Method for improving heat stress tolerance and / or yield of rice

Abstract

The invention discloses a method for improving heat stress tolerance and / or yield of rice. The rice OsHTT5 gene is mutated by utilizing a CRISPR / Cas9 gene editing system, an OsHTT5 protein function deletion mutant strain is constructed, heat stress is carried out on the OsHTT5 protein function deletion mutant strain, and it is found that the tolerance of rice to heat stress can be remarkably improved by inhibiting expression of the OsHTT5 protein. In addition, by inhibiting the expression of the OsHTT5 protein, the average setting rate, the plant height, the total grain number per panicle, the weight per plant and the length per panicle of the rice can be remarkably increased, so that the yield of the rice is increased. On the basis, the preparation capable of inhibiting the expression of the OsHTT5 protein can be used for improving the heat stress tolerance and yield of the rice, constructing a heat stress resistant rice strain and the like. The method is beneficial to cultivation of heat stress-resistant and high-yield rice varieties, and is beneficial to reduction of adverse effects on rice yield caused by climate warming.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and more specifically relates to a method for improving the heat stress tolerance and / or yield of rice. Background Art

[0002] Heat stress refers to the phenomenon that the environmental temperature exceeds the upper limit of the temperature that the organism can withstand for normal growth and development, causing the organism to produce a series of stress responses at the physiological, biochemical and molecular levels. Heat stress is the main abiotic stress that restricts crop yield and quality. For example, heat stress will affect the normal growth and development of rice, leading to dead seedlings and reduced tillering. During the meiosis and flowering stages of rice, heat stress can lead to a decrease in the rice fruiting rate and pollen abortion, thus affecting the final yield. In addition, heat stress will cause the chalky grain rate and chalky area of ​​rice to increase, resulting in a decrease in rice quality.

[0003] Global warming has led to an increase in average temperatures, and has also increased the frequency and intensity of extreme high temperature events (such as heat waves), causing heat stress to crops. Rice is an important food crop, and ensuring its yield is of great significance to food security. Therefore, it is necessary to study the response mechanism of rice to heat stress and cultivate heat-resistant rice varieties to reduce the adverse effects of climate warming on rice yield.

[0004] NAC transcription factors are a class of transcription factors that are widely present in plants. They are one of the largest transcription factor families in plants and play a key regulatory role in plant growth and development, including seed germination, secondary cell wall growth, root development, leaf senescence, flower formation and senescence, and fruit ripening. NAC transcription factors are also involved in plant responses to abiotic stresses, such as tolerance to drought, salt stress, and heavy metals. NAC transcription factors related to heat tolerance in rice may be mined. However, different NAC transcription factors in different plants respond to different abiotic stresses. Among the NAC transcription factors reported so far, more are related to drought resistance and fewer are related to heat tolerance. Summary of the invention

[0005] In order to improve the tolerance and yield of rice to heat stress, the present invention analyzes and explores various genes of rice, discovers a protein related to the resistance of rice to heat stress, named OsHTT5 protein, and thus provides a method for improving the tolerance and / or yield of rice to heat stress, as well as related applications of preparations for inhibiting the expression of OsHTT5 protein.

[0006] The first object of the present invention is to provide a method for improving the heat stress tolerance and / or yield of rice.

[0007] The second object of the present invention is to provide a use of an agent for inhibiting the expression of OsHTT5 protein in improving the tolerance of rice to heat stress or in preparing a product for improving the tolerance of rice to heat stress.

[0008] The third object of the present invention is to provide a use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with improved tolerance to heat stress.

[0009] The fourth object of the present invention is to provide use of an agent for inhibiting the expression of OsHTT5 protein in increasing rice yield or in preparing a product for increasing rice yield.

[0010] A fifth object of the present invention is to provide use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with improved yield.

[0011] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0012] The present invention mutates the gene encoding the OsHTT5 protein in rice through the CRISPR / Cas9 gene editing system, constructs a mutant strain with loss of function of the OsHTT5 protein, and subjects it to heat stress. It is found that inhibiting the expression of the OsHTT5 protein can significantly improve the tolerance of rice to heat stress. In addition, inhibiting the expression of the OsHTT5 protein can also significantly increase the average fruiting rate, plant height, total number of grains per panicle, single plant weight and length per panicle of rice, thereby increasing rice yield. Based on this, the present invention provides a method for improving the tolerance and / or yield of rice to heat stress.

[0013] Specifically, the method is: inhibiting the expression of OsHTT5 protein in rice.

[0014] Specifically, the amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO.3.

[0015] Specifically, the expression of the OsHTT5 protein in rice is inhibited by interfering with the expression of the gene encoding the OsHTT5 protein, or by mutating or knocking out the coding region or promoter of the gene encoding the OsHTT5 protein.

[0016] More specifically, the expression of the gene encoding the OsHTT5 protein is interfered with by RNA interference technology; the coding region or promoter of the gene encoding the OsHTT5 protein is mutated by a gene editing system, or the gene sequence encoding the OsHTT5 protein is deleted by gene editing technology, or the gene sequence encoding the OsHTT5 protein is knocked out by homologous recombination to inhibit the expression of the OsHTT5 protein in rice.

[0017] Specifically, the mutation includes base insertion, deletion or base conversion.

[0018] Optionally, the nucleotide sequence of the gene encoding the OsHTT5 protein (OsHTT5 gene) is shown in SEQ ID NO.1.

[0019] Optionally, the nucleotide sequence of the coding region of the OsHTT5 gene is shown as SEQ ID NO.2.

[0020] Optionally, the gene editing system is a CRISPR / Cas9-based gene editing system.

[0021] In a specific embodiment of the present invention, the expression of OsHTT5 protein in rice is inhibited by mutating the gene encoding OsHTT5 protein.

[0022] Specifically, the method for inhibiting the expression of OsHTT5 protein in rice is as follows: designing a CRISPR / Cas9-based sgRNA sequence for the gene (or target sequence) encoding the OsHTT5 protein, connecting a DNA fragment containing the sgRNA sequence encoding the sgRNA sequence to a pCRISPR / Cas9 vector carrying a Cas9 expression cassette and transforming rice callus to achieve site-directed mutagenesis of the gene encoding the OsHTT5 protein, thereby rendering the OsHTT5 protein inoperable.

[0023] Specifically, the target sequence recognized by sgRNA conforms to the 5'-N X -NGG-3' or 5'-N X -NTT-3' sequence rule; where N represents any one of A, T, C, G, x is an integer between 17 and 20, N X express X consecutive deoxyribonucleotides.

[0024] As an optional embodiment, the nucleotide sequence of the target site recognized by the sgRNA is shown as SEQ ID NO.4 or SEQ ID NO.9.

[0025] In addition to using CRISPR / Cas9 genome editing technology, gene editing technologies such as zinc finger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs) can also be used to mutate the gene encoding the OsHTT5 protein.

[0026] Specifically, the present invention obtains a mutant strain with loss of OsHTT5 protein function by mutating the gene encoding the OsHTT5 protein in rice, comprising the following steps:

[0027] S1. Design sgRNA target sequence and adapter primer;

[0028] S2. Constructing the sgRNA vector containing the target sequence fragment: synthesizing the adapter primer, denaturing the adapter primer and moving it to room temperature to cool and complete annealing; connecting the annealed primer pair to the sgRNA vector after enzyme digestion, and verifying the positive plasmid by PCR amplification and sequencing;

[0029] S3. Construction of pCRISPR / Cas9 vector containing target sequence fragment: Cut the gRNA expression cassette containing the target sequence fragment from the gRNA, and then connect it to the pCRISPR / Cas9 vector containing the Cas9 expression cassette;

[0030] S4. Transformation: The pCRISPR / Cas9 vector containing the target site is transformed into rice callus tissue, and positive transgenic plants are identified through screening, differentiation and rooting.

[0031] S5. Identification of mutation sites: Extract DNA from positive plants, design identification primers to amplify the extracted DNA, purify it, sequence it, and analyze the mutation.

[0032] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.4, the nucleotide sequences of the adapter primers are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0033] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.9, the nucleotide sequences of the adapter primers are shown in SEQ ID NO.10 and SEQ ID NO.11.

[0034] Specifically, the nucleotide sequences of the primer pair used to identify the mutation site are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0035] Specifically, the rice is japonica rice.

[0036] More specifically, the rice is the japonica rice variety Zhonghua 11.

[0037] Since inhibiting the expression of OsHTT5 protein in rice can improve its tolerance to heat stress and yield, the present invention claims the use of an agent for inhibiting the expression of OsHTT5 protein in improving the tolerance of rice to heat stress or in preparing a product for improving the tolerance of rice to heat stress.

[0038] Specifically, the improving the tolerance of rice to heat stress is improving the tolerance of rice to heat stress at the seedling stage.

[0039] The present invention also claims the use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with improved tolerance to heat stress.

[0040] The present invention also claims the use of the agent for inhibiting the expression of OsHTT5 protein in increasing rice yield or in preparing a product for increasing rice yield.

[0041] Specifically, the agent increases rice yield by increasing the average fruit setting rate, total number of grains per panicle, length per panicle, plant height and / or single plant weight of rice.

[0042] The present invention also claims the use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with improved yield.

[0043] Specifically, the agent for inhibiting the expression of OsHTT5 protein includes an agent interfering with the expression of the gene encoding OsHTT5 protein, such as dsRNA, or a vector for mutating or knocking out the gene encoding OsHTT5 protein.

[0044] The present invention has the following beneficial effects:

[0045] The present invention utilizes the CRISPR / Cas9 gene editing system to mutate the rice OsHTT5 gene, constructs an OsHTT5 protein function-deficient mutant strain, and subjects it to heat stress. It is found that inhibiting the expression of the OsHTT5 protein can significantly improve the tolerance of rice to heat stress. In addition, inhibiting the expression of the OsHTT5 protein can also significantly improve the average fruiting rate, plant height, total number of grains per panicle, single plant weight and length per panicle of rice, thereby increasing rice yield. Based on this, the preparation capable of inhibiting the expression of the OsHTT5 protein can be used to improve the tolerance and yield of rice to heat stress, construct a rice strain resistant to heat stress, etc. The present invention is conducive to the cultivation of heat-resistant and high-yield rice varieties, and is conducive to reducing the adverse effects of climate warming on rice yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 The expression response of OsHTT5 gene in rice seedlings under heat stress conditions.

[0047] Figure 2 The phenotypes of the OsHTT5 gene mutant strain and the wild-type Zhonghua 11 strain before and after heat stress treatment.

[0048] Figure 3 These are the test results of the heat stress tolerance of the OsHTT5 gene mutant strain and the wild-type Zhonghua 11 strain. A to D in the figure are the survival rate, ion leakage rate, total chlorophyll content and hydrogen peroxide content test results of the strains, respectively; **p<0.001 in the figure.

[0049] Figure 4These are the results of yield trait analysis of the OsHTT5 gene mutant strain and the wild-type Zhonghua 11 strain. A to E in the figure are the statistical results of average fruit setting rate, plant height, total number of grains per ear, single plant weight and length per ear, respectively; **p<0.01; ***p<0.001. DETAILED DESCRIPTION

[0050] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0051] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0052] The nucleotide sequence of the OsHTT5 gene (gDNA) described in the embodiment of the present invention is shown in SEQ ID NO.1, the nucleotide sequence of the coding region (cDNA) of the OsHTT5 gene is shown in SEQ ID NO.2, and the amino acid sequence of the OsHTT5 protein encoded thereby is shown in SEQ ID NO.3.

[0053] Example 1 Expression response of OsHTT5 gene in rice seedlings under heat stress conditions

[0054] The present invention designs qPCR primers of the OsHTT5 gene and detects the expression response of the OsHTT5 gene in rice at the seedling stage under heat stress treatment conditions by qPCR.

[0055] The rice used in the experiment was 14-day-old seedlings of the japonica rice variety Zhonghua 11. The heat stress treatment conditions were: 45°C, 12h light / 12h dark. Samples were taken at 0, 6, 12, and 24h of heat treatment, and total RNA was extracted and reverse transcribed into cDNA. The obtained cDNA was used as a template for qPCR detection, and Actin was the internal reference.

[0056] The nucleotide sequences of the qPCR primers and internal reference primers used in qPCR detection are as follows:

[0057] qPCR Primer F: ATCAAGAAGGCGCTCGTGT

[0058] qPCR Primer R: CGTGCATGATCCACTCCGTC

[0059] Internal reference primer F: CACATTCCAGCAGATGTGGA

[0060] Internal reference primer R: GCGATAACAGCTCCTCTTGG

[0061] The qPCR reaction system and reaction conditions are shown in Tables 1 and 2 below respectively:

[0062] Table 1 qPCR reaction system

[0063]

[0064]

[0065] Table 2 qPCR reaction conditions

[0066]

[0067] The expression response of OsHTT5 gene in rice seedlings under heat stress conditions is shown in Figure 2. Figure 1 As shown. Figure 1 It can be seen that the expression level of OsHTT5 reached a peak at the 6th and 12th hours after heat treatment and then showed a decreasing trend, indicating that it responded to heat stress.

[0068] Example 2 Obtaining OsHTT5 gene mutant strains htt5-1 and htt5-2

[0069] The present invention utilizes CRISPR / Cas9 technology to mutate the OsHTT5 gene, thereby constructing an OsHTT5 gene mutant strain, and the specific process is as follows:

[0070] 1. Design of sgRNA target sequence and adapter primer

[0071] For the OsHTT5 gene (nucleotide sequence as shown in SEQ ID NO. 1), the target sequence was designed using the targetDesign applet (http: / / skl.scau.edu.cn / targetdesign / ) (reference: DOI: http: / / dx.doi.org / 10.1016 / j.molp.2017.06.004).

[0072] The sgRNA target sequence (5'→3') designed in this example is as follows:

[0073] Target-HTT5-U3: CCTCTACCGCCACGACCCAT(SEQ ID NO.4)

[0074] Based on the target sequence, the designed adapter primers with sticky ends (5'→3') are as follows:

[0075] Target-HTT5-U3F:ggcaCCTCTACCGCCACGACCCAT(SEQ ID NO.5)

[0076] Target-HTT5-U3R:aaacATGGGTCGTGGCGGTAGAGG(SEQ ID NO.6)

[0077] 2. Construction of pU3-gRNA vector containing Target-HTT5 fragment

[0078] Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the above-mentioned adapter primers with sticky ends. The synthesized adapter primers were heated at 90°C for 30s to denature and then moved to room temperature for cooling to complete annealing. The annealed primers were connected to the pU3-gRNA vector after enzyme digestion. After PCR amplification and sequencing verification, the pU3-gRNA vector containing the Target-HTT5-U3 fragment was obtained.

[0079] The PCR primers used for PCR verification were Target-HTT5-U3F / Target-HTT5-U3R.

[0080] 3. Construction of pCRISPR / Cas9 vector containing Target-HTT5-U3 fragment

[0081] The expression cassette of the Target-HTT5-U3 fragment was cut out from the pU3-gRNA vector containing the Target-HTT5-U3 fragment, and connected to the pCRISPR / Cas9 vector containing the Cas9 expression cassette. After PCR amplification and sequencing verification, the pCRISPR / Cas9 vector containing the Target-HTT5-U3 fragment was obtained.

[0082] 4. Obtaining mutant strains

[0083] The pCRISPR / Cas9 vector containing the target (Target-HTT5-U3) was transformed into callus tissue of the rice variety Zhonghua 11 through Agrobacterium tumefaciens-mediated genetic transformation; after secondary screening, differentiation and rooting into seedlings, the resulting plants were planted in a net room, and mutant strains were identified and screened by sequencing.

[0084] 5. Sequencing and identification of mutation sites in mutant strains

[0085] The genomic DNA (gDNA) of the screened mutant strain was extracted and used as a template for PCR amplification with primers HTT5TF (AGATCGAACACCTCGTGTCC; shown in SEQ ID NO.7) and HTT5TR (TGAGCACAACATGGTGAACT; shown in SEQ ID NO.8). The product was purified and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target sequence of the wild-type Zhonghua 11 plant before mutation to analyze the mutation.

[0086] The PCR amplification reaction system is shown in Table 3:

[0087] Table 3 PCR amplification reaction system

[0088]

[0089] The PCR amplification reaction conditions were as follows: 94°C for 2 min; 94°C for 20 sec, 58°C for 20 sec, 72°C for 30 sec, 30 cycles; 72°C for 5 min.

[0090] In this example, two different mutant strains were obtained, which were named htt5-1 and htt5-2. The sequencing results (5'→3') of the wild-type Zhonghua 11 and the mutant strains are as follows:

[0091] WT: CGACCTCTACCGCCACGACCCATGGGACCTCCCCCGGGACCTCCC CCACCGCGCCCTCTTCG

[0092] htt5-1:CGACCTCTACCGCCACGACC AC ATGGGACCTCCCCCGGGACCTCCCCCACCGCGCCCTCTTCG

[0093] htt5-2: CGACCTCTACCGCCACGACC--ATGGGACCTCCCCCGGGACCTCCCCCACCGCGCCCTCTTCG

[0094] Among them, WT indicates wild type; htt5-1 and htt5-2 indicate different mutant strains; the “ AC" is the mutated base; "--" in the sequence indicates base deletion. By comparison, the mutant strain obtained in this embodiment has base deletion or mutation in the target sequence compared with the wild type, indicating that the present invention successfully mutated the OsHTT5 gene and obtained the OsHTT5 gene mutant strain (OsHTT5 protein function loss mutant strain). Example 3 Obtaining OsHTT5 gene mutant strains htt5-3 and htt5-4

[0095] In this example, the OsHTT5 gene was mutated using the same method as in Example 2, except that a different target sequence was used.

[0096] The sgRNA target sequence (5'→3') designed in this example is as follows:

[0097] Target-HTT5-U6:TCCCGGCCGGACGACGGCTT(SEQ ID NO.9)

[0098] Based on the target sequence, the designed adapter primers with sticky ends (5'→3') are as follows:

[0099] Target-HTT5-U6F:GCCGTCCCGGCCGGACGACGGCTT(SEQ ID NO.10)

[0100] Target-HTT5-U6R:AAACAAGCCGTCGTCCGGCCGGGA(SEQ ID NO.11)

[0101] In this example, two different mutant strains were obtained, which were named htt5-3 and htt5-4. The sequencing results (5'→3') of the wild-type Zhonghua 11 and the mutant strains are as follows:

[0102] WT: CGGCGGCGCAGTCGTGGGGGGAGACGCGGACGCCGGAGTCGGA GGTCGTCGACAGCGACG

[0103] htt5-3:CGGCCGGCCATCGTGGGGGGAG G ACGCGGACGCCGGAGTCGGAGGTCGTCGACAGCGACG

[0104] htt5-4:CGGCGGCGCAGTCGTGGGGG------TCGTCGACAGCGACG

[0105] Among them, WT indicates wild type; htt5-3 and htt5-4 indicate different mutant strains; the “G " is the mutated base; "------" in the sequence indicates base deletion. By comparison, compared with the wild type, the mutant strain obtained in this embodiment has base deletion or mutation in the target sequence, indicating that the present invention successfully mutated the OsHTT5 gene and obtained the OsHTT5 gene mutant strain (OsHTT5 protein function loss mutant strain).

[0106] Example 4 Detection of the tolerance of OsHTT5 gene mutant strains to heat stress

[0107] In this example, the positive mutant strains htt5-1 and htt5-2 identified in Example 2 were subjected to heat stress treatment, and the phenotypic changes of the plants before and after heat stress treatment were compared, and the survival rate (%), ion leakage rate (%), total chlorophyll content (mg / g) and hydrogen peroxide (H 2 O 2 ) content (μM / g FW) was measured to observe the effect of the mutant OsHTT5 gene on the tolerance of rice to heat stress.

[0108] Heat stress treatment: Select a number of plump seeds of the wild type Zhonghua 11, OsHTT5 gene mutant strains htt5-1 and htt5-2, soak them in water, and clamp them on a 96-well plate for hydroponics after the seeds germinate; after growing for 14 days, select seedlings with consistent growth and treat them with heat stress respectively. The heat stress treatment conditions are: 45℃, 12h light / 12h dark, and the heat stress treatment time is 7 days; after heat stress treatment, place them at 28℃ for recovery, and the recovery time is 5 days.

[0109] Determination of ion leakage rate (R1 / R2): 10 mL of sterile ddH 2 O is added to a 15mL sterile centrifuge tube, 0.05g of rice seedling leaves of equivalent size are cut into small pieces, placed in the above 15mL centrifuge tube, the leaves are completely immersed in it, and shaken at 100rpm at room temperature overnight; after overnight, the 15mL centrifuge tube is turned upside down to mix, and then the value R1 is measured with a conductivity meter; after the value R1 is obtained, the 15mL centrifuge tube is put into boiling water and boiled for 15 minutes, and after naturally cooling to room temperature, the conductivity meter is used for a second measurement to obtain the value R2; the ratio of R1 to R2 is the ion leakage rate.

[0110] Hydrogen peroxide (H 2 O 2 ) content: Use the Biyuntian Hydrogen Peroxide Content Detection Kit (Cat. No.: S0038) for determination. For specific operations, please refer to the kit instructions.

[0111] The phenotypes of the OsHTT5 gene mutant and wild-type Zhonghua 11 before and after heat stress treatment are shown in Figure 2. Figure 2 As shown. Figure 2 It can be seen that after heat stress treatment, the leaves of htt5-1 and htt5-2 mutant strains did not shrink or die after heat stress treatment, while the wild-type plants showed high temperature intolerance.

[0112] The results of the heat stress tolerance test of the OsHTT5 gene mutant strain and the wild-type Zhonghua 11 strain are shown in Figure 3 As shown, Figure 3 A to D in the figure are the test results of strain survival rate, ion leakage rate, total chlorophyll content and hydrogen peroxide content. Figure 3 It can be seen that compared with the wild type Zhonghua 11, the ion leakage rate and hydrogen peroxide content of the OsHTT5 gene mutant strains htt5-1 and htt5-2 after heat stress treatment were decreased, and the survival rate and total chlorophyll content were increased, with significant differences (p < 0.001), indicating that by mutating the rice OsHTT5 gene and inhibiting the expression of OsHTT5 protein, the tolerance of rice to heat stress can be significantly improved.

[0113] Example 5 Yield trait analysis of OsHTT5 gene mutant strains

[0114] Several full seeds of the wild-type Zhonghua 11, OsHTT5 gene mutant lines htt5-1 and htt5-2 were selected and grown to maturity according to conventional planting and management methods, and yield traits were analyzed (average fruit setting rate, plant height, total number of grains per ear, single plant weight (weight of the rice ear of the whole plant) and length of each ear were counted respectively).

[0115] The yield trait analysis results of the OsHTT5 gene mutant strain and the wild-type Zhonghua 11 strain are shown in Figure 4 As shown, Figure 4 A to E in the figure are the statistical results of average fruit setting rate, plant height, total number of grains per ear, plant weight and length of each ear. Figure 4 It can be seen that the average fruit setting rate, plant height, total number of grains per panicle, single plant weight and panicle length of the OsHTT5 gene mutant strains htt5-1 and htt5-2 were significantly different from those of the wild type Zhonghua 11 (p < 0.01 or p < 0.001), indicating that by mutating the rice OsHTT5 gene and inhibiting the expression of OsHTT5 protein, the average fruit setting rate, plant height, total number of grains per panicle, single plant weight and panicle length of rice can be significantly improved, thereby increasing rice yield.

[0116] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A method for improving the tolerance and / or yield of rice to heat stress, characterized in that: The method comprises: inhibiting the expression of OsHTT5 protein in rice; the amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO.

3.

2. The method according to claim 1, characterized in that: The expression of the OsHTT5 protein in rice is inhibited by interfering with the expression of the gene encoding the OsHTT5 protein, or by mutating or knocking out the coding region or the promoter of the gene encoding the OsHTT5 protein.

3. Use of an agent for inhibiting the expression of OsHTT5 protein in improving the tolerance of rice to heat stress or in preparing a product for improving the tolerance of rice to heat stress, characterized in that: The amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO.

3.

4. Use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with improved tolerance to heat stress, characterized in that: The amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO.

3.

5. Use of an agent for inhibiting the expression of OsHTT5 protein in increasing rice yield or in preparing a product for increasing rice yield, characterized in that: The amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO.

3.

6. The use according to claim 5, characterized in that: The agent increases rice yield by increasing the average fruit setting rate of rice.

7. The use according to claim 5, characterized in that: The agent increases rice yield by increasing the total number of grains per panicle of rice.

8. The use according to claim 5, characterized in that: The agent increases rice yield by increasing the length of each ear of rice.

9. The use according to claim 5, characterized in that: The agent increases rice yield by increasing the weight per plant of rice.

10. Use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with increased yield, characterized in that: The amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO.3.

Images