or wording of this specification will be interpreted by the technician based on the teaching content and guidance.

[0159] All patents and publications mentioned in the specification are indicative of the levels of ordinary skill in the art to which the present disclosure pertains. All patents and publications are incorporated herein by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

Claims

1. A method for treating cancer, the method comprising administering a therapeutically effective amount of a SETD2 inhibitor to a subject in need thereof.

2. A method for reducing or inhibiting the proliferation of cancer cells, the method comprising: (i) contacting the cancer cell with an effective amount of a SETD2 inhibitor; and (ii) reducing or inhibiting the proliferation of said cancer cells.

3. The method of claim 1 or 2, wherein the SETD2 inhibitor is selected from the group consisting of polypeptide, DNA and RNA.

4. The method of any one of claims 1 to 3, wherein the SETD2 inhibitor is an RNAi, miRNA, siRNA, shRNA, antisense RNA, antisense DNA, bait molecule, bait DNA, double-stranded DNA, single-stranded DNA, composite DNA, encapsulated DNA, viral DNA, plasmid DNA, naked RNA, encapsulated RNA, viral RNA, double-stranded RNA, a molecule capable of producing RNA interference or a combination thereof, or a gene editing system that hybridizes to a nucleotide sequence encoding a SETD2 polypeptide under stringent conditions.

5. The method of any one of claims 1-3, wherein the SETD2 inhibitor is a small molecule compound.

6. The method of claim 5, wherein the small molecule compound is a sinefungin derivative selected from the group consisting of N-propyl sinefungin and N-benzyl sinefungin.

7. The method of any one of claims 1-6, wherein the cancer or cancer cell is selected from the group consisting of: adrenal cancer, acinar cell carcinoma, acoustic neuroma, acral lentiginous melanoma, acrohidrosis, adenocarcinoma, adenoid cystic carcinoma, adenoma, odontogenic adenomatous tumor, adenosquamous carcinoma, adipose tissue tumor, adrenocortical carcinoma, AIDS-related lymphoma, alveolar rhabdomyosarcoma, alveolar soft tissue sarcoma, ameloblastic fibroma, anaplastic large cell lymphoma, anaplastic thyroid carcinoma, angiomyolipoma, angiosarcoma, astrocytoma, atypical teratoid rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, blastoma, bone cancer, breast cancer, brain cancer, malignant epithelial tumor, carcinoma in situ, carcinosarcoma, chondroma, cementoma, myeloid sarcoma, soft tissue tumor, Osteoma, Chordoma, Choriocarcinoma, Choroid plexus papilloma, Clear cell sarcoma of the kidney, Craniopharyngioma, Cutaneous T-cell lymphoma, Cervical cancer, Colorectal cancer, Degos disease, Desmoplastic small round cell tumor, Dysembryoplastic neuroepithelioma, Germinoma, Embryonic carcinoma, Endocrine gland tumor, Endodermal sinus tumor, Esophageal cancer, Fibrosarcoma, Follicular lymphoma, Follicular thyroid cancer, Ganglioneuroma, Gastrointestinal cancer, Germ cell tumor, Gestational choriocarcinoma, Giant cell fibroblastoma, Giant cell tumor of bone, Glioma, Glioblastoma, Glioma, Gliomatosis cerebri, Glucagonoma, Gonadoblastoma, Granular cell tumor, Ovarian gynecoma, Gallbladder cancer, Gastric cancer, Hemangioblastoma, Head and neck cancer, Vascular Pericytoma, hepatoblastoma, hepatocellular carcinoma, hepatosplenic T-cell lymphoma, infiltrating lobular carcinoma, intestinal cancer, kidney cancer, laryngeal cancer, lentigo maligna, fatal midline cancer, leukemia, Leydig cell tumor, liposarcoma, lung cancer, lymphangioma, lymphangiosarcoma, lymphoepithelioma, liver cancer, small cell lung cancer, non-small cell lung cancer, malignant fibrous histiocytoma, malignant peripheral nerve sheath tumor, malignant salamander tumor, mediastinal germ cell tumor, medullary breast cancer, medullary thyroid cancer, medulloblastoma, melanoma, meningioma, Merkel cell carcinoma, mesothelioma, metastatic urothelial carcinoma, mixed mullerian tumor, myxoma, muscle tissue tumor, mycosis fungoides, myxoid liposarcoma, myxoma, myxosarcoma, nasopharyngeal carcinoma, nerve sheath tumor, neuroblastoma, neurofibroma , neuroma, nodular melanoma, eye cancer, oligoastrocytoma, oligodendroglioma, oncocytoma, optic nerve sheath meningioma, optic neuroma, oral cancer, osteosarcoma, ovarian cancer, papillary thyroid cancer, paraganglioma, pinealoblastoma, pineocytoma, pituitary cell tumor, pituitary adenoma, pituitary tumor, plasma cell tumor, polyembryonic tumor, primary central nervous system lymphoma, primary effusion lymphoma, primary peritoneal cancer, prostate cancer, pancreatic cancer, pharyngeal cancer, pseudomyxoma peritonei, renal cell carcinoma, renal medullary carcinoma, retinoblastoma, rhabdomyoma, rhabdomyosarcoma, rectal cancer, sarcoma, schwannoma, seminoma, Sertoli cell tumor, sex cord-gonadal stromal tumor, skin cancer, small cell carcinoma, soft tissue sarcoma, somatostatinoma,Spinal tumors, squamous cell carcinoma, synovial sarcoma, small intestine cancer, squamous cell carcinoma, gastric cancer, testicular cancer, thyroid cancer, transitional cell carcinoma, laryngeal cancer, urachal carcinoma, genitourinary system cancer, urothelial carcinoma, uveal melanoma, uterine cancer, verrucous carcinoma, optic glioma, vulvar cancer, vaginal cancer, Warthin tumor, Wilms tumor, head and neck squamous cell carcinoma, esophageal adenocarcinoma, gastric adenocarcinoma, colon adenocarcinoma, hepatocellular carcinoma, bile duct system bile duct carcinoma, gallbladder adenocarcinoma, pancreatic adenocarcinoma, breast ductal carcinoma in situ, breast adenocarcinoma, lung adenocarcinoma, lung squamous cell carcinoma, bladder transitional cell carcinoma, bladder squamous cell carcinoma, cervical squamous cell carcinoma, cervical adenocarcinoma, endometrial cancer, penis squamous cell carcinoma and skin squamous cell carcinoma.

8. The method of any one of claims 1-7, further comprising the step of administering one or more additional therapeutic agents.

9. A SETD2 inhibitor for use in a method for treating cancer as claimed in any one of claims 1 or 3-8.

10. A method of treating cancer, the method comprising inhibiting the activity of SETD2 in a subject in need thereof.

Images