Method for efficiently knocking out pseudomonas fluorescens flic gene

Abstract

The invention belongs to the field of microbial genetic engineering, and particularly relates to a method for efficiently knocking out a pseudomonas fluorescens flic gene. The method comprises the following steps: firstly, activating a strain and carrying out resistance verification (selecting an antibiotic with the highest sensitivity), then obtaining a fusion fragment of upstream and downstream homologous arms by utilizing an overlapping extension PCR (Polymerase Chain Reaction) technology, constructing a recombinant plasmid vector pT18sacB, then taking S17-1lambdapir as a donor bacterium (carrying a flick-pT18sacB plasmid) of recombinant plasmids to carry out a conjugation transfer experiment, and finally, carrying out screening by utilizing a screening method to obtain a recombinant plasmid vector S17-1lambdapir. And finally, inducing double exchange by using 10% sucrose, and screening by using Tc (tetracycline). The method is efficient, simple and convenient, the gene knockout efficiency is greatly improved, an important reference is provided for popularization and application of a pseudomonas fluorescens gene knockout technology, and meanwhile a new path is opened up for biological function research of flagellin flic genes.

Description

Technical Field

[0001] The invention belongs to the field of microbial genetic engineering, and particularly relates to a method for efficiently knocking out the flic gene of Pseudomonas fluorescens. Background Art

[0002] Pseudomonas fluorescens (P.Fluorescens) is an environmental contaminant. It is a rare opportunistic pathogen for humans. Pseudomonas fluorescens belongs to the genus Pseudomonas, is a chemoheterotrophic Gram-negative bacterium, rod-shaped, and has flagella. It can secrete yellow-green fluorescent pigments to emit fluorescence, and can produce metabolites such as antibiotics and hydrolases. It grows in a neutral environment within the range of 4℃-37℃, and has significant physiological and biochemical characteristics. As a psychrophilic bacterium, it is the most harmful microorganism in milk.

[0003] Flagella are the motile organs of bacteria, which not only help bacteria invade host cells, but also play a toxic role in the bacterial pathogenic process. Flagellar proteins are subunit proteins of flagella, and flagellar proteins of different bacteria have different structures and functions. Flagellar proteins of different bacteria differ in structure, size and function. Even different flagellar proteins of the same bacteria have different immune functions. Because flagellar proteins have a strong immune activation effect, flagellar proteins have been widely used in vaccine development. At present, the research on flagellar proteins in terms of structure, immune function, signaling pathways, etc. is gradually increasing, which helps us deepen our understanding of flagellar proteins. However, there are relatively few studies on flagellar proteins of Pseudomonas fluorescens. Gene knockout technology provides us with an effective idea and method to study flagellar proteins. The functional mechanism of flagellar proteins can be studied by constructing flagellar protein-deficient mutants.

[0004] Bacterial gene knockout is a reverse genetic research method, which belongs to genetic engineering gene modification technology. It mainly targets a genetic gene of interest, and precisely inactivates or deletes its gene sequence by changing or deleting it, thereby causing the loss of the gene function. In this way, the changes in phenotypic traits can be further compared, or the relevant physical and chemical characteristics of the gene-deficient mutant strain can be studied, and the biological function of the gene can be inferred. At present, there are many methods for bacterial gene knockout, and it is impossible to form a unified and effective knockout technology for a specific bacterium. Although gene knockout technology is widely used in the exploration of gene function, it still has the problem of low knockout efficiency. Knockout of target genes in bacteria may cause bacterial death; the role of the same targeting vector in the genetic system of different bacteria may be quite different; different plasmids and bacteria have different requirements for transformation conditions. In addition, there are many types of bacteria, and there are great differences in their morphological structure, gene regulation characteristics, and physical and chemical characteristics. In particular, many bacterial cell walls are thick and have poor permeability, which also leads to low efficiency of bacterial gene knockout.

[0005] At present, most methods for knocking out the gene of Pseudomonas fluorescens have problems such as low transformation efficiency, long homology arms, and cumbersome operation, which to a certain extent limit the study of the gene function of the bacterium. Therefore, the establishment of a gene knockout technology suitable for Pseudomonas fluorescens will provide an important reference for the study of the virulence and pathogenicity of the bacterium. At the same time, the development of an efficient gene knockout scheme for Pseudomonas fluorescens can add a lot to the development and application of bacterial gene editing technology. The present invention not only helps to reveal the functional mechanism of flagellin by constructing a flagellin-deficient mutant strain, but also provides an important reference for the improvement and development of bacterial gene knockout technology. Summary of the invention

[0006] The present invention aims at providing a method for efficiently knocking out the flic gene of Pseudomonas fluorescens.

[0007] A method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525), comprising the following steps:

[0008] S1. Take out the strain stored at low temperature, streak culture, pick a single clone and inoculate it into LB antibiotic-free liquid culture medium, and use bacteria in the logarithmic growth phase to carry out gene knockout experiments;

[0009] S2. Detect and analyze the sensitivity of Pseudomonas fluorescens to antibiotics, and select the antibiotic with the highest sensitivity as the screening antibiotic for plasmid transfected bacteria;

[0010] S3. Use overlap extension PCR amplification technology to construct upstream and downstream homology arms, obtain fused target gene fragments, construct a vector with the fused target gene fragments, and transform Ecoli DH5alphA cells;

[0011] S4. Use plasmid vector pT18sacB to seamlessly clone the target gene and transform Ecoli S17pir competent cells;

[0012] S5, Ecoli S17-1λpir bacteria carrying flic-pT18sacB were used as donor bacteria for the recombinant plasmid, and Pseudomonas fluorescens was used as the recipient bacteria to conduct conjugation transfer experiments;

[0013] S6. Double exchange was induced using 10% sucrose and screened using.

[0014] In step S1, the cryopreservation temperature is -80°C, the bacterial strain used for streaking inoculation is a bacterial solution of Pseudomonas fluorescens, and the culture temperature is 37°C.

[0015] In step S2, the antibiotic used for detection is selected from one of Amp (ampicillin), Kan (kanamycin), Spc (spectinomycin), Cm (chloramphenicol), Gen (gentamicin), Tc (tetracycline), Str (streptomycin) and Apr (ampramycin).

[0016] In step S3, the extracted Pseudomonas fluorescens DNA is used as a template, and primers flic-UP-F / flic-UP-R and flic-down-F / flic-down-R are used to perform PCR amplification, respectively, to obtain the amplified products, namely the upstream homology arm and the downstream homology arm of flic;

[0017] The upstream homology arm and downstream homology arm of the amplified product flic were used as templates and primers flic-up-F / flic-down-R were used for fusion PCR amplification to obtain the fusion target gene fragment.

[0018] The fused target gene fragment was inserted into the pUXT vector to obtain the Flic-UD-T plasmid and transformed into Ecoli DH5alphA cells. The universal primers M13-F (pUC) / M13-R (pUC) (pUC) were used to amplify and screen positive clones by PCR. The amplification conditions were as follows: 94℃5min 30Cycle (94℃30sec, 55℃30sec, 72℃1min) 10℃hold on.

[0019] The PCR amplification system for primers flic-UP-F / flic-UP-R and flic-down-F / flic-down-R was: 94°C 5min 30Cycle (94°C 30sec, 55°C 30sec, 72°C 40sec) 10°C hold on;

[0020] The PCR amplification system of primers flic-up-F / flic-down-R is: 94℃5min 2Cycle (94℃30sec, 50℃30sec, 68℃1min), 30cycle (94℃30sec, 55℃30sec, 68℃1min), 10℃hold on.

[0021] The base sequences of the primers are as follows:

[0022] flic-up-F: TGCTGTATTGCGCGTTGATCGAG;

[0023] flic-up-R:ACCCACGAGGATTTCGTCTAGCCATCGGTAGATGACTGAC;

[0024] flic-down-R: ATCGACGCGCTGATCGTTGTGAC;

[0025] flic-down-F: CATCTACCGATGGCTAGACGAAATCCCTCGTGGGTGGTGTA.

[0026] In step S4, the Flic-UD-T plasmid was used as a template and primers (flic-pT18-smaI-F / flicpT18-smaI-R) were used to amplify the target gene fragment; pT18sacB was cut at the smaI site and the target gene fragment was seamlessly cloned and connected, and the recombinant vector was placed on ice for 30 minutes, chemically transformed into Ecoli S17 pir competent cells, spread on a resistance plate containing the selected antibiotic, and colony PCR identification was performed using primers (M13-F(pUC) / M13-R(pUC)).

[0027] In step S6, primers flic-JD-F / flic-JD-R were used to perform PCR identification on the knockout strain, and primers flic-ter-F / flic-ter-R were used to perform secondary identification on the knockout bacteria, and finally the PCR amplification products were sequenced and identified.

[0028] A flic gene knocked out Pseudomonas fluorescens (ATCC13525), prepared by the method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525) according to any one of claims 1 to 9.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] 1. The present invention uses Amp and Tc as screening antibiotics to obtain the fusion fragment of the upstream and downstream homologous arms by overlapping PCR technology, and seamlessly clones and connects them to the recombinant plasmid vector pT18sacB, then uses S17-1λpir as the donor bacteria of the recombinant plasmid to complete the plasmid transformation of Pseudomonas fluorescens, and knocks out the flagellin gene flic of Pseudomonas fluorescens by sucrose-induced double exchange; in terms of gene knockout technology, its efficient and simple characteristics greatly improve the efficiency, providing a new and reliable method for related research.

[0031] 2. For the study of Pseudomonas fluorescens, it opens the door to a deeper understanding of its biological characteristics. By knocking out the flagellin gene flic, we can clearly observe the impact of gene changes on various aspects of bacteria, helping to explore its growth, reproduction and pathogenicity. In agriculture, it can be better used to promote plant growth or prevent and control diseases; in medicine, it provides new research directions and targets for the treatment of Pseudomonas fluorescens infections, which is of great significance for the development of antibacterial drugs.

[0032] 3. From the perspective of the study of flagellin's biological function, it provides a new perspective. Flagellin plays a key role in many life activities of bacteria, and previous research was limited by technology. This invention enables us to accurately explore its specific functional mechanism in Pseudomonas fluorescens, enrich bacterial biology theory, and promote interdisciplinary research, such as its application in biophysics, biochemistry and other fields.

[0033] 4. It also has great potential in the biotechnology industry. Based on this invention, new products and processes can be developed, such as using modified fluorescent Pseudomonas to carry out environmental bioremediation or optimize the biological fermentation process, improve production efficiency and quality, inject vitality into industrial innovation and sustainable development, and promote the green development of the economy and society. It has broad application prospects and far-reaching social and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0035] Figure 1 1% agarose gel electrophoresis detection of upstream and downstream homology arms of flic provided by the embodiment of the present invention; wherein lane M is trans plus DNA Marker, lane down is the downstream fragment, and lane up is the upstream fragment;

[0036] Figure 2 The gel electrophoresis diagram of the fusion fragment provided in the embodiment of the present invention; wherein lane M is trans plus DNAMarker, lanes UD are fusion fragments;

[0037] Figure 3 This is a colony PCR identification diagram after the recombinant vector provided in the embodiment of the present invention is transformed into Escherichia coli Ecoli DH-5Alpha; wherein lane M is plus DNAMarker, lanes 1-12 refer to randomly picked clone numbers;

[0038] Figure 4 The gel electrophoresis diagram of the fusion fragment amplified by the primers flic-pT18-smaI-F / flic-pT18-smaI-R provided in the embodiment of the present invention; wherein lane M is trans plus DNAMarker, lane 1 is the fusion fragment carrying the pT18sacB recombinant sequence;

[0039] Figure 5 The pT18sacB restriction electrophoresis diagram provided in the embodiment of the present invention; wherein lane M is trans plus DNAMarker, lane 1 plasmid digestion product;

[0040] Figure 6 PCR electrophoresis diagram of the flic-pT18sacB knockout vector provided in the embodiment of the present invention to construct the colony; wherein lane M is trans plus DNAMarker, lanes 1-5 refer to randomly picked clone numbers;

[0041] Figure 7 PCR electrophoresis diagram of flic-JD-F / flic-JD-R for identifying wild-type and knockout bacteria provided by the embodiment of the present invention, lane M is trans DNA Marker, lane 1 is the PCR product referring to the amplification product of the knockout bacteria, and lane 2 is the amplification product of the wild bacteria;

[0042] Figure 8 PCR electrophoresis diagram of flic-ter-F / flic-ter-R for identifying wild bacteria and knockout bacteria provided by the embodiment of the present invention, lane M is trans DNA Marker, lane 1 is the PCR product referring to the amplification product of the knockout bacteria, and lane 2 is the amplification product of the wild bacteria;

[0043] Fig. 9 A design table for primer design of the present invention; wherein, the sequence with a colored background is a sequence that overlaps with the flic gene, and the primer is consistent with the flic gene background color; the sequence without a colored background in the table is a sequence that overlaps with the corresponding plasmid.

[0044] Fig.10 The mRNA and upstream and downstream gene sequence diagram of Pseudomonas fluorescens flic provided in the embodiment of the present invention; the colored sequences are the primers used in the present invention; the capital letters are the mRNA sequences of Pseudomonas fluorescens flic.

[0045] Fig.11 This is the sequencing result of the knockout bacteria provided in the embodiments of the present invention. DETAILED DESCRIPTION

[0046] The following will be combined with the accompanying drawings in the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention.

[0047] The following is combined with Figure 1 To Attachment Fig.11 And specific embodiments, the present invention is described in detail:

[0048] like Figures 1 to 11 As shown, the object of the present invention is to provide a method for efficiently knocking out the flic gene of Pseudomonas fluorescens.

[0049] The purpose of the present invention is achieved through the following technical solutions:

[0050] The sequences with colored background in the table are sequences that overlap with the flic gene (including upstream and downstream sequences), and the primers are consistent with the background color of the flic gene; the sequences without colored background in the table are sequences that overlap with the corresponding plasmid.

[0051] Embodiment 1:

[0052] 1. Activated strains:

[0053] Take out the bacterial solution of Pseudomonas fluorescens (ATCC13525) from the refrigerator. Do not wait for it to completely melt. Immediately and quickly dip a small amount of the liquid that is still in the ice state, and then perform streaking culture. Use a sterilized pipette tip to dip the bacterial solution and carefully streak it on the LB antibiotic-free plate. Then place the plate in a 37°C environment and culture it overnight. After that, pick a single clone from the plate and inoculate it into the LB antibiotic-free liquid culture medium, and activate it at 37°C.

[0054] It should be noted that when performing transfection operations, bacteria in the logarithmic growth phase should be selected, because during this period, the bacterial vitality is the strongest. In addition, for strains stored at -80°C, try to avoid repeated freezing and thawing. After all, as time goes by, if frozen and thawed repeatedly, the vitality of the strain will gradually decrease. Therefore, after taking the strain out of the refrigerator, you can immediately pick a small amount of ice residue liquid for inoculation or streaking culture without waiting for it to melt, so as to maintain the vitality of the strain to the greatest extent.

[0055] 2. Strain resistance verification:

[0056] The sensitivity of Pseudomonas fluorescens to antibiotics was tested and analyzed, specifically covering multiple antibiotics such as Amp (ampicillin), Kan (kanamycin), Spc (spectinomycin), Cm (chloramphenicol), Gen (gentamicin), Tc (tetracycline), Str (streptomycin) and Apr (ampramycin). After a series of rigorous detection experiments, the results clearly showed that Pseudomonas fluorescens was highly sensitive to Tc (tetracycline). In view of this, in the present invention, it was decided to use Tc (tetracycline) as the antibiotic for screening positive clones. This choice is based on in-depth research and accurate judgment of the sensitivity of Pseudomonas fluorescens to antibiotics, aiming to ensure the efficiency and accuracy of the screening process, and provide a strong guarantee for subsequent research and application.

[0057] 3. Construct homology arms:

[0058] First, the extracted Pseudomonas fluorescens DNA was used as a template, and the primers flic-UP-F / flic-UP-R and flic-down-F / flic-down-R were used to perform PCR amplification according to a specific procedure. The specific procedure was: pre-denaturation at 94°C for 5 minutes, followed by 30 cycles, each cycle including denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 40 seconds, and finally maintained at 10°C. After this process, the amplified products are the upstream (1042bp) and downstream (912bp) homology arms of flic, such as Figure 1 shown.

[0059] Subsequently, the amplified flic upstream and flic downstream fragments were recovered by PCR product purification kit, and primers flic-up-F / flic-down-R were used for fusion PCR amplification according to the following system. First, pre-denaturation was performed at 94°C for 5 minutes, followed by 2 cycles, each cycle of denaturation at 94°C for 30 seconds, annealing at 50°C for 30 seconds, and extension at 68°C for 1 minute; then 30 cycles were performed, each cycle of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 68°C for 1 minute, and finally maintained at 10°C. The length of the fusion fragment obtained by overlap extension PCR technology is 1984bp ( Figure 2 ).

[0060] Next, the fusion fragment was inserted into the pUXT vector and transformed into Ecoli DH-5Alpha cells, and the positive clones were amplified and screened using universal primers M13-F (pUC) / M13-R (pUC) (pUC) ( Figure 3 ). PCR amplification conditions were as follows: pre-denaturation at 94°C for 5 min, followed by 30 cycles, each cycle consisting of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, and finally holding at 10°C.

[0061] 4. Construction of recombinant knockout vector

[0062] First, the Flic-UD-T plasmid was used as a template and primers (flic-pT18-smaI-F / flicpT18-smaI-R) were used for amplification. After the amplification was completed, the amplified product was subjected to electrophoresis and then processed by gel excision, recovery and purification. After this series of operations, the obtained fragment length was 1987 bp, as shown in FIG. Figure 4 shown.

[0063] Next, pT18sacB was treated with smaI for single enzyme digestion, the digestion temperature was set to 37°C, and the digestion time was 1 hour. After the digestion was completed, the digestion product was also subjected to gel excision recovery and purification, and its sequence length was 5721 bp, as shown in FIG. Figure 5 shown.

[0064] Finally, a seamless cloning connection operation was performed. After the connection was completed, the recombinant vector was placed on ice for 30 minutes. Subsequently, chemical transformation was performed and it was transformed into Ecoli S17 pir competent cells. Then, a coating operation was performed on a Tc-resistant plate. In addition, colony PCR identification was performed using primers (M13-F (pUC) / M13-R (pUC)), and the fragment length obtained was 2496 bp, as shown in FIG. Figure 6 shown.

[0065] 5. Transformation of recombinant plasmid (combination transfer experiment):

[0066] S17λpir was used as the donor bacteria of the recombinant plasmid. It should be noted that the donor bacteria carried flic-pT18sacB. At the same time, Pseudomonas fluorescens was used as the recipient bacteria to carry out the conjugation transfer experiment. The specific operation is as follows: First, pick a single clone of Pseudomonas fluorescens and inoculate it into LB liquid culture medium; in addition, pick a single clone of S17λpir carrying flic-pT18sacB and inoculate it into LB (Tc10) liquid culture medium. Subsequently, the two bacterial liquids were cultured, and when the optical density value (OD600nm) at a wavelength of 600nm grew to about 0.8, the conjugation transfer experiment was carried out. Next, 700 microliters of ATCC13525 bacterial liquid and flic-pT18 sacB S17 pir were taken, and the two were thoroughly mixed and centrifuged. After that, the bacteria were placed in the center of the sterilized nitrocellulose filter and cultured overnight in LB culture medium. The bacterial solution was washed with 1 ml of LB medium, diluted and spread on Amp / T double-antibody plates.

[0067] 6. Sucrose induced double exchange:

[0068] The positive single exchange strains were inoculated into LB medium containing 10% sucrose. When performing the spot plate operation, those single clones that did not grow under Tc resistance conditions were selected. Then, the knockout strains were identified by PCR using primers flic-JD-F / flic-JD-R. It should be noted that the product fragment of this identification contains the mRNA sequence of flic. The results are shown in Figure 2. Figure 7 As shown in the figure, the length of the PCR product of the wild-type bacteria is 2519 bp, while that of the knockout bacteria is 610 bp. In addition, the knockout bacteria were further identified using primers flic-ter-F / R. The product fragment of the secondary identification is located inside the mRNA sequence of flic. The amplified product is shown in Figure 8 As shown in Figure 1, the length of the PCR product of the wild-type strain is 1439 bp, while that of the knockout strain is 0 bp. Finally, the PCR amplification product was sequenced to ensure the accuracy and reliability of the knockout strain. Fig.10 , 11 shown.

[0069] Primer design:

[0070] like Fig. 9 Shown

[0071] Fig. 9 The sequences with colored background are the sequences that overlap with the flic gene (including upstream and downstream sequences), and the primers are consistent with the background color of the flic gene; the sequences without colored background in the table are the sequences that overlap with the corresponding plasmid. Fig.11 The mRNA and upstream and downstream gene sequence diagram of Pseudomonas fluorescens flic provided in the embodiment of the present invention, wherein the colored sequences are the primers used in the present invention; wherein the capital letters are the mRNA sequences of Pseudomonas fluorescens flic.

[0072] Flagellin plays an important role in the process of Pseudomonas fluorescens invading host cells. The construction of a flagellin-deficient mutant strain will help study the function of flagellin in the infection process of Pseudomonas fluorescens. The present invention constructs an efficient and fast gene knockout method, which not only lays an important foundation for the study of functional genes of Pseudomonas fluorescens, but also provides an important reference for the development and application of bacterial gene knockout technology.

[0073] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. The above embodiments and descriptions are only optional examples of the present invention and are not intended to limit the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525), characterized in that: The following steps are involved: S1. Take out the strain stored at low temperature, streak culture, pick a single clone and inoculate it into LB antibiotic-free liquid culture medium, and use bacteria in the logarithmic growth phase to carry out gene knockout experiments; S2. Detect and analyze the sensitivity of Pseudomonas fluorescens to antibiotics, and select the antibiotic with the highest sensitivity as the screening antibiotic for plasmid transfected bacteria; S3, using overlap extension PCR amplification technology to construct upstream and downstream homology arms, obtain the fused target gene fragment, use the fused target gene fragment to construct a vector, and transform Ecoli DH-5Alpha cells; S4. Use plasmid vector pT18sacB to seamlessly clone the target gene and transform Ecoli S17pir competent cells; S5, Ecoli S17-1λpir bacteria carrying flic-pT18sacB were used as donor bacteria for the recombinant plasmid, and Pseudomonas fluorescens was used as the recipient bacteria to conduct conjugation transfer experiments; S6. Double exchange was induced using 10% sucrose and screened using.

2. A method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525) according to claim 1, characterized in that: In step S1, the cryopreservation temperature is -80°C, the bacterial strain used for streaking inoculation is a bacterial solution of Pseudomonas fluorescens, and the culture temperature is 37°C.

3. The method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525) according to claim 1, characterized in that: In step S2, the antibiotic used for detection is selected from one of Amp (ampicillin), Kan (kanamycin), Spc (spectinomycin), Cm (chloramphenicol), Gen (gentamicin), Tc (tetracycline), Str (streptomycin) and Apr (ampramycin).

4. The method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525) according to claim 1, characterized in that: In step S3 Using the extracted Pseudomonas fluorescens DNA as a template, PCR amplification was performed using primers flic-UP-F / flic-UP-R and flic-down-F / flic-down-R, respectively, and the amplified products obtained were the upstream homology arm and the downstream homology arm of flic; The upstream homology arm and downstream homology arm of the amplified product flic were used as templates and primers flic-up-F / flic-down-R were used for fusion PCR amplification to obtain the fusion target gene fragment.

5. A method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525) according to claim 4, characterized in that: The fused target gene fragment was inserted into the pUXT vector to obtain the Flic-UD-T plasmid and transformed into Ecoli DH5alphA cells. The universal primers M13-F (pUC) / M13-R (pUC) (pUC) were used to amplify and screen positive clones by PCR. The amplification conditions were as follows: 94℃5min 30Cycle (94℃30sec, 55℃30sec, 72℃1min) 10℃hold on.

6. The method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525) according to claim 4, characterized in that: The PCR amplification system for primers flic-UP-F / flic-UP-R and flic-down-F / flic-down-R was: 94°C 5min 30Cycle (94°C 30sec, 55°C 30sec, 72°C 40sec) 10°C hold on; The PCR amplification system of primers flic-up-F / flic-down-R is: 94℃5min 2Cycle (94℃30sec, 50℃30sec, 68℃1min), 30cycle (94℃30sec, 55℃30sec, 68℃1min), 10℃hold on.

7. A method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525) according to claim 4 or 6, characterized in that: The base sequences of the primers are as follows: flic-up-F: TGCTGTATTGCGCGTTGATCGAG; flic-up-R:ACCCACGAGGATTTCGTCTAGCCATCGGTAGATGACTGAC; flic-down-R: ATCGACGCGCTGATCGTTGTGAC; flic-down-F: CATCTACCGATGGCTAGACGAAATCCCTCGTGGGTGGTGTA.

8. The method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525) according to claim 5, characterized in that: In step S4, the Flic-UD-T plasmid was used as a template and primers (flic-pT18-smaI-F / flicpT18-smaI-R) were used to amplify the target gene fragment; After single restriction digestion at the smaI site, pT18sacB was used to seamlessly clone and connect the target gene fragments, and the recombinant vector was placed on ice for 30 min, chemically transformed into Ecoli S17 pir competent cells, spread on resistance plates containing the selected antibiotics, and colony PCR identification was performed using primers (M13-F (pUC) / M13-R (pUC)).

9. The method for efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525) according to claim 5, characterized in that: In step S6, primers flic-JD-F / flic-JD-R were used to perform PCR identification on the knockout strain, and primers flic-ter-F / flic-ter-R were used to perform secondary identification on the knockout bacteria, and finally the PCR amplification products were sequenced and identified.

10. A Pseudomonas fluorescens (ATCC13525) with a knockout flic gene, characterized in that: The method is prepared by efficiently knocking out the flic gene of Pseudomonas fluorescens (ATCC13525) as described in any one of claims 1 to 9.

Images